Maize tail rot rpa-lfd detection primer and probe, kit and detection method thereof

Abstract

The application discloses a maize tail fungus RPA-LFD detection primer and probe, a kit and a detection method thereof, and belongs to the field of molecular detection. The detection primer comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID No. 1, the nucleotide sequence of the downstream primer is shown as SEQ ID No. 2, and the nucleotide sequence of the probe is shown as SEQ ID No. 3. The application designs special primers and probes for the DNA template of the corn gray spot pathogen maize tail fungus, can quickly, simply, specifically and sensitively detect the corn gray spot pathogen maize tail fungus, and effectively solves the problems of complicated detection, time consumption and labor consumption.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular detection, and particularly relates to a zea tail rot RPA-LFD detection primer and probe, a kit and a detection method thereof. BACKGROUND

[0002] Corn gray leaf spot (GLS) is a leaf disease that seriously harms corn production and is widely distributed in major corn-producing regions (the Americas, Asia, Africa, etc.) around the world. The disease mainly invades leaves, and at the early stage of the disease, it shows small yellow-brown spots, and with the development of the disease, it expands into a long rectangular or fusiform gray-brown spot limited by leaf veins. When the disease occurs seriously, the leaf spots can cause leaf death, significantly reduce photosynthetic efficiency, and cause 20%-50% yield loss. Influenced by global climate change, changes in farming systems, and factors such as introduction of varieties, the disease has become one of the most threatening epidemic diseases in China's corn production, and has occurred in at least 17 provinces (autonomous regions and municipalities), posing a serious threat to corn yield and quality.

[0003] At present, four types of corn gray leaf spot pathogens have been identified in the world: Cercospora zeae-maydis, C. zeina, C. sorghivar., and an undetermined species (Cercospora sp.). Cercospora zeae-maydis was first discovered in Liaoning in 1991, and then rapidly spread to Jilin, Heilongjiang, and Inner Mongolia, and has now spread to North China's Shanxi, Shandong, Beijing, Tianjin, and Anhui provinces. C. zeina was first detected in Yunnan in 2001, and in 2003, it broke out and became the dominant pathogen in the local high-altitude mountainous areas. Driven by factors such as monsoon climate, the species has continued to spread northward to Guizhou, Chongqing, and Sichuan, and has gradually replaced Cercospora zeae-maydis as the dominant pathogen in Southwest China. It is worth noting that both species have recently been detected in northern provinces such as Liaoning, Hebei, and Shaanxi, indicating that C. zeina is expanding towards the main production areas in the north.

[0004] The main epidemic species in China is Cercospora zeae-maydis and Cercospora zeina, which are highly similar in morphological characteristics and pathogenicity, but differ significantly in growth characteristics, ecological adaptability and molecular genetic characteristics. The current methods for identifying the pathogen of corn grey leaf spot mainly include morphological observation of spore culture from leaf separation and PCR molecular detection. These detection methods are after the disease occurs, which is not conducive to early screening and prevention. At the same time, the PCR detection method has high requirements for the site, detection instrument and professional ability of personnel operation, and is not suitable for rapid detection in the field. Therefore, the development and establishment of a precise and rapid pathogen molecular detection technology system can not only accurately master the geographical distribution and population dynamics of the pathogen, but also help to analyze the genetic variation rules of the pathogen population, provide technical support for the disease epidemic early warning system, and help to develop targeted comprehensive prevention and control strategies. SUMMARY

[0005] The purpose of the present application is to provide a Cercospora zeae-maydis RPA-LFD detection primer and probe, a kit and a detection method thereof, which are designed for the DNA template of the corn grey leaf spot pathogen Cercospora zeae-maydis, and can quickly, simply, specifically and sensitively detect the corn grey leaf spot pathogen Cercospora zeae-maydis, effectively solving the problem of the existing detection being relatively complicated, time-consuming and labor-consuming.

[0006] To achieve the above-mentioned purpose, the present application provides the following technical solutions.

[0007] In a first aspect, the present application provides a Cercospora zeae-maydis RPA-LFD detection primer and probe, the primer comprising an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID No. 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 2; and the nucleotide sequence of the probe is shown in SEQ ID No. 3.

[0008] Further, the 5' end of the downstream primer is modified with a biotin group.

[0009] Further, the 5' end of the probe is connected with a fluorescent group, and the 3' end is connected with a modification group that suppresses polymerase extension or amplification.

[0010] Further, the fluorescent group is FAM, and the modification group that suppresses polymerase extension or amplification is C3spacer.

[0011] Further, the cytosine 15 bases away from the 3' end of the probe is replaced with tetrahydrofuran.

[0012] In a second aspect, the present application provides a Cercospora zeae-maydis RPA-LFD detection kit, comprising the Cercospora zeae-maydis RPA-LFD detection primer and probe.

