Use of agents that detect, inhibit micropeptide miPEP70 or rosmarinic acid

By identifying and targeting miPEP70, which is highly expressed in nasopharyngeal carcinoma, and inhibiting miPEP70 using rocetin and the CRISPR/Cas9 system, the diagnostic and treatment challenges of nasopharyngeal carcinoma have been solved, enabling early diagnosis and effective treatment, and improving patient survival rates.

CN120801712BActive Publication Date: 2025-11-25HUNAN PROVINCIAL PEOPLES HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511251770.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-03
Publication Date
2025-11-25
Estimated Expiration
2045-09-03

AI Technical Summary

Technical Problem

Existing technologies are unable to effectively inhibit the expression and function of miPEP70 in the treatment of nasopharyngeal carcinoma, leading to local recurrence and distant metastasis, reducing the 5-year survival rate of patients, and lacking effective diagnostic and therapeutic targets.

Method used

We discovered and validated that the micropeptide miPEP70 encoded by LINC00510 is highly expressed in nasopharyngeal carcinoma. We designed and synthesized rocetin to target miPEP70, knocked out miPEP70 using the CRISPR/Cas9 system, developed ELISA and immunohistochemical reagents to detect miPEP70, and utilized rocetin to inhibit the interaction between miPEP70 and YTHDF1 to develop a therapeutic drug for nasopharyngeal carcinoma.

Benefits of technology

miPEP70 serves as a biomarker for early diagnosis and prognostic monitoring in nasopharyngeal carcinoma. Rochetomycin significantly inhibits the proliferation, migration, and invasion of nasopharyngeal carcinoma cells. The CRISPR/Cas9 system effectively knocks out miPEP70, improving the treatment efficacy of nasopharyngeal carcinoma.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120801712B_ABST
    Figure CN120801712B_ABST
Patent Text Reader

Abstract

The application belongs to the field of tumor molecular biology technology, and particularly relates to application of a reagent for detecting and inhibiting micropeptide miPEP70 or leucovorin. The application finds that the micropeptide miPEP70 promotes the proliferation, migration and invasion of nasopharyngeal carcinoma cells, and the micropeptide can be used as a biomarker for diagnosis and prognosis of nasopharyngeal carcinoma and a therapeutic target. Especially, a polyclonal antibody designed for miPEP70 can specifically detect the expression of miPEP70 protein in cells and tissues. The miPEP70 can interact with YTHDF1 to up-regulate the protein expression of YTHDF1 and promote the malignant progression of nasopharyngeal carcinoma. The leucovorin can hinder the interaction between miPEP70 and YTHDF1 and play an anti-tumor role. Therefore, the miPEP70 provides a good application prospect for diagnosis, prognosis and treatment of nasopharyngeal carcinoma.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of tumor molecular biology technology, and particularly relates to the application of a reagent for detecting and inhibiting micropeptide miPEP70 or rosmarinus. BACKGROUND

[0002] Nasopharyngeal carcinoma (NPC) is a common head and neck malignancy. At present, the comprehensive treatment with radiotherapy as the main mode can cure most of the early NPC patients, but part of the patients still have local recurrence and distant metastasis after receiving the treatment, which eventually leads to the reduction of 5-year survival rate. This is related to the factors such as the occult site of NPC and strong local invasion ability, and the complex gene regulation network and the interaction between genes and tumor microenvironment fundamentally restrict the efficacy of NPC. Therefore, it has become a key problem urgently to be solved in the field of NPC prevention and treatment to comprehensively study the molecular mechanism of malignant progression of nasopharyngeal carcinoma, and to explore the diagnostic, prognostic markers and effective treatment targets of nasopharyngeal carcinoma.

[0003] People have identified the existence of different lncRNA coding micropeptides in various tumors, and the expression levels of these micropeptides are closely related to the early diagnosis and prognosis of tumor patients, and can promote the malignant progression of tumors through different molecular mechanisms. Therefore, developing more new lncRNA coding micropeptides as tumor diagnosis, prognosis biomarkers and treatment targets will have broad application prospects. SUMMARY

[0004] The present application detects that LINC00510 can encode a micropeptide with a length of 70 aa, which is named as miPEP70. miPEP70 is highly expressed in nasopharyngeal carcinoma, and can promote the proliferation, invasion and radiotherapy resistance of nasopharyngeal carcinoma cells, and is likely to be used as a diagnostic, prognostic biomarker and treatment target of nasopharyngeal carcinoma. The small molecule compound rosmarinus can target miPEP70 and destroy the interaction between miPEP70 and YTHDF1, and is likely to be used as a potential drug for the treatment of nasopharyngeal carcinoma.

[0005] Specifically, a small open reading frame (sORF) of 213 bases is found in LINC00510 (NR_145434.1, the sequence is shown as SEQ ID NO. 1), which can encode a micropeptide miPEP70 of 70 amino acids, and the small peptide has a molecular weight of about 8 kDa. The LINC00510 sORF has the nucleotide sequence shown in SEQ ID NO. 2; the miPEP70 has the amino acid sequence of SEQ ID NO. 3.

[0006] The present application can achieve the following purposes: the first aspect of the present application is to provide a micropeptide miPEP70, the amino acid sequence of which is shown as SEQ ID NO. 3.

[0007] The second aspect of the present application is to provide an antibody prepared by using the micropeptide miPEP70, which is a polyclonal antibody capable of specifically binding to the micropeptide miPEP70. The epitope sequence of the polyclonal antibody is shown as SEQ ID NO. 4.

[0008] The third aspect of the present application is to provide the use of a reagent for detecting the micropeptide miPEP70 in the preparation of a nasopharyngeal carcinoma diagnosis and / or prognosis preparation.

[0009] Further,

[0010] The reagent for detecting the micropeptide miPEP70 includes an immunohistochemical detection reagent or an Elisa detection reagent, and the Elisa detection reagent contains an miPEP70 antibody, an antigen and a standard required for Elisa detection.

[0011] The fourth aspect of the present application is to provide a nasopharyngeal carcinoma detection preparation, which contains a reagent for detecting the micropeptide miPEP70.

[0012] Further,

[0013] The reagent for detecting the micropeptide miPEP70 includes an immunohistochemical detection reagent or an Elisa detection reagent.

[0014] The fifth aspect of the present application is to provide the use of a reagent for inhibiting the micropeptide miPEP70 in the preparation of a nasopharyngeal carcinoma treatment preparation, the amino acid sequence of the micropeptide miPEP70 being shown as SEQ ID NO. 3.

[0015] Further,

[0016] The reagent for inhibiting the micropeptide miPEP70 includes a CRISPR / Cas9 system designed for miPEP70, and the preferred sequence of a Donor DNA (a donor DNA template) is shown as SEQ ID NO. 5.

