Multiplex fluorescent quantitative PCR (polymerase chain reaction) detection reagent for synchronously detecting four DNA (deoxyribonucleic acid) viruses related to infectious infertility

Abstract

The invention discloses a multiplex fluorescent quantitative PCR (Polymerase Chain Reaction) detection reagent for synchronously detecting four DNA (Deoxyribose Nucleic Acid) viruses related to infectious infertility. The detection reagent comprises specific primers and probes aiming at human microviruses, adenoviruses, polyoma viruses and adeno-associated viruses; the multiple fluorescence detection method used in the invention not only can synchronously detect four infectious DNA viruses in a single reaction tube, but also can simultaneously measure the load of the viruses, and has great value for researching infectious clinical diseases. The reagent disclosed by the invention has the characteristics of strong specificity, high sensitivity, good stability, simplicity in operation, less time consumption and the like, and can greatly improve the detection efficiency and reduce the detection cost when the method is used for performing large-scale clinical screening on the infection of the four viruses; meanwhile, the detection result can also provide important reference for formulating an individualized treatment scheme, so that the kit has important clinical application value and social significance for realizing symptomatic medication and improving the treatment effect.

Description

Technical Field

[0001] The present invention belongs to the technical field of DNA virus detection, and in particular relates to a multiplex fluorescence quantitative PCR detection reagent for synchronously detecting four DNA viruses related to infectious infertility. Background Art

[0002] Currently, male and female infertility has become a major global public health challenge. Infertility can be caused by a variety of factors, among which infection by pathogenic microorganisms is a major predisposing factor. Through extensive literature review, we have found that pathogens associated with infectious infertility include viruses, bacteria, fungi, and protozoa. Among all pathogens associated with infectious infertility, DNA viruses are a relatively common type. Existing research results indicate that human parvovirus B19 (B19V), adenovirus (ADV), polyomavirus (JCV), and adeno-associated virus (AAV) are four highly prevalent DNA viruses associated with infertility.

[0003] Human parvovirus B19V is the only known human pathogen in the genus Erythrovirus of the Parvoviridae family, with a genome size of approximately 5.6 kb. As a major pathogen, B19V is primarily transmitted through respiratory secretions, saliva, or infected blood, and can cause a variety of diseases in children, including erythema infectiosum, arthritis, and acute aplastic crisis. B19V can infect people of all ages and is a global epidemic, with particular prevalence among pregnant women and children. Existing studies have found that B19V can cross the placenta and cause asymptomatic infection in the fetus, ultimately leading to serious pregnancy consequences such as spontaneous abortion, fetal anemia, hydrops fetalis, and even fetal death.

[0004] Adenoviruses are a type of virus in the genus Adenovirus of the family Adenoviridae that are pathogenic to humans. They are non-enveloped, double-stranded, linear DNA viruses with a genome size of approximately 34-36 kilobases. ADV primarily infects humans through respiratory droplets and contact. While the general population is generally susceptible to ADV, it is more common in children and those with weakened immune systems. Existing studies have found that ADV infection can cause orchitis, epididymitis, or prostatitis. Persistent inflammation can lead to tissue fibrosis or obstruction of the vas deferens, hindering sperm transport and, in turn, decreasing male fertility.

[0005] Polyomaviruses belong to the genus Polyomavirus and are widespread worldwide. The JCV genome is a circular double-stranded DNA approximately 5.1 kb in size. Once inside the human body, JCV typically colonizes the lymphoid tissue and urinary system, causing a persistent or latent infection. JCV can reactivate when the immune system is compromised. Existing studies have found that the JCV genome can be detected in the semen of some infertile men. JCV infection can lead to decreased sperm motility and changes in sperm morphology, making it a significant infectious pathogen associated with male infertility.

[0006] Adeno-associated virus (AAV) is a non-enveloped, single-stranded DNA virus of the Parvoviridae family, approximately 20-26 nm in diameter. It relies on a helper virus (such as adenovirus) for replication. Its genome is approximately 4.7 kb and contains inverted terminal repeats (ITRs) and genes encoding the replication protein (Rep) and capsid protein (Cap). It can integrate into a specific region (AAVS1) on chromosome 19 of the host. Existing studies have shown that AAV can infect the male reproductive system by attaching to sperm (e.g., by binding to HSPG receptors) or integrating into the germ cell genome, resulting in a 30%-50% decrease in sperm motility. AAV infection can also occur in the female reproductive tract, with a cervical detection rate of approximately 5%. The prevalence of AAV in semen in healthy men is approximately 3%-8%, rising to 10%-15% in infertile men. Common serotypes are AAV2 and AAV5. Its pathogenicity includes directly damaging sperm function, inducing local inflammation (such as activating the TLR9 pathway to release IL-6 / TNF-α), and synergistically exacerbating reproductive damage through co-infection with viruses such as HPV and HIV, and may even be transmitted to the embryo through sexual transmission or assisted reproductive technology.