[0013] Further, the kit further comprises a lateral flow test strip.

[0014] In a third aspect, the method for detecting the RPA-LFD of the maize tail rot includes the following steps:

[0015] (1) extracting DNA of the sample to be detected;

[0016] (2) using the DNA of the sample to be detected as a template, using the RPA-LFD detection primer and probe of the maize tail rot to establish a recombinase polymerase amplification system and perform RPA amplification reaction to obtain an RPA amplification product;

[0017] (3) adding the RPA amplification product to the lateral flow test strip, observing the color reaction of the control line and the detection line, and determining the detection result.

[0018] Further, the recombinase polymerase amplification system includes: 0.84 μL of upstream primer, 0.84 μL of downstream primer, 0.6 μL of probe, 10 μL of Rehydration Buffer, 1 μL of DNA template, 2 μL of Starter, and 4.72 μL of ddH2O.

[0019] Further, when observing the color reaction of the control line and the detection line and determining the detection result:

[0020] If the test strip has two purple-red bands, one is the quality control line and the other is the detection line, the result is positive, indicating that the amplification product is positive; if the test strip has only one purple-red band in the quality control area and no band in the detection area, the result is negative.

[0021] Based on the above technical solutions, the embodiments of the present application can at least produce the following technical effects:

[0022] The present application uses the recombinase-mediated isothermal amplification (PRA) technology to develop a new type of rapid visual molecular detection method for maize leaf spot disease by combining the nfo probe with the lateral flow chromatographic analysis diagnosis method. Finally, a new type of visual detection method is applied in the field to establish an efficient and rapid detection and prevention system for maize gray spot disease. At the same time, the detection method of the present application has the advantages of short detection time, high sensitivity and simple operation, and is especially suitable for rapid detection at the grassroots or on-site, and has important practical application value. BRIEF DESCRIPTION OF DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are only some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained from the structures shown in these drawings without creative labor.

[0024] Figure 1 is the RPA-LFD feasibility detection result of the present application, in which, a is the RPA-LFD reaction result; b is the PCR reaction result; C is the quality control line; M is the DNA Marker; T is the detection line; 1 is the corn gray spot pathogen Helminthosporium maydis; 2 is the negative control;

[0025] Figure 2 is the RPA-LFD sensitivity detection result of the present application, in which, a is the RPA-LFD reaction result; b is the PCR reaction result; C is the quality control line; T is the detection line; M is the DNA Marker; 1 is 20 ng.μL -1 ; 2 is 2 ng.μL -1 ; 3 is 200 pg.μL -1 ; 4 is 20 pg.μL -1 ; 5 is 2 pg.μL -1 ; 6 is 200 fg.μL -1 ; 7 is 20 fg.μL -1 ; 8 is 2 fg.μL -1 ;

[0026] Figure 3 is the RPA-LFD specificity detection result of the present application, in which, a is the RPA-LFD reaction result; b is the PCR reaction result; C is the quality control line; T is the detection line; M is the DNA Marker; 1 is the corn gray spot pathogen Helminthosporium maydis; 2 is the corn gray spot pathogen Cercospora zeae-maydis; 3 is the corn large spot pathogen Exserohilum turcicum; 4 is the corn small spot pathogen Bremia graminicola; 5 is the corn anthracnose pathogen Glomerella cingulata; 6 is the corn Fusarium graminearum; 7 is the corn white spot pathogen Pseudomonas cichorii; 8 is the control group;

[0027] Figure 4RPA-LFD detection results of the RPA-LFD blade of the application, in the figure, a is the RPA-LFD reaction result; b is the PCR reaction result; C is the quality control line; T is the detection line; M is the DNA marker; 1 is the positive control; 2 is the negative control; 3 is the healthy blade; 4 is the maize tail rot infected blade ZM-1; 5 is the maize tail rot infected blade ZM-2; 6 is the maize tail rot infected blade ZM-3; 7 is the maize tail rot infected blade ZM-4; 8 is the maize tail rot infected blade ZM-5; 9 is the corn tail rot infected blade Zei-1; 10 is the corn tail rot infected blade Zei-2. DETAILED DESCRIPTION

[0028] The technical solutions in the embodiments of the application will be described below in a clear and complete manner. Obviously, the described embodiments are only a part of the embodiments of the application, rather than all the embodiments. Based on the embodiments in the application, all other embodiments obtained by those skilled in the art without creative work are within the protection scope of the application. In addition, the technical solutions of various embodiments can be combined with each other, but it must be based on the fact that a person skilled in the art can realize it. When the combination of technical solutions appears contradictory or unachievable, it should be considered that the combination of technical solutions does not exist and is not within the protection scope of the application.