[0017] The sixth aspect of the present application is to provide a medicine for treating nasopharyngeal carcinoma, which contains a CRISPR / Cas9 system designed for miPEP70, the amino acid sequence of the micropeptide miPEP70 being shown as SEQ ID NO. 3, and the preferred sequence of a Donor DNA being shown as SEQ ID NO. 5.

[0018] The seventh aspect of the present application is to provide the use of a rosmarinus in the preparation of a nasopharyngeal carcinoma treatment medicine.

[0019] By research, it is found that LINC00510 is located on human chromosome 1, and the full-length sequence thereof contains 5 different isomers. LINC00510 forms a complete small open reading frame (213 bp) across the exon region, encodes 70 amino acids, and the protein molecular weight is about 8 kDa, hereinafter referred to as miPEP70 micro peptide or miPEP70. By coomassie brilliant blue staining, the presence of miPEP70 is found by mass spectrometry identification (). Figure 1 ).

[0020] Based on the antibody designed for miPEP70, it is found by western blot and immunohistochemical experiments that miPEP70 is up-regulated in a variety of nasopharyngeal carcinoma cell lines and nasopharyngeal carcinoma patient tissue samples, and further survival analysis shows that nasopharyngeal carcinoma patients with high expression of miPEP70 have shorter overall survival, suggesting poor prognosis (. Figure 3 ).

[0021] By biological function research, it is found that miPEP70 can promote the proliferation, migration and invasion of nasopharyngeal carcinoma cells; in contrast, knocking out miPEP70 has the opposite effect of inhibiting the proliferation, migration and invasion of nasopharyngeal carcinoma cells. Further recovery experiments show that in the miPEP70-knocked-out nasopharyngeal carcinoma cells, transfection of the miPEP70 ORF plasmid (re-expression of miPEP70) can promote the proliferation, migration and invasion of nasopharyngeal carcinoma cells, however, transfection of the miPEP70 ORF promoter mutant plasmid (which cannot re-express miPEP70) does not have the above-mentioned pro-tumor function, indicating that the micro peptide miPEP70 has the function of promoting the progression of nasopharyngeal carcinoma (. Figures 4-6 ).

[0022] The animal experiment results of the present application show that miPEP70 can promote the subcutaneous tumor formation of nasopharyngeal carcinoma cells in nude mice, and knocking out miPEP70 inhibits the subcutaneous tumor formation of nasopharyngeal carcinoma cells in nude mice. Further recovery experiments show that on the basis of miPEP70 knock-out, transfection of the miPEP70 ORF plasmid (re-expression of miPEP70) can promote the subcutaneous tumor formation of nasopharyngeal carcinoma cells in nude mice, and on the contrary, on the basis of miPEP70 knock-out, transfection of the miPEP70 ORF promoter mutant plasmid (which cannot re-express miPEP70) does not have the above-mentioned pro-tumor function (. Figure 7 ).

[0023] It is found by molecular mechanism research that miPEP70 can interact with m6A reading protein YTHDF1; it is further found that overexpression of miPEP70 can promote the protein expression of YTHDF1; compared with, knockout of miPEP70 can inhibit the protein expression of YTHDF1; the recovery experiment shows that in the nasopharyngeal carcinoma cell with knockout of miPEP70, transfection of the miPEP70 ORF plasmid (re-expression of miPEP70) can restore the protein expression of YTHDF1, however, transfection of the miPEP70 ORF promoter mutant plasmid (which cannot re-express miPEP70) cannot restore the protein expression of YTHDF1, indicating that YTHDF1 is the downstream protein of miPEP70. Figure 8 .

[0024] It is found by rescue experiment that miPEP70 can promote the proliferation, migration and invasion of nasopharyngeal carcinoma cells, and knockout of miPEP70 can inhibit the proliferation, migration and invasion of nasopharyngeal carcinoma cells; compared with the control group (KO+Vector group), restoration of the expression of YTHDF1 (KO+YTHDF1) can promote the proliferation, migration and invasion of nasopharyngeal carcinoma cells on the basis of knockout of miPEP70, which indicates that miPEP70 promotes the progression of nasopharyngeal carcinoma by up-regulating the protein level of YTHDF1. Figure 9 .

[0025] It is found by molecular docking software prediction that the small molecule compound rosmarinicine can hinder the combination of miPEP70 and YTHDF1, thereby playing an anti-tumor role; the half-inhibitory concentration experiment shows that rosmarinicine has an inhibitory effect on the proliferation of nasopharyngeal carcinoma cells; compared with the control group (PBS), rosmarinicine treatment can weaken the interaction of miPEP70 and YTHDF1 in nasopharyngeal carcinoma cells; biological function research shows that compared with the control group (PBS), rosmarinicine treatment can weaken the promoting effect of miPEP70 on the proliferation, migration and invasion of nasopharyngeal carcinoma cells, and rosmarinicine can inhibit the proliferation, migration and invasion of nasopharyngeal carcinoma cells. Figure 10 .

[0026] The Elisa experiment result of the application shows that miPEP70 can be detected in the peripheral blood serum of nasopharyngeal carcinoma patients, and the expression of miPEP70 in the peripheral blood serum of nasopharyngeal carcinoma patients is up-regulated compared with healthy subjects; in addition, the high expression of serum miPEP70 is related to the clinical stage of nasopharyngeal carcinoma patients, which indicates the feasibility and reliability of the newly found miPEP70 as a nasopharyngeal carcinoma biomarker. Figure 11 .

[0027] CRISPR / Cas9 is one of the three major gene editing technologies, CRISPR / Cas9 is composed of two parts of endonuclease (Cas9) and guide RNA, in which Cas9 nuclease has the function of cutting double-stranded DNA, and guide RNA is responsible for guiding Cas9 to cut the target site. After the CRISPR / Cas9 system produces a double-stranded DNA gap, it is repaired by two ways of non-homologous end joining (NHEJ) or homologous directed repair (HDR). When Cas endonuclease cuts double-stranded DNA, and a highly homologous DNA repair template exists, the HDR repair method is started in the organism, and a segment of exogenous DNA is inserted into the gene, which is called CRISPR / CAS9 gene knock-in system (KI). Through such a way, the miPEP70 ORF promoter ATG can be directed to mutate into ATT, which causes the translation to be unable to start, so as to achieve the effect of knocking out miPEP70.

[0028] By gene editing for miPEP70, the goal of gene therapy for tumors, especially nasopharyngeal carcinoma, is achieved.