[0007] Currently, detection methods for the four DNA viruses mentioned above primarily include chemiluminescent immunoassays (CLIA) and real-time quantitative PCR (qPCR). CLIA assesses viral infection by detecting the presence of virus-specific antibodies or antigens. However, antigen or antibody detection results cannot accurately determine the infection status of the virus, resulting in significant limitations in practical application. In contrast, real-time quantitative PCR (qPCR) uses fluorescent signals to monitor the PCR amplification process in real time, accurately quantifying viral load and becoming an important method for laboratory and clinical diagnosis of pathogen infections. However, traditional single-plex qPCR technology uses only one pair of primers and probes, detecting only one target viral genome per reaction. This makes it inefficient for co-infections with multiple pathogens or when high-throughput screening is required, and the high cost of individual tests has limited its widespread clinical application. Recently developed multiplex qPCR technology, by designing multiple sets of specific primers and probes, enables simultaneous detection of multiple targets in a single reaction system, significantly improving detection efficiency and throughput while reducing the cost of individual tests.

[0008] In summary, real-time fluorescence quantitative PCR technology plays an important role in pathogen detection due to its high sensitivity and quantitative capabilities. The introduction of multiplex PCR technology has further improved its detection efficiency, which is conducive to promoting its widespread application in clinical diagnosis. Therefore, the development of multiplex qPCR detection methods for the four viruses mentioned above, using the principles of multiplex qPCR technology, is of great value and significance for the clinical detection and diagnosis of these four viruses. Summary of the Invention

[0009] In response to the limitations of existing detection technologies, the present invention provides a multiplex fluorescent quantitative PCR detection reagent for the simultaneous detection of four DNA viruses related to infectious infertility. The present invention can achieve high-throughput screening of clinical samples from infertile populations, and has the advantages of rapid results, high efficiency and low cost. It can not only provide a reliable basis for clinical diagnosis and treatment, but also provide important technical support for the prevention and treatment research of infectious infertility.

[0010] To achieve the above objectives, the present invention designs specific primers and probes for the highly conserved sequences of human parvovirus, adenovirus, polyomavirus, and adeno-associated virus, respectively; The specific primers for human parvovirus were GTCATCATTTTCARAGYCATGGACAGTT and GCTATACCTAAAGTCATGAATCCTTG, and the probe was ATGCAGTATTATCTAGTGAAGACTTACACAAGCCTG; For adenovirus, the probes are TSTTYAAYCGYTTYCCYGASAAYCAGAT and GTCAGTRAYGGTSACDCGYTGRACTC, and ACCGTYAGTGAAAACGTKCCYGCYCTCACAGATCA; The primers specific for polyomavirus were GTAGCTGAAATTGCTGCTGGAGA and CAGCTATAGCCTCAGAGGTACTTG, and the probe was CTGCTGCTACTATAGAAGTTGAAATTGCATCCCTTG; The specific primers for adeno-associated virus were GCRGCCCTCGARCACGACAA and CTTYTTBGCCTGGAARACTGCTC, and the probe was TTGCCCCCAAAWGACGTATCTTCTT; The detection reagents of the present invention also include other conventional reagents used for multiplex fluorescence quantitative PCR detection.

[0011] The method for using the above-mentioned multiplex fluorescence quantitative PCR detection reagent is as follows: 1. Collect clinical plasma and reproductive tract samples from infertile people (male reproductive tract samples are semen, female reproductive tract samples are vaginal swabs). Verify and record patient information during sampling, register, store at low temperature during transportation, and then store at -80℃; 2. Use the Tiangen Virus Genomic DNA / RNA Extraction Kit to extract infectious DNA virus groups from blood or reproductive tract samples; 3. Using the DNA extracted in step 2 as a template, specific primers and probes for four infectious DNA viruses were used to perform multiplex fluorescence quantitative PCR detection according to the reaction procedure and reaction system, and the results were determined based on the Ct value; the reaction procedure was pre-denaturation at 95°C for 30 seconds; denaturation at 95°C for 5 seconds, annealing and extension at 58°C for 30 seconds, for 40 cycles; the fluorescence signal was collected during the annealing and extension stage of each cycle.