[0029] 1. MATERIALS

[0030] 1.1 Experimental materials

[0031] The test strains were isolated and preserved by the Plant Protection Institute of Sichuan Academy of Agricultural Sciences, and the specific information is shown in Table 1. The infected blade was collected in Henan, Yunnan and Guizhou in 2024. The main reagents: DNA extraction kit (NuClean Plant Genomic DNA Kit) was purchased from Kangwei Century, Taq enzyme was purchased from Novozyme Company. RPA-LFD isothermal amplification reagent kit was purchased from Shenzhen Yizhi Biological Technology DNA constant temperature amplification reagent kit (test paper type).

[0032] 1.2. Experimental instruments

[0033] NanaDrop2000 ultramicro UV spectrophotometer, Eppendorf ThermoMixer® C-shaking instrument, agarose electrophoresis instrument.

[0034] 1.3. DNA extraction of test strains

[0035] All test strains were inoculated on PDA solid medium plates and incubated at 26°C for 5-7 days. Genomic DNA of each test strain was extracted using a plant genomic DNA extraction kit and dissolved in 80 μL of ddH2O. The DNA concentration was determined using a spectrophotometer (NanaDrop 2000), and the DNA was stored at -20°C for later use.

[0036] Table 1 Test strain information

[0037]

[0038] Table 2 Leaf with bacteria information

[0039]

[0040] 2. Experimental methods and results

[0041] Example 1: Selection of specific sequences of the corn gray leaf spot pathogen Cercospora zeae-maydis and design of primers and probes

[0042] The full genomic sequence of Cercospora zeae-maydis published on NCBI, Cercospora zeae-maydis AY170476, was selected, and the following specific genomic sequence fragments were selected as target amplification fragments through whole genome homologous sequence alignment. The upstream and downstream primers were designed on the amplification fragment, and the nfo detection probe was located between the upstream and downstream primers. The upstream and downstream primers were used for fragment amplification, and the nfo probe and the downstream primer with Biotin were used together for LFD detection. The primer and probe sequences are shown in Table 3 below.

[0043] The sequence of Cercospora zeae-maydis is as follows:

[0044] TATATTATAGCGATTAGCTATATCTTCCTAAGGACTACGTACTACGGACGTAGGTAATCCGTATATACTACGATAATCTACTCGCTAGTTACTTTAGTAAGGATAAAACTACCGAGTTAGTATAGCGGAAGTATTACTAGCTAGGCATATCTACGGATATTAGCTAGTACGTCTAATCCTATTAGGAGTATTAAGTATCGAAGGCGAGACGCTATCGACTATATAGCGAGCTATTAGCATTACCGTAGCTAGAGCTTCTATAGAAGGAGCTAACTATAGACTTTATTACGGACCTACCGCTTAGTAAGCGAGATATATACGTATATAATGCGGTCCTAGTAATTATCGACCGGTACTTAAAGATAAACCTCTTTATACTAACTACTAAGAAATATATAAGCGTAGATCTCGTATAGATCCTAATTAATAGGGTAATTTGCCGATTCGGAATGCTATATAGAATTATAAGCAATAGAGGCACTAT.

[0045] Table 3 Primer probe sequences

[0046]

[0047] Example 2: Establishment and detection of RPA-LFD reaction system

[0048] RPA-LFD reaction system: 20 μL reaction system, add (note: operate on ice) upstream primer ZM1-F (10 μM) 0.84 μL, downstream primer ZM3-R-biotin (10 μM) 0.84 μL, probe ZM-nfo (4 μM) 0.6 μL, Rehydration Buffer (2X) 10 μL, DNA template 1 μL, Starter (10X) 2 μL, ddH2O 4.72 μL, wherein deionized water is used instead of DNA template in the negative control group.

[0049] RPA reaction conditions and lateral flow dipstick (LFD) detection: The prepared RPA reaction solution was incubated in a ThermoMixer® C at 41°C for 30 min. After incubation, 10 μL of the amplification product was added to 80 μL of diluent buffer, mixed, and added to the dipstick for detection within five minutes. The results were observed by the naked eye: if two purple-red bands appeared on the dipstick, one was the quality control line and the other was the detection line, the result was positive, indicating that the amplification product was positive; if only one purple-red band appeared in the quality control area and no band appeared in the detection area, the result was negative. As shown in FIG. 2, the band with pathogenic bacterial genomic DNA showed two bands, indicating a positive detection result, while the negative control (sterilized ddH2O) only had one band in the quality control area, indicating no amplification, which was the same result as the PCR reaction using only F2 / R3 primers. Figure 1