[0029] In the present application, the "micropeptide", "small peptide", "short peptide", "polypeptide" should be understood as having the same meaning to express the amino acid fragment. In addition to the micropeptide of the amino acid sequence described in SEQ ID NO. 3, the micropeptide of the present application sequence modified in the prior art is also understood to have the tumor inhibitory effect described in the present application. For example, polypeptide preparations can have a short circulating half-life and proteolytic degradation and low solubility. In order to improve the pharmacokinetic and pharmacodynamic characteristics of the biological drugs of the present application, methods such as manipulating the amino acid sequence can be used to reduce or increase immunogenicity and reduce proteolytic cleavage; the peptide can be fused or coupled to immunoglobulin and serum protein, such as albumin; it can also be incorporated into drug delivery carriers for biological drugs (such as the peptides of the present application) and antibodies to protect and slow down release; and coupling to natural or synthetic polymers is also envisaged. Specifically, for synthetic polymer coupling, pegylation or acylation such as N-acylation, S-acylation, amidation, etc. is also envisaged.

[0030] As used herein, "pharmaceutical excipients or pharmaceutical carriers" include any and all solvents, dispersion media, nanocarriers, coatings, antibacterial and antifungal agents, isotonic agents, and absorption delay agents. The use of such media and agents for pharmaceutically active substances is well known in the art. Unless any conventional media or agent is incompatible with the active ingredient, its use in therapeutic compositions is contemplated. Supplemental active ingredients may also be incorporated into the composition. The use of such media and agents for pharmaceutically active substances is well known in the art. Unless any conventional media or agent is incompatible with the active ingredient, its use in therapeutic compositions is contemplated. Supplemental active ingredients may also be incorporated into the pharmaceutical compositions described herein.

[0031] Drug compounds can be administered in convenient ways, such as via oral, intravenous (in the case of water-soluble compounds), intramuscular, subcutaneous, intraperitoneal, nasal, intradermal, or suppository routes, or implantation (e.g., via intraperitoneal route using slow-release molecules or by using cells or lentiviruses and subsequently transferring to the recipient). Depending on the route of administration, it may be necessary to encapsulate the active ingredient in a material to protect it from enzymes, acids, and other natural conditions that may inactivate the ingredient.

[0032] The beneficial effects of this invention are:

[0033] 1. This invention is the first to discover the micropeptide miPEP70 in nasopharyngeal carcinoma. This micropeptide is encoded by a 213bp ORF on LINC00510, with a relative molecular weight of approximately 8 kDa. miPEP70 is naturally endogenously expressed and upregulated in nasopharyngeal carcinoma cell lines and tissues, suggesting that miPEP70 can serve as a potential biomarker for nasopharyngeal carcinoma screening.

[0034] 2. This invention restores miPEP70 expression in nasopharyngeal carcinoma cell lines where miPEP70 is knocked out. Through in vitro cell phenotype experiments and in vivo xenograft tumor models, it was found that miPEP70 can promote the proliferation, migration and invasion of nasopharyngeal carcinoma cells, suggesting that miPEP70 can serve as a potential therapeutic target for nasopharyngeal carcinoma.

[0035] 3. Based on the exploration of the carcinogenic molecular mechanism of miPEP70, this invention screened out rocetin, a small molecule compound that can target miPEP70, suggesting that rocetin can be used as a novel drug for anti-tumor treatment of nasopharyngeal carcinoma.

[0036] 4. Based on the newly discovered miPEP70, the chemically synthesized miPEP70 micropeptide and the prepared miPEP70 antibody and its antigen, this invention can provide an ELISA detection kit for detecting miPEP70 expression in peripheral blood serum of nasopharyngeal carcinoma patients, which can provide a new strategy for the early diagnosis or prognostic monitoring of nasopharyngeal carcinoma. Attached Figure Description

[0037] Figure 1 Schematic diagram of miPEP70 expression;

[0038] in Figure 1 A: Coomassie blue staining results show the effects of overexpression of the full-length LINC00510 sequence on human chromosome 1, which contains five different splice isoforms (tv1-tv5). Figure 1 B: Schematic diagram of the ORF encoding miPEP70 and amino acid diagram; Figure 1 C: Coomassie blue staining showed that HEK293 cells overexpressing LINC00510 exhibited an enriched band around 8 kDa; Figure 1 D: Schematic diagram of LINC00510, Flag-labeled ORF and its promoter mutant plasmid; Figure 1 E: Western blotting's ability to detect ORF-encoded micropeptides in HEK293 cells; Figure 1 F: Western blotting's ability to detect ORF-encoded micropeptides in HONE1 cells.

[0039] Figure 2 Validate the miPEP70 antibody results;

[0040] in Figure 2 A: qRT-PCR detection of the interference effect of LINC00510; Figure 2 B: Western blotting was used to detect the protein expression of miPEP70; Figure 2 C: Representative immunofluorescence images showing miPEP70 expression; Green: miPEP70, Blue: DAPI, Scale bar: 5μm; .

[0041] Figure 3 Results of miPEP70 expression in nasopharyngeal carcinoma cells and nasopharyngeal carcinoma tissues;

[0042] in Figure 3 A: qRT-PCR was used to detect the expression level of LINC00510 in immortalized nasopharyngeal epithelial cells NP69 and eight different nasopharyngeal carcinoma lines; Figure 3 B: Western blotting was used to detect the expression level of miPEP70 in immortalized nasopharyngeal epithelial cells NP69 and eight different nasopharyngeal carcinoma lines; Figure 3 C: Representative images from immunohistochemical experiments show the expression levels of miPEP70 in adjacent normal tissue (NPE) and nasopharyngeal carcinoma (NPC) tissues. Scale bar: 20 μm; Figure 3D: Chi-square test analysis shows that high expression of miPEP70 is associated with the occurrence of NPC in the training set; Figure 3 E: Chi-square test analysis shows that high expression of miPEP70 is associated with the occurrence of NPC in the validation set; Figure 3 F: Kaplan-Meier analysis shows the overall survival of NPC patients in the training set; Figure 3 G: Kaplan-Meier analysis shows the overall survival of NPC patients in the validation set; ; ; .

[0043] Figure 4 . Results of constructing miPEP70 expression changed nasopharyngeal carcinoma cell line model;

[0044] Wherein Figure 4 A: Schematic diagram of constructing miPEP70 knockout cell model using CRISPR / Cas9 technology; Figure 4 B: qRT-PCR detects the expression of LINC00510 in nasopharyngeal carcinoma cell lines; Figure 4 C: Western blotting shows that miPEP70 is successfully knocked out; Figure 4 D: Western blotting shows that the miPEP70 expression changed cell model is successfully constructed in 5-8F cells; Figure 4 E: Western blotting shows that the miPEP70 expression changed cell model is successfully constructed in 6-10B cells; Figure 4 F: Western blotting shows that the miPEP70 expression changed cell model is successfully constructed in C666-1 cells; Figure 4 G: Western blotting shows that the miPEP70 expression changed cell model is successfully constructed in HONE1 cells.