[0012] The following are the optimized test result interpretation criteria: Determination of the validity of the amplification curve: Amplification curve shape: a standard "S" curve, which must be smooth without jagged fluctuations and have a normal plateau phase; Threshold line setting requirements: located in the middle of the exponential growth period, not too high or too low; Quality control requirements: The Cq value of the negative control / no-template control should be UNDEF, and the difference in Ct values ​​between replicate wells should be <0.5 (otherwise, retesting or re-extraction of nucleic acid is required).

[0013] 2. Result interpretation criteria Table 1 Criteria for interpreting multiplex fluorescence quantitative PCR results

[0014] 3. Special Notes It is recommended that samples in the suspicious range be retested for confirmation; UNDEF indicates that the sample concentration is below the detection limit and is uniformly judged as negative; all positive results must meet the validity criteria of the amplification curve.

[0015] Compared with previous detection methods, the present invention has the following advantages: The present invention designs specific primers based on the highly conserved regions of the conserved genes of four DNA viruses, and uses specific probes for different viruses with different fluorescent labels to achieve simultaneous detection of four viruses in a single reaction system. While detecting the viral infection status, the viral load can also be quantified. Compared with the traditional four sets of independent primer-probe systems, the detection cost is reduced and the detection speed is faster.

[0016] The specificity validation of the method found that there was no cross-reaction between the DNA viruses and other pathogens, and the specificity was good, ensuring that the detection results were accurate and reliable; the sensitivity validation of the method found that the minimum detection limit of B19V and ADV was 10 1 copies / μL, and the minimum detection limit for JCV and AAV viruses is 10 0 The results showed that the method has high sensitivity and is suitable for low viral load samples. The repeatability verification of the method found that the coefficient of variation (CV) of both intra-batch and inter-batch repeatability was less than 2%, indicating that the method has good repeatability and reproducibility.

[0017] The detection reagent developed by this invention boasts high sensitivity, strong specificity, and good reproducibility, as well as rapid detection and low cost. It enables efficient and simultaneous detection of four viruses: B19V, ADV, JCV, and AAV. This technology is not only suitable for clinical infection diagnosis and epidemiological monitoring, but can also be used for dynamic analysis of viral load, significantly increasing detection throughput. Its widespread application in high-risk populations such as infertile patients and pregnant women will provide important technical support for elucidating the molecular mechanisms linking viral infection with reproductive dysfunction and adverse pregnancy outcomes, and possesses significant clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The results of the multiplex fluorescence quantitative PCR specificity experiment; Figure 2 Verify the amplification curve results for the linear interval of human parvovirus in multiplex fluorescence quantitative PCR; Figure 3 Verify the amplification curve results for the linear range of multiplex fluorescence quantitative PCR adenovirus; Figure 4 Verify the amplification curve results for the linear interval of polyomavirus in multiplex fluorescence quantitative PCR; Figure 5 Verify the amplification curve results for the linear range of multiplex fluorescence quantitative PCR adeno-associated virus; Figure 6 This is the standard curve result of human parvovirus multiplex fluorescence quantitative PCR; Figure 7 This is the standard curve result of adenovirus multiplex fluorescence quantitative PCR; Figure 8 This is the standard curve result of polyomavirus multiplex fluorescence quantitative PCR; Figure 9 This is the standard curve result of adeno-associated virus multiplex fluorescence quantitative PCR; Figure 10 This is the Sanger sequencing peak diagram of the common PCR amplification products of the viral genome of some positive samples; Figure 11 Blast results of viral genome sequences of some positive samples. DETAILED DESCRIPTION

[0019] To further illustrate the technical means and effects of the present invention, the following specific embodiments are used to further illustrate the technical solutions of the present invention, but the present invention is not limited to the scope of the embodiments. It should be pointed out that the materials used in the following examples are not limited to the above-mentioned materials and can be replaced by other similar materials. If the specific conditions of the instruments are not specified, they should be used under conventional conditions or according to the conditions recommended by the manufacturer. Those skilled in the art should have relevant knowledge of using conventional materials and instruments. Unless otherwise specified, the methods in the examples are all conventional methods. Example 1: Design of specific primers and probes 1. Download the full-length gene nucleic acid sequences of human parvovirus, adenovirus, polyomavirus, and adeno-associated virus from NCBI (https: / / www.ncbi.nlm.nih.gov / ); 2. Use Mega 11 software to align nucleotide sequences, and use Primer Select software to design primers and probes for human parvovirus, adenovirus, polyomavirus, and adeno-associated virus; 3. Primer and probe BLAST evaluation: The nucleotide sequences of the primers and probes designed were compared again using the BLAST search function on the NCBI website to select primers and probes with high specificity. The primers and probes were synthesized by Sangon Biotech Co., Ltd. The nucleotide sequences of the specific primers and probes for four infectious infertility-related DNA viruses (B19V, ADV, JCV, AAV) are shown in Table 2 below: Table 2 Nucleotide sequences of relevant DNA virus-specific primers and probes .