[0050] Example 3: RPA-LFD sensitivity detection

[0051] The Cercospora zeae-maydis genomic DNA was diluted by 10-fold gradient with sterilized ddH2O, and genomic DNA at 20 ng.μL -1 , 2 ng.μL -1 , 0.2 ng.μL -1 , 20 pg.μL -1 , 2 pg.μL -1 , 0.2 pg.μL -1 , 20 fg.μL -1 , and 2 fg.μL -1 was selected as the RPA-LFD reaction template to detect the sensitivity of Cercospora zeae-maydis genomic DNA, and the detection sensitivity was evaluated according to the detection results. As shown in FIG. 3, the results showed that the concentration of Cercospora zeae-maydis genomic DNA was higher than 20 fg.μL -1 The detection results of the above treatments were all positive, that is, the LFD dipstick had clear quality control lines and detection lines, indicating that the established RPA-LFD method had a detection sensitivity of 20 fg.μL -1 for Cercospora zeae-maydis genomic DNA. The detection sensitivity of the PCR reaction using the same primers was basically the same, indicating that the RPA-LFD method had very high detection sensitivity. Figure 2

[0052] Example 4: RPA-LFD specificity detection

[0053] ​​To verify the specificity of RPA-LFD to Cercospora zeae-maydis, the genomes of other common corn leaf spot pathogens (Table 1) were used as templates for specificity verification using RPA-LFD, with Cercospora zeae-maydis genomic DNA as a positive control and sterilized ddH2O as a negative control. The RPA amplification products were detected using LFD test strips. As shown in Figure 3 the detection results showed that only Cercospora zeae-maydis genomic DNA had positive amplification results, the LFD test strip had obvious quality control lines and detection lines, while the other pathogens and sterile water had no amplification products and were all negative, especially for another pathogen of corn gray leaf spot, Cercospora Zeina, which also had no non-specific detection, thus the results showed that the established RPA-LFD had strong specificity to Cercospora zeae-maydis.

[0054] Example 5: Leaf tissue with bacteria detection

[0055] Leaf tissue with bacteria detection: The collected corn gray leaf spot leaf tissues from different locations (Table 2) were used to extract genomic DNA using a plant genomic DNA extraction kit, and RPA-LFD was used for detection, with Cercospora zeae-maydis purified bacteria genomic DNA as a positive control, and sterile ddH2O and healthy leaves as negative controls. The PCR detection results were compared as shown in Figure 4 all the bacteria-containing leaves (PCR-positive samples) had positive RPA-LFD detection results, while the PCR-negative corn leaves (healthy leaves) had negative RPA-LFD detection, indicating that the established RPA-LFD could specifically detect Cercospora zeae-maydis in plant leaves, and would not produce non-specific detection of leaves infected with Cercospora zeae-maydis.

[0056] The above shows and describes the basic principles and main features of the present application and the advantages of the present application. Those skilled in the art should understand that the present application is not limited by the above examples, and the above examples and descriptions in the specification are only to illustrate the principles of the present application, and various changes and improvements can be made without departing from the spirit and scope of the present application, and these changes and improvements all fall within the scope of the claimed present application. The scope of protection of the present application is defined by the appended claims and their equivalents.

Claims

1. A primer and probe for detection of Xanthomonas campestris RPA-LFD, characterized in that, The primer comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID No. 1, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 2; the nucleotide sequence of the probe is shown as SEQ ID No. 3; The 5' end of the downstream primer is modified with a biotin group; the 5' end of the probe is connected with a fluorescent group, and the 3' end is connected with a modification group for inhibiting polymerase extension or amplification; the fluorescent group is FAM, and the modification group for inhibiting polymerase extension or amplification is C3spacer; the cytosine 16 bases away from the 3' end of the probe is replaced with tetrahydrofuran.

2. A maize Aspergillus ear rot RPA-LFD test kit characterized in that, The kit comprises the maize Aspergillus RPA-LFD detection primer and probe of claim 1.

3. The maize (Zea mays) race 1 (RPA-LFD) test kit of claim 2, wherein, The kit further comprises a lateral flow test strip.

4. A method for detection of Xanthomonas campestris RPA-LFD, characterized in that, The kit comprises the following steps: (1) extracting DNA of a sample to be detected; (2) establishing a recombinase polymerase amplification system and performing RPA amplification reaction by taking the DNA of the sample to be detected as a template and the maize Aspergillus RPA-LFD detection primer and probe of claim 1, to obtain an RPA amplification product; (3) adding the RPA amplification product to the lateral flow test strip, observing the color reaction of the control line and the detection line, and determining the detection result.

5. The method for detecting Cercospora zeylansium RPA-LFD according to claim 4, characterized in that, When observing the color reaction of the control line and the detection line and determining the detection result: If two purple-red bands appear on the test strip, one is the quality control line and the other is the detection line, the result is positive, indicating that the amplification product is positive; if only one purple-red band appears in the quality control area of the test strip and no band appears in the detection area, the result is negative.

Images