[0045] Figure 5 . Results of miPEP70 promoting the proliferation of nasopharyngeal carcinoma cells;

[0046] Wherein Figure 5 A: CCK-8 experiment detects the effect of miPEP70 on the proliferation of C666-1 cells; Figure 5 B: CCK-8 experiment detects the effect of miPEP70 on the proliferation of HONE1 cells; .

[0047] Figure 6 . Results of miPEP70 promoting the migration and invasion of nasopharyngeal carcinoma cells;

[0048] WhereinFigure 6 A: Transwell migration and invasion experiment to detect the effect of miPEP70 on the migration and invasion of 5-8F cells; Figure 6 B: Transwell migration and invasion experiment to detect the effect of miPEP70 on the migration and invasion of 6-10B cells; Figure 6 C: Migration statistics of 5-8F cells; Figure 6 D: Invasion statistics of 5-8F cells; Figure 6 E: Migration statistics of 6-10B cells; Figure 7 F: Invasion statistics of 6-10B cells; Scale bar: 50 μm; .

[0049] Figure 7 . Results of miPEP70 promoting the proliferation of nasopharyngeal carcinoma cells in vivo;

[0050] Wherein Figure 7 A: Image of subcutaneous tumor formed by transplanting HONE1 cells with changed miPEP70 expression into nude mice; Figure 7 B: Tumor weight statistics; Figure 8 C: Tumor growth curve; ; .

[0051] Figure 8 . Results of miPEP70 interacting with YTHDF1 and promoting the protein expression of YTHDF1;

[0052] Wherein Figure 8 A: Screening mode diagram of miPEP70 interacting proteins; Figure 8 B: CO-IP to detect the interaction between miPEP70 and YTHDF1; Figure 8 C: Duolink PLA proximity ligation experiment detected positive interaction signal in 5-8F and HONE1 cells; Scale bar: 5 μm; Figure 9 D: Western blotting to detect the effect of miPEP70 expression change in C666-1 and HONE1 cells on YTHDF1 protein expression.

[0053] Figure 9 . Results of miPEP70 / YTHDF1 signaling axis promoting the proliferation, migration and invasion of nasopharyngeal carcinoma cells;

[0054] Wherein Figure 9 A: Western blot results showing the successful construction of YTHDF1 expression restoration cell model in miPEP70 knockout C666-1 cells; Figure 9B: Western blot results show the successful construction of the YTHDF1 expression restoration cell model in miPEP70 knockout HONE1 cells; Figure 9 C: CCK-8 experiment to detect the effect of YTHDF1 expression restoration on the proliferation of miPEP70 knockout C666-1 cells; Figure 9 D: CCK-8 experiment to detect the effect of YTHDF1 expression restoration on the proliferation of miPEP70 knockout HONE1 cells; Figure 9 E: Transwell migration and invasion experiment to detect the effect of YTHDF1 expression restoration on the migration and invasion of miPEP70 knockout 5-8F cells; Figure 9 F: Transwell migration and invasion experiment to detect the effect of YTHDF1 expression restoration on the migration and invasion of miPEP70 knockout 6-10B cells; Figure 9 G: Migration statistics of 5-8F cells; Figure 9 H: Invasion statistics of 5-8F cells; Figure 10 I: Migration statistics of 6-10B cells; Figure 10 J: Invasion statistics of 6-10B cells; ; .

[0055] Figure 10 . Results of rosmarinic acid disrupting the interaction between miPEP70 and YTHDF1 to inhibit the malignant progression of nasopharyngeal carcinoma;

[0056] wherein Figure 10 A: Molecular docking predicts the mode of rosmarinic acid disrupting the interaction between miPEP70 and YTHDF1; Figure 10 B: The results of the half-inhibitory concentration experiment show that rosmarinic acid can inhibit the proliferation of nasopharyngeal carcinoma cells; Figure 10 C: CO-IP experiment to detect the effect of rosmarinic acid on the interaction between miPEP70 and YTHDF1; Figure 10 D: Duolink PLA proximity ligation experiment to detect the effect of rosmarinic acid on the interaction between miPEP70 and YTHDF1; Figure 10 E: Western blot results show that rosmarinic acid can down-regulate the protein expression of YTHDF1 in C666-1 cells; Figure 10 F: Western blot results show that rosmarinic acid can down-regulate the protein expression of YTHDF1 in HONE1 cells; Figure 11 G: CCK-8 experiment to detect the effect of rosmarinic acid on the proliferation of C666-1 cells; Figure 11 H: CCK-8 experiment to detect the effect of rosmarinic acid on the proliferation of HONE1 cells; .

[0057] Figure 11 . The expression and clinical significance of miPEP70 in the peripheral blood serum of nasopharyngeal carcinoma patients

[0058] wherein Figure 11 A: Expression of miPEP70 in the peripheral blood serum of healthy subjects and nasopharyngeal carcinoma patients in the training set; Figure 11 B: Expression of miPEP70 in the peripheral blood serum of healthy subjects and nasopharyngeal carcinoma patients in the verification set; Figure 11 C: Expression of miPEP70 in the peripheral blood serum of nasopharyngeal carcinoma patients with different clinical stages in the training set; Figure 11 D: Expression of miPEP70 in the peripheral blood serum of nasopharyngeal carcinoma patients with different clinical stages in the verification set; Figure 1 E: ROC curve of the training set; Figure 1 F: ROC curve of the verification set; ; ; . DETAILED DESCRIPTION

[0059] The technical solutions in the embodiments of the present application will be described in a systematic manner in combination with the drawings in the embodiments of the present application. The described embodiments are only some of the embodiments of the present application, rather than all the embodiments. Some non-essential modifications and adjustments made by others according to the concept of the present application still fall within the protection scope of the present application.

[0060] The immortalized nasopharyngeal epithelial cells NP69 and the nasopharyngeal carcinoma cell lines CNE1, S18, S26, HNE2, 5-8F, 6-10B, C666-1 and HONE1 used in the present application are purchased from the Biomedical Center of the Central South University Research Center. The cell culture conditions are as follows: 10% fetal bovine serum (FBS) and 1% double-antibiotic (penicillin and streptomycin) RPMI1640 liquid medium, adherent growth in a constant temperature incubator at 37℃ and a CO2concentration of 5%.

[0061] The miPEP70 antibody of the present application is prepared by Gilon Biochemical (Shanghai) Co., Ltd. (polyclonal antibody against two segments of amino acid sequences).

[0062] The test results of the present application are analyzed by statistics, and t-test is used to evaluate the difference between two groups. , , All P values are tested by two sides. Statistical analysis is performed by SPSS 13.0 and Prism 8.3.0 software.