[0020] Example 2: Establishment of multiplex fluorescence quantitative PCR method 1. Construction and verification of plasmids The highly conserved nucleotide sequences of human parvovirus and adenovirus were ligated with the pUC57 vector to synthesize the positive plasmid GD1P1 (SEQ ID NO: 1). The highly conserved nucleotide sequences of polyomavirus and adeno-associated virus were ligated with the pUC57 vector to synthesize the positive plasmid GD1P2 (SEQ ID NO: 2). Plasmid construction was completed by Sangon Biotech Co., Ltd. After activation of the synthesized plasmids in glycerol stock, the plasmids were extracted and their concentrations were measured using a UV spectrophotometer. The copy number of the plasmids was calculated based on the length and concentration of each plasmid. The copy number results are shown in Table 3: Table 3 Plasmid copy number results ; 2. Optimization of fluorescence quantitative reaction system (1) Optimization of multiplex fluorescence quantitative PCR reaction system The final concentrations of the upstream primer for each target gene in the reaction system were set at 40 nM, 60 nM, 80 nM, and 100 nM, respectively. The final concentrations of the downstream primer in the reaction system were set at 20 nM, 40 nM, 60 nM, 80 nM, and 100 nM, respectively. The "matrix method" was used to optimize primer concentrations. The Ct and Std values ​​are shown in Table 4. The probe concentrations were optimized using final concentrations of 20 nM, 40 nM, 60 nM, 80 nM, and 100 nM, respectively. The Ct and Std values ​​are shown in Table 5. Three replicates were set for each gradient, and the average Ct and Std values ​​were calculated. Based on the principles of relatively small Ct values, a well-defined and S-shaped amplification curve, high and concentrated fluorescence intensity, and minimal primer-dimers, the optimal concentration of both upstream and downstream primers in the reaction system was determined to be 60 nM. The optimal probe concentration was 40 nM.

[0021] The final multiplex fluorescence quantitative PCR reaction system was determined as follows: Premix Ex Taq (Probe qPCR) (2×) 10 μL, B19V-F / R 0.6 μL each, ADV-F / R 0.6 μL each, JCV-F / R 0.6 μL each, AAV-F / R 0.6 μL each, B19V-P 0.4 μL, ADV-P 0.4 μL, JCV-P 0.4 μL, AAV-P 0.4 μL, template 1 μL, and water was added to make up to 20 μL. The multiplex fluorescence quantitative PCR reaction program was as follows: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing and extension at 58°C for 30 s, for 40 cycles.

[0022] Table 4 Final concentrations of upstream and downstream primers

[0023] Table 5 Probe final concentration results .

[0024] Example 3: Evaluation of specificity, sensitivity and repeatability of fluorescent quantitative PCR using primers and probes of the present invention 1. Specificity verification of fluorescent quantitative PCR Nine DNA viruses (herpes simplex virus type 1 HSV-1, herpes simplex virus type 2 HSV-2, varicella-zoster virus VZV, human herpesvirus EDV, cytomegalovirus CMV, human papillomavirus type 6 HHV-6, human papillomavirus type 7 HHV-7, Kaposi's sarcoma-associated herpesvirus KSHV, and hepatitis B virus HBV) and nine RNA viruses (hepatitis C virus HCV, hepatitis E virus HEV, hepatitis G virus HGV, dengue virus type 4 DENV-4, coxsackievirus A8 CVA8, coxsackievirus A16 CVA16, human immunodeficiency virus HIV, echovirus ECHO, and human rhinovirus HRV) were selected as specific detection pathogens; viral genomic extracts and 10 7 The specificity of the multiple fluorescence quantitative detection method was verified using a plasmid standard of 100 copies / μL as a template. The reaction system and reaction procedure were the same as those in Example 2.

[0025] The results are as follows Figure 1 As shown in the figure, the primer probe of each pathogen only has an amplification curve when detecting the plasmid standard of this pathogen, and no amplification occurs for other viruses, indicating that there is no cross-reaction between the DNA virus detection primers and probes and other viral nucleic acid templates, and the specificity of this method is good.

[0026] 2. Verification of the linear interval of fluorescent quantitative PCR The positive plasmid standard was diluted to 10 by 10-fold serial dilution method. 7 copies / μL, 10 6 copies / μL, 10 5 copiesμL、10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, sterile water was used as a negative control, and specific primers and probes for the four DNAs were used respectively, and the linear range of the multiplex fluorescence quantitative PCR detection method was verified according to the reaction system and procedure in Example 2.

[0027] The results are as follows Figure 2-5 As shown in the figure, it can be seen that the amplification efficiency is close to 100%; the consistency of amplification efficiency is verified, and the efficiency deviation caused by factors such as inhibitors and primer dimers is excluded; it ensures that when the Ct value of the unknown sample in the subsequent detection falls within the linear range, the calculation result is credible; as shown in the figure Figure 6-9 As shown in the figure, the standard curve constructed based on the highly conserved sequence of human parvovirus has an amplification efficiency of 107.87%, R 2 The standard curve constructed based on the highly conserved sequence of adenovirus had an amplification efficiency of 109.67%, and R 2The standard curve constructed based on the highly conserved sequence of polyomavirus had an amplification efficiency of 106.23%, and R 2 The standard curve constructed based on the highly conserved sequence of adeno-associated virus has an amplification efficiency of 104.76%, R 2 It is 1, indicating a good linear relationship.

[0028] 3. Fluorescence quantitative PCR sensitivity evaluation 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 With four gradients of 100 copies / μL as templates and sterile water as negative control, 20 repeated experiments were performed using the multiplex fluorescence quantitative PCR detection method according to the optimized reaction system and reaction procedure. If the detection rate could stably reach more than 95%, it would be finally determined as the minimum detection limit.

[0029] The results are shown in the table below. The minimum detection limit of the multiplex fluorescence quantitative PCR system for B19V and ADV is 10 1 copies / μL, and the minimum detection limit for JCV and AAV viruses is 10 0 copies / μL.

[0030] Table 6 Sensitivity verification results of multiplex fluorescence quantitative PCR .

[0031] 4. Evaluation of Fluorescence Quantitative PCR Repeatability In order to verify the repeatability of the multiplex qPCR detection method, a concentration gradient of 10 3 -10 1 The plasmid standard with 100 copies / μL was used as the positive template. The intra-batch experiment was repeated three times for each template. The inter-batch experiment was repeated three times for each template for three consecutive days. The intra-batch and inter-batch coefficients of variation (CV%) were calculated based on the Ct values ​​to evaluate the repeatability and reproducibility of the method. The results of the repeatability test are shown in Table 7. The results show that the coefficient of variation CV is less than 2%, indicating that the repeatability and reproducibility of the present invention are good;

[0032] Table 7 Multiplex fluorescence quantitative PCR repeatability verification results .

[0033] Example 4: Multiplex fluorescence quantitative PCR detection of clinical samples 1 mL of whole blood was collected from 600 infertility patients into sterile EP tubes. The patient information was carefully verified, the samples were labeled, and the tubes were registered. The samples were stored at 4°C during transportation and at -80°C until nucleic acid extraction. 1. Nucleic acid extraction DNA was extracted using the Tiangen virus genomic DNA / RNA extraction kit. The specific steps are as follows: a. Before using the Tiangen Virus Genomic DNA / RNA Extraction Kit, add 70 mL of anhydrous ethanol to the rinse buffer PW and 17 mL of anhydrous ethanol to the buffer GD, respectively. b. Sample aliquoting: Aliquot 200 μL of blood into a new EP tube and add 20 μL of Protein K; c. Add 200 μL of the prepared Carrier RNA working solution to the EP tube, vortex and shake, incubate in a 56°C water bath for 15 minutes, then briefly centrifuge and add 250 μL of anhydrous ethanol. Shake for 15 seconds and let stand for 5 minutes. A flocculent precipitate will form. d. Transfer the flocculent precipitate and solution mixture to the adsorption column, centrifuge at 8000 rpm for 1 min, discard the waste liquid, add 500 μL buffer GD, centrifuge at 8000 rpm for 1 min, discard the waste liquid; place the adsorption column in the collection tube e. Add 600 μL of rinse solution PW, let it stand for 2 minutes, centrifuge at 8000 rpm for 1 minute, and discard the waste liquid. Repeat this step twice; f. Add 500 μL of anhydrous ethanol, centrifuge at 8000 rpm for 1 min, discard the waste liquid, and then centrifuge at 12000 rpm for 3 min, discard the waste liquid; h. Place the adsorption column in a new enzyme-free centrifuge tube, add 45 μL of RNase-Free ddH2O to the middle of the adsorption membrane, let it stand at room temperature for 5 minutes, and centrifuge at 12,000 rpm for 3 minutes to collect the nucleic acid solution at the bottom of the tube. Aliquot according to the experimental situation and store at -20°C for later use.