[0063] Example 1: Prediction and identification of LINC00510 coding micropeptide

[0064] Multiple open reading frames (ORF) with coding potential were found in LINC00510 (NR145433.1, NR 145434.1, NR 145435.1, NR145436.1, NR145437.1) by ORF Finder (https: / / www.ncbi.nlm.nih.gov / orffinder / ). Only NR145434.1 was found to have a 213 nt ORF (NR 145434.1) with coding potential by Coomassie blue staining experiment (see Figure 1 A), which can encode a 70-amino acid micropeptide (see Figure 1 B), named miPEP70. The relative molecular weight of miPEP70 was calculated to be about 8.08 kDa by protein relative molecular weight prediction software https: / / proteininformationresource.org / pirwww / search / comp_mw.shtml. The host gene LINC00510 of miPEP70 was transfected into HEK293 cells, and the cell lysate was collected and subjected to gel electrophoresis and Coomassie blue staining. An enriched blue band was detected near 8 kDa (see Figure 1 C). LINC00510, Flag-labeled ORF and its promoter mutant plasmids (see Figure 2 D) were constructed, transfected into HONE1 cells and the cell protein lysate was collected, and western blot was used to detect whether miPEP70 was encoded. The results showed that a Flag band was detected in the FLAG-ORF group, indicating that the predicted ORF indeed had coding function and could encode micropeptide miPEP70 (see Figure 2 E and 1F).

[0065] Vector: refers to the empty vector pcDNA3.1;

[0066] LINC00510: refers to a vector overexpressing LINC00510, which contains the ORF (213 nt) sequence but does not contain the FLAG tag;

[0067] FLAG-ORF: refers to a vector overexpressing ORF (213 nt) carrying a FLAG tag;

[0068] FLAG-ORF-mut: refers to a vector overmutating the first ATG of ORF (213 nt) carrying a FLAG tag, but cannot express the micropeptide encoded by the ORF.

[0069] Polyclonal antibodies specifically recognizing the miPEP70 micropeptide and detectable by Western blot and immunofluorescence were designed based on its amino acid sequence. The preparation method for the miPEP70 antibody is as follows: The micropeptide was chemically synthesized targeting the selected epitope sequence of miPEP70, achieving a purity >85%. It was then conjugated with the carrier protein KLH, mixed with the antigen, and used to immunize two New Zealand white rabbits to prepare the polyclonal antibody. The antigenic epitope sequence of the polyclonal antibody is shown in SEQ ID NO.4.

[0070] Example 2: Identification of miPEP70 antibody specificity

[0071] Interference plasmids targeting LINC00510 were designed based on the base sequence of the miPEP70 host gene LINC00510 (NR 145434.1, ENST00000830947.1). The interference sites of the plasmids avoided the ORF region on LINC00510. The control plasmid and the interference plasmid were transfected into the nasopharyngeal carcinoma HONE1 cell line, and cellular RNA and protein lysates were collected. The specificity of the miPEP70 antibody was detected using qRT-PCR and Western blot. The results showed that compared with the control group, the sh-LINC00510-1, sh-LINC00510-2, and sh-LINC00510-3 groups all significantly reduced the mRNA expression of LINC00510 (see...). Figure 2 A). Based on this, the use of miPEP70-specific antibody detection revealed that miPEP70 protein expression decreased as the mRNA expression of the host gene LINC00510 decreased (see A). Figure 3 B).

[0072] In summary, for the immunofluorescence assay, HONE1 cells from the above-treated groups were seeded onto cell culture slides. After cell adhesion, cells were fixed with 4% paraformaldehyde for 15 min and washed three times with PBS; cells were permeated with 0.1% Triton X-100 for 10 min and washed three times with PBS; cells were blocked with 3% BSA for 1 h; cells were incubated overnight at 4°C with miPEP70 antibody and washed three times with PBS; and finally, anti-Rabbit fluorescent secondary antibody (Alexa Fluor) was used. TM 488) Incubate at room temperature for 1 h, wash 3 times with PBS; stain nuclei with 4,6-diamidinyl-2-phenylindole (DAPI) at room temperature for 10 min, wash 3 times with PBS, wash 3 times with DEPC water; dry, mount, and observe under a laser confocal microscope. Results showed that compared with the Control group, the fluorescence intensity of sh-LINC00510-1, sh-LINC00510-2, and sh-LINC00510-3 groups was significantly reduced (see...). Figure 3 C).

[0073] Control: is the empty vector P11R;

[0074] sh-LINC00510-1: GCATGGAGCTGACAACCATGA

[0075] sh-LINC00510-2: TCTGACTTAGGAATAGAGACA

[0076] sh-LINC00510-3: CGGGTGATGGGCAGATTGGAA;

[0077] SEQ ID NO. 6-8, respectively.

[0078] Example 3: Identification of miPEP70 expression in nasopharyngeal carcinoma cell lines and nasopharyngeal carcinoma tissues

[0079] Immortalized nasopharyngeal epithelial cells NP69 and all nasopharyngeal carcinoma cell lines were cultured in RPMI-1640 complete medium containing 10% FBS, and the culture environment was 37°C, 5% CO2. All cells were lysed on ice for 30 min using RIPA lysis buffer containing protease inhibitors, the cells were scraped using a cell scraper and collected into 1.5 mL EP tubes, and the supernatant was transferred to a new EP tube after high-speed (14000g) centrifugation at 4°C for 30 min.

[0080] The RNA of NP69 and all nasopharyngeal carcinoma cell lines was collected, and after reverse transcription into cDNA, the LINC00510 mRNA expression level was detected in immortalized nasopharyngeal epithelial cells NP69 and different nasopharyngeal carcinoma cell lines (CNE1, S18, S26, HNE2, 5-8F, 6-10B, C666-1 and HONE1) using qRT-PCR (see Figure 3 A).

[0081] The protein concentration was determined using the BCA method, 2 mg / mL BCA standard protein was taken and gradiently diluted to obtain 0, 0.1, 0.2, 0.3, 0.4, 0.5 mg / mL gradient concentrations of standard protein solution; 20 μL of standard protein solution was added to the 96-well plate (3 replicates) in turn, followed by the addition of 20 μL (2 μL protein solution + 18 μL RIPA) of the protein solution of the cell line to be tested (3 replicates); the prepared BCA working solution was added to the 96-well plate (200 μL / well), and the absorbance value was measured at a wavelength of 562 nm after incubation at 37°C for 30 min. The standard protein curve was drawn and the protein concentration was calculated.

[0082] Based on the concentration of each protein, the amount of protein loaded was quantified to 40 μg, and the loading volume was quantified to 20 μL, the system was supplemented, and the protein expression of miPEP70 was detected in the immortalized nasopharyngeal epithelial cell NP69 and different nasopharyngeal carcinoma cell lines (CNE1, S18, S26, HNE2, 5-8F, 6-10B, C666-1 and HONE1) using western blot experiment. It was found that the expression of miPEP70 in all nasopharyngeal carcinoma cell lines was significantly up-regulated compared with NP69 cells (see Figure 3 B}.