[0034] 2. Multiplex fluorescence quantitative PCR detection The nucleic acid extracted in step 2 was used as a template. The reaction system was similar to that in Example 2. The amplification procedure was as follows: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 58°C for 30 s, for 40 cycles. Fluorescence was collected during the extension phase of each cycle.

[0035] Blood samples from 300 infertile men and 300 infertile women were collected for testing. Negative controls were NTC (no template negative) and NSC (blank control), and repeated twice. At the same time, positive controls were set as quadruple positive plasmid 10 8 , 10 5 , 10 1 The test results are shown in Table 8. Four viruses were detected in the blood samples of infertile women, with the following positive rates: B19V detection rate 1% (3 / 300); ADV detection rate 1% (3 / 300); JCV detection rate 1% (3 / 300); and AAV detection rate 1.6% (5 / 300). Only one of the four viruses was detected in the blood samples of infertile men, with the following positive rates: AAV detection rate 0.6% (2 / 300).

[0036] Table 8 Positive results of multiplex fluorescence quantitative PCR for infertility clinical samples

[0037] Nested PCR was performed on the B19V, ADV, JCV, and AAV positive samples obtained from the above tests to amplify the VP1 region fragment of B19V (242 bp), the E1A region fragment of ADV (152 bp), the VP2 region fragment of JCV (103 bp), and the VP1 region fragment of AAV (159 bp). The amplification primer system and reaction conditions are shown in Table 9. Table 9 DNA virus nested PCR amplification primers

[0038] The reaction system is shown in Table 10: Table 10 Nested PCR reaction system

[0039] The reaction conditions were 95°C for 5 min; 40 cycles of 95°C for 30 s, 50°C for 30 s, and 72°C for 3 min; and 72°C for 7 min. The results showed that the fragment sizes were consistent with the target fragment size. The PCR products with target bands were subjected to Sanger sequencing. The Sanger sequencing results of PCR products in the VP1 region, E1A region, VP2 region, and VP1 region were as follows: Figure 10 As shown, the sequencing result peak diagram is single and complete, and the sequencing result is used for Blast analysis. The results are as follows Figure 11As shown, the homology is strong, indicating that the positive samples detected by the multiplex fluorescence quantitative PCR of the present invention are the expected target gene fragments (VP1 region of B19V, E1A region of ADV, VP2 region of JCV, and VP1 region of AAV).

[0040] In summary, the detection method of the present invention has the advantages of high sensitivity, strong specificity, good repeatability and simple operation. It can simultaneously, quickly and accurately detect four viruses: B19V, ADV, JCV and AAV, thereby improving the clinical screening speed of the four viruses and saving detection costs.

Claims

1. A multiplex fluorescence quantitative PCR detection reagent for simultaneous detection of four infectious infertility-related DNA viruses, characterized by: Includes specific primers and probes for human parvovirus, adenovirus, polyomavirus, and adeno-associated virus; The specific primers for human parvovirus were GTCATCATTTTCARAGYCATGGACAGTT and GCTATACCTAAAGTCATGAATCCTTG, and the probe was ATGCAGTATTATCTAGTGAAGACTTACACAAGCCTG; The specific primers for adenovirus were TSTTYAAYCGYTTYCCYGASAAYCAGAT and GTCAGTRAYGGTSACDCGYTGRACTC, and the probe was ACCGTYAGTGAAAACGTKCCYGCYCTCACAGATCA; The primers specific for polyomavirus were GTAGCTGAAATTGCTGCTGGAGA and CAGCTATAGCCTCAGAGGTACTTG, and the probe was CTGCTGCTACTATAGAAGTTGAAATTGCATCCCTTG; The specific primers for adeno-associated virus were GCRGCCCTCGARCACGACAA and CTTYTTBGCCTGGAARACTGCTC, and the probe was TTGCCCCCAAAWGACGTATCTTCTT.

Images