[0083] The present application includes 69 cases of nasopharyngeal carcinoma tissue samples diagnosed in Hunan Provincial Tumor Hospital from January 2013 to December 2013, and the inclusion criteria are as follows: 1) patients diagnosed as nasopharyngeal carcinoma by postoperative pathological analysis; 2) complete medical records; 3) clinical features are 18-75 years old, gender is not limited; 4) exclusion criteria: combined with other malignant tumors. Among them, there are 21 cases of normal nasopharyngeal epithelial tissue (distance from tumor edge ≥1 cm), and 69 cases of nasopharyngeal carcinoma tissue. The expression of miPEP70 in paraffin-embedded nasopharyngeal carcinoma tissue and pericancer tissue was detected by immunohistochemical experiment. Briefly, the section was baked in a 70℃ oven for 2h, and then rehydrated in xylene and gradient ethanol; the section was placed in sodium citrate repair solution, and the antigen was repaired under high temperature and high pressure for 10min and naturally cooled; peroxidase blocker was added and incubated at room temperature for 10min, washed with PBS for 3 times; the primary antibody was added and incubated at 4℃ overnight, washed with PBS for 3 times; reaction enhancer was added and incubated at 37℃ for 20min, washed with PBS for 3 times; enzyme-labeled goat anti-mouse / rabbit IgG polymer secondary antibody was added and incubated at 37℃ for 20min, washed with PBS for 3 times; DAB color development, hematoxylin blue staining; dehydration, mounting, and observed under an optical microscope: the staining intensity was scored according to the staining degree (0 points, no staining; 1 point, weak staining; 2 points, strong staining). The proportion-based score positive signal accounts for the total number of cells (0 points, no positive cells; 1 point, positive cells ≤25%; 2 points, 25%< positive cells ≤50%; 3 points, 50%< positive cells ≤75%; 4 points, positive cells >75%). The present application found that the expression of miPEP70 in nasopharyngeal carcinoma tissue was up-regulated compared with normal nasopharyngeal epithelium (see Figure 3 C). In addition, the nasopharyngeal carcinoma tissue samples and normal nasopharyngeal epithelial tissue samples were randomly divided into two groups, namely training set and validation set, the relationship between the expression of miPEP70 and the occurrence of nasopharyngeal carcinoma was analyzed by chi-square test, and the results showed that the high expression of miPEP70 was related to the occurrence of nasopharyngeal carcinoma in the training set (see Figure 3 D), and this result was verified in the validation set (see Figure 3E). Kaplan-Meier survival analysis was used to generate overall survival (OS) curves, and it was found that patients with higher miPEP70 levels in nasopharyngeal carcinoma tissues had significantly shorter overall survival in the training set (see Figure 4 F), which was verified in the validation set (see Figure 4 G).

[0084] Example 4: Construction of miPEP70 Knockout Cell Line

[0085] First, the miPEP70 KO nasopharyngeal carcinoma cell line was constructed using CRISPR / Cas9 technology (contracted to Shanghai Jikai Gene Technology Co., Ltd.). Briefly, the template donor (ssODN / plasmid) was first introduced into nasopharyngeal carcinoma cells by lipofection, and then the cas9-sgRNA virus was used to infect the transfected target cells, and puromycin was used to screen the infected cells (see Figure 4 A). The screened interference cells were subjected to single clone screening and identification, and the KO monoclonal stable strain was selected for subsequent experiments, and the KO effect was detected by qRT-PCR and western blot experiments, and the results showed that compared with the control group (WT group), the LINC00510 mRNA level of the KO group (miPEP70 knockout) did not change significantly (see Figure 4 B), and at the protein level, the KO group could not detect a significant miPEP70 band, indicating that the miPEP70 KO cell line was successfully constructed (see Figure 5 C).

[0086] WT: refers to not using CRISPR / Cas9 technology to knock out miPEP70;

[0087] KO: refers to using CRISPR / Cas9 technology to knock out miPEP70.

[0088] On this basis, by transfecting ORF plasmid and ORF promoter mutant plasmid, a nasopharyngeal carcinoma cell model with altered expression of miPEP70 was constructed for cell experiments. The results of western blot experiments showed that compared with the control group (WT group), the KO group (miPEP70 knockout) could not detect a significant miPEP70 band, the KO+ORF group (restored the expression of miPEP70) could detect the miPEP70 band, and the KO+ORF-mut group (without restoring the expression of miPEP70) could not detect the miPEP70 band, indicating that the cell model with altered expression of miPEP70 was successfully constructed (see Figure 6 D-4G).

[0089] WT: refers to no use of CRISPR / Cas9 technology to knock out miPEP70;

[0090] KO: refers to use of CRISPR / Cas9 technology to knock out miPEP70;

[0091] KO+ORF: refers to use of CRISPR / Cas9 technology to knock out miPEP70, and then transfect ORF plasmid to re-express miPEP70;

[0092] KO+ORF-mut: refers to use of CRISPR / Cas9 technology to knock out miPEP70, and then transfect ORF promoter mutant plasmid, which cannot re-express miPEP70.

[0093] Example 5: CCK-8 proliferation experiment

[0094] CCK-8 cell proliferation experiment, briefly, cells of different experimental treatment groups were prepared, and 2000 cells were inoculated into a 96-well plate (5 replicate wells) according to 200 μL cell suspension per well; after the cells adhered, the original medium was removed and replaced with a medium containing CCK-8 reagent (100 μL medium + 10 μL CCK-8 reagent / well), and incubated in a cell incubator for 2 h; the absorbance value was measured at a wavelength of 450 nm, and the cell proliferation curve was drawn by detecting 4 times in succession. The results showed that compared with the WT (miPEP70 high expression) group, the KO group (miPEP70 knockout) could delay the proliferation of nasopharyngeal carcinoma cells; compared with the KO group, the KO+ORF group (restored the expression of miPEP70) could promote the proliferation of nasopharyngeal carcinoma cells, while the KO+ORF-mut group (without restoring the expression of miPEP70) could not promote the proliferation of nasopharyngeal carcinoma cells. The results are shown in Figure 7 .

[0095] Example 6: Transwell migration and invasion experiment

[0096] Transwell migration experiment, briefly, the cells of different experimental treatment groups were prepared, 200 μL of cell suspension (2% FBS) was added to the upper chamber, a total of 50,000 cells, 600 μL of medium containing 20% FBS was added to the lower chamber, and it was placed in the cell incubator for 36 h; immerse the upper chamber in 4% paraformaldehyde for 15 min, wash with PBS for 3 times; immerse the upper chamber in 0.1% crystal violet staining solution for 15 min, wash with PBS for 3 times; use a wet cotton swab to wipe off the cells on the inner side of the upper chamber, wash the chamber with distilled water, and dry; observe under an optical microscope, take pictures and count. It was found that, compared with the WT (high expression of miPEP70) group of cells, the KO group (knockout of miPEP70) could inhibit the migration of nasopharyngeal carcinoma cells; compared with the KO group, the KO+ORF group (restoring the expression of miPEP70) could promote the migration of nasopharyngeal carcinoma cells, while the KO+ORF-mut group (without restoring the expression of miPEP70) could not promote the migration of nasopharyngeal carcinoma cells.

[0097] Transwell invasion experiment, briefly, before inoculating cells, dilute the BD Matrigel glue (Matrigel glue: 1640 medium = 1:9) and evenly pave it into the upper chamber (50 μL / well), and place it in the cell incubator for 30 min, and then follow the steps of the Transwell migration experiment. It was found that, compared with the WT (high expression of miPEP70) group of cells, the KO group (knockout of miPEP70) could inhibit the invasion of nasopharyngeal carcinoma cells; compared with the KO group, the KO+ORF group (restoring the expression of miPEP70) could promote the invasion of nasopharyngeal carcinoma cells, while the KO+ORF-mut group (without restoring the expression of miPEP70) could not promote the invasion of nasopharyngeal carcinoma cells.

[0098] Results are shown in Figure 8 .

[0099] Example 7: Animal experiment

[0100] BALB / c nude mouse models were established. Four-week-old female mice were raised in SPF barriers. Heterotransplantation tumor research was carried out according to the approved animal committee agreement (including nursing, injection, sample collection, and dissection). The mice were randomly divided into 4 groups (n=4), and each nude mouse was subcutaneously injected with 2×10 6 cells of different treatment groups (WT, KO, KO+ORF, and KO+ORF-mut) of HONE1 cells. The in situ tumor volume was recorded during feeding. After 4 weeks, the mice were sacrificed, the in situ tumor was taken out, photographed and weighed, and the tumor tissue was preserved in tissue fixative. It was found that, compared with the WT (high expression of miPEP70) group of cells, the KO group (knockout of miPEP70) could inhibit the growth of tumors.

[0101] Results are shown in Figure 8 .

[0102] Example 8: Screening and detection of miPEP70 downstream proteins

[0103] The present application uses miPEP70 antibody and Flag antibody to enrich the interaction proteins of miPEP70, respectively. Briefly, the proteins of 5-8F cells and the proteins of 5-8F cells transfected with FLAG-ORF were collected, respectively. 500 μL of the proteins (1 mg of total protein, supplemented with IP lysis buffer to 500 μL) were mixed with 10 μL of miPEP70 antibody and Flag antibody, respectively, and incubated on a 4°C shaker overnight. Protein A / G agarose beads were added to the above suspension the next day, and incubated on a 4°C shaker for 2 h, followed by washing and elution. The proteins enriched by the two antibodies were subjected to mass spectrometry analysis, and a total of 19 potential interaction proteins of miPEP70 were obtained, including YTHDF1, as shown in Figure 8 A.

[0104] The present application subsequently verified the interaction between YTHDF1 and miPEP70 by CO-IP experiment. Briefly, the proteins of nasopharyngeal carcinoma cell lines 5-8F, 6-10B, HONE1 and C666-1 were collected, and 500 μL of the proteins (1 mg in total) were mixed with 10 μL of YTHDF1 antibody, and incubated on a 4°C shaker overnight. Protein A / G agarose beads were added to the above suspension the next day, and incubated on a 4°C shaker for 2 h, followed by washing and elution. Western blot experiment was then performed to detect the interaction between YTHDF1 and miPEP70, as shown in Figure 9 B.

[0105] Duolink PLA proximity ligation assay was also used to detect the interaction between miPEP70 and YTHDF1. Briefly, 5-8F and HONE1 cells with normal expression of miPEP70 (WT) and miPEP70 knockout (KO) were evenly seeded on cell slides, and miPEP70 antibody (rabbit) and YTHDF1 antibody (mouse) were added to cover the cell slides, and incubated at 4°C overnight; after washing the primary antibody, Duolink PLA probe was added to cover the cell slides, and incubated at 37°C for 1 h; after washing the PLA probe, Duolink ligation solution was added to cover the cell slides, and incubated at 37°C for 30 min; after washing the Duolink ligation solution, amplification solution was added to cover the slides, and incubated at 37°C for 100 min; finally, after washing the amplification solution, Duolink in situ mounting medium containing DAPI was used to mount the slides, and laser confocal microscopy was used for observation and photography. The experimental results showed that in 5-8F and HONE1 cells with normal expression of miPEP70 (WT), the interaction between miPEP70 and YTHDF1 could be observed, that is, orange PLA signal, while in 5-8F and HONE1 cells with knockout of miPEP70 (KO), the interaction between miPEP70 and YTHDF1 could not be observed, see Figure 9 C.

[0106] Constructing nasopharyngeal carcinoma cell lines with altered expression of miPEP70, and detecting the effect of altered expression of miPEP70 on the protein level of YTHDF1 by western blot.

[0107] WT: refers to no use of CRISPR / Cas9 technology to knockout miPEP70;

[0108] KO: refers to use of CRISPR / Cas9 technology to knockout miPEP70;

[0109] KO+ORF: refers to use of CRISPR / Cas9 technology to knockout miPEP70, and then transfecting ORF plasmid to re-express miPEP70;

[0110] KO+ORF-mut: refers to use of CRISPR / Cas9 technology to knockout miPEP70, and then transfecting ORF promoter mutant plasmid to fail to re-express miPEP70.

[0111] Example 9: Rescue experiment

[0112] The YTHDF1 expression restoration cell model was constructed in the miPEP70 knockout cells by transfecting the Vector plasmid and the YTHDF1 plasmid, and the protein expression of miPEP70 and YTHDF1 was detected by western blot. The results showed that, compared with the control group (WT group), the expression of miPEP70 could not be detected in the KO group, the KO+Vector group and the KO+YTHDF1 group; compared with the control group (WT group), the expression of YTHDF1 was significantly down-regulated in the KO group and the KO+Vector group, while the expression of YTHDF1 in the KO+YTHDF1 group had no obvious change, indicating that the YTHDF1 expression restoration cell model was successfully constructed in the miPEP70 knockout cells (see Figure 9 Figures 9A and 9B).

[0113] The CCK-8, Transwell migration and invasion experiments were used to detect the effect of YTHDF1 expression restoration on the inhibition of nasopharyngeal carcinoma cell proliferation, migration and invasion caused by miPEP70 knockout. The CCK-8 experiment results showed that, compared with the control group (WT group), knocking out miPEP70 (KO group) could inhibit the proliferation of C666-1 and HONE1 cells; compared with the control group (KO+Vector), restoring the expression of YTHDF1 (KO+YTHDF1 group) could weaken the effect of inhibiting the proliferation of C666-1 and HONE1 cells caused by miPEP70 knockout (see Figure 10 Figures 9C and 9D). The Transwell migration and invasion experiment results showed that, compared with the control group (WT group), knocking out miPEP70 (KO group) could inhibit the migration and invasion of 5-8F and 6-10B cells; compared with the control group (KO+Vector), restoring the expression of YTHDF1 (KO+YTHDF1 group) could weaken the effect of inhibiting the migration and invasion of 5-8F and 6-10B cells caused by miPEP70 knockout (see Figure 10 Figures 9E-9J).

[0114] WT: refers to not using CRISPR / Cas9 technology to knock out miPEP70;

[0115] KO: refers to using CRISPR / Cas9 technology to knock out miPEP70;

[0116] KO+Vector: refers to the control group of transfecting the Vector plasmid after knocking out miPEP70 using CRISPR / Cas9 technology, which cannot restore the expression of YTHDF1;

[0117] KO+YTHDF1: refers to transfecting the YTHDF1 plasmid after knocking out miPEP70 using CRISPR / Cas9 technology, which restores the expression of YTHDF1.

[0118] Example 10: rhodosporin treatment of nasopharyngeal carcinoma cells

[0119] The molecular docking software was used to predict that rhodosporin could hinder the interaction between miPEP70 and YTHDF1 (see Figure 10 A). The semi-inhibitory concentration (IC50) experiment was used to detect the inhibitory effect of rhodosporin on the proliferation of nasopharyngeal carcinoma cells. Briefly, after treating nasopharyngeal carcinoma cells with gradient concentrations (0, 0.01, 0.1, 1, 10, 100 μM) of rhodosporin for 48 h, CCK-8 reagent was added to detect the survival of nasopharyngeal carcinoma cells, and the survival curve of nasopharyngeal carcinoma cells was drawn and the IC50 value was calculated (see Figure 10 B). After treating nasopharyngeal carcinoma HONE1 cells with rhodosporin for 48 h, the interaction between miPEP70 and YTHDF1 was detected by CO-IP experiment and Duolink PLA proximity ligation experiment, respectively, and the results showed that rhodosporin could weaken the interaction between miPEP70 and YTHDF1 (see Figure 10 C and 10D). Since rhodosporin can hinder the interaction between miPEP70 and YTHDF1, the present application further detects the effect of rhodosporin on the protein expression of miPEP70 and YTHDF1, and the results show that rhodosporin can down-regulate the protein expression of YTHDF1, and has no direct effect on the protein expression of miPEP70, suggesting that after rhodosporin hinders the interaction between miPEP70 and YTHDF1, the promotion effect of miPEP70 on the protein expression of YTHDF1 is weakened (see Figure 11 E and 10F). The CCK-8 experiment was used to detect the effect of rhodosporin on the growth of nasopharyngeal carcinoma cells, and the results showed that in the miPEP70 normal expression group (WT), rhodosporin could inhibit the proliferation of C666-1 and HONE1 cells, and in the miPEP70 knockout group (KO), rhodosporin had no obvious inhibitory effect on the proliferation of C666-1 and HONE1 cells (see Figure 11 G and 10H).

[0120] Example 11: Elisa experiment

[0121] The present application includes 14 healthy subjects and 82 patients with nasopharyngeal carcinoma diagnosed in Hunan Provincial Tumor Hospital from April 2016 to February 2019. The inclusion criteria are as follows: 1) clear pathological diagnosis, biopsy or surgical resection of nasopharyngeal tissue confirmed as nasopharyngeal carcinoma; 2) complete medical records; 3) clinical features are 18-75 years old, gender is not limited; 4) exclusion criteria: combined with other malignant tumors. The present application randomly divides 14 healthy subjects and 82 patients with nasopharyngeal carcinoma into two groups, namely training set and validation set. The expression of miPEP70 in peripheral blood serum is detected by Elisa experiment. Briefly, competitive enzyme-linked immunosorbent assay (Elisa) is used. The peripheral serum sample, standard (chemically synthesized micropeptide), biotin-labeled miPEP70 antibody, HRP enzyme conjugate are added into the microhole coated with human micropeptide antigen in turn, and incubated and washed in the middle. The substrate TMB is colored under the catalysis of peroxidase (HRP) and converted into final yellow under the action of acid. The absorbance is measured at 450 nm wavelength by using the enzyme marker, the standard curve is drawn, and the concentration of miPEP70 is calculated. The results show that in the training set, the expression of miPEP70 in the peripheral blood serum of patients with nasopharyngeal carcinoma is up-regulated compared with healthy subjects (see Figure 11 A), and this result is verified in the validation set (see Figure 11 B). We divide the patients in the training set and the validation set into 4 groups (Ⅰ-Ⅱ, Ⅲ, Ⅳa and Ⅳb) according to the clinical staging, and analysis shows that in the training set, with the progression of the clinical stage of the patients, the expression of miPEP70 shows a gradually up-regulated trend (see Figure 11 C), and this finding is verified in the validation set (see Figure 11 D). ROC curve shows that in the training set, the content of miPEP70 in peripheral blood serum has effective predictive value for the prevalence of nasopharyngeal carcinoma (see ​ E), and this result is further verified in the validation set (see ​ F). Further analysis of clinical data shows that the expression of serum miPEP70 is related to the T stage, M stage and clinical stage of patients with nasopharyngeal carcinoma, but has nothing to do with the gender, age and N stage of patients with nasopharyngeal carcinoma (see Table 1). In summary, miPEP70 may be an oncogene, which plays a key role in the proliferation and metastasis of nasopharyngeal carcinoma; the expression of miPEP70 in peripheral blood serum may become a new biomarker for the diagnosis and prognosis of nasopharyngeal carcinoma.

[0122] .

Claims

1. The application of a reagent for detecting the micropeptide miPEP70, characterized in that, The amino acid sequence of the micropeptide miPEP70, used for the preparation of diagnostic and / or prognostic agents for nasopharyngeal carcinoma, is shown in SEQ ID NO.

3.

2. The application according to claim 1, characterized in that, Reagents for detecting miPEP70 include immunohistochemical assays or ELISA assays.

3. The application of a reagent that inhibits the micropeptide miPEP70, characterized in that, The amino acid sequence of the micropeptide miPEP70 is shown in SEQ ID NO.3 and is used to prepare a nasopharyngeal carcinoma treatment agent. The reagents for inhibiting the micropeptide miPEP70 include a CRISPR / Cas9 system designed for the micropeptide miPEP70.

4. Application of rocetin in the preparation of drugs for the treatment of nasopharyngeal carcinoma.

Citation Information

Patent Citations

  • Nucleic acid and corresponding protein entitled 162P1E6 useful in treatment and detection of cancer

    AU2007237282A1

  • High-producing 3-hydroxypropionaldehyde strain and application thereof to prevention and treatment of nasal cavity infection of mammals

    CN105087435A