Multimodal biosensor and method of making the same

By fabricating a multimodal biosensor that combines electrochemical and optical detection, using chitin fiber paper substrate and organic conductive polymer materials, the error problem of single detection methods was solved, achieving highly accurate and reliable biological detection.

CN120820609BActive Publication Date: 2026-01-02INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510605522.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-12
Publication Date
2026-01-02
Estimated Expiration
2045-05-12

AI Technical Summary

Technical Problem

The detection results of existing biosensors are easily affected by the errors and interference of a single detection method, resulting in insufficient detection accuracy and reliability.

Method used

A multimodal biosensor fabrication method was adopted, combining an electrochemical field effect biosensor region and an optical biosensor region. Transparent chitin fiber paper was used as a flexible substrate, and an electrochemical-fluorescence-visible light trimodal biosensor was formed by bonding organic conductive polymer materials and electrochemical biomaterials.

Benefits of technology

It improves the accuracy and reliability of detection results, reduces the errors and interference of single detection methods, enables more comprehensive detection of biological samples, and is suitable for applications in multiple fields.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120820609B_ABST
    Figure CN120820609B_ABST
Patent Text Reader

Abstract

The embodiment of the present application provides a kind of multimodal biosensor and its preparation method.The preparation method includes: providing flexible substrate layer;The first side of flexible substrate layer has first electrode area, second electrode area, electrochemical field effect biological detection area and optical biological detection area;Second side has third electrode area;Wherein, the material of flexible substrate layer is transparent flexible material;Bond organic conductive polymer material in first electrode area, to form first electrode;Bond organic conductive polymer material in second electrode area, to form second electrode;Bond organic conductive polymer material in third electrode area, to form third electrode;Providing optical biological material and electrochemical biological material;Optical biological material and electrochemical biological material respectively include nucleotide;Bond electrochemical biological material in electrochemical field effect biological detection area;Bond optical biological material in optical biological detection area, namely multimodal biosensor.It can improve the accuracy and reliability of detection.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of sensors, in particular to a multi-modal biosensor and a preparation method thereof. BACKGROUND

[0002] The multi-modal biosensor combines multiple detection modes, which can verify and supplement the results of different detection methods, reduce the errors and interference of single detection method, and thus improve the accuracy and reliability of the detection results. SUMMARY

[0003] Therefore, the present application aims to provide a multi-modal biosensor and a preparation method thereof.

[0004] To achieve the above purpose, the present application provides a preparation method of a multi-modal biosensor, comprising:

[0005] providing a flexible substrate layer; the first side of the flexible substrate layer has a first electrode area, a second electrode area, an electrochemical field effect biosensing area and a photo-biosensing area; the second side of the flexible substrate layer has a third electrode area; the electrochemical field effect biosensing area, the photo-biosensing area, the first electrode area and the second electrode area do not overlap in the orthographic projection of the horizontal plane; wherein the material of the flexible substrate layer is a transparent flexible material; the first side and the second side are oppositely arranged;

[0006] providing an organic conductive polymer material;

[0007] bonding the organic conductive polymer material in the first electrode area to form a first electrode; bonding the organic conductive polymer material in the second electrode area to form a second electrode; and bonding the organic conductive polymer material in the third electrode area to form a third electrode;

[0008] providing photo-biological materials and electrochemical biological materials; the photo-biological materials and the electrochemical biological materials each include nucleotides;

[0009] bonding the electrochemical biological materials in the electrochemical field effect biosensing area; and bonding the photo-biological materials in the photo-biosensing area, thereby obtaining the multi-modal biosensor.

[0010] In some embodiments, the material of the flexible substrate layer is a chitin fiber paper; and the providing of the flexible substrate layer comprises:

[0011] purifying chitin;

[0012] reacting the purified chitin to obtain a chitin solution;

[0013] The chitin solution is spread on a glass substrate to form a thin film;

[0014] The glass substrate with the chitin thin film is immersed in anhydrous ethanol and left to obtain a chitin fiber paper in the form of a hydrogel.

[0015] In some embodiments, the organic conductive polymer material has hydrophilicity; the providing of the organic conductive polymer material comprises:

[0016] The organic conductive polymer is provided;

[0017] The organic conductive polymer is surface-modified with a first hydrophilic group or polymerized with a hydrophilic polymer to obtain an organic conductive polymer material with hydrophilicity.

[0018] In some embodiments, the providing of the flexible substrate layer further comprises:

[0019] The first side and the second side of the flexible substrate layer are respectively subjected to a first treatment to form a first electrode region and a second electrode region with a second hydrophilic group on the first side of the flexible substrate layer and to form a third electrode region with the second hydrophilic group on the second side of the flexible substrate layer;

[0020] A semiconductor material is provided on a first region of the first side of the flexible substrate layer and subjected to a second treatment to form an electrochemical field effect biological detection region with a third hydrophilic group on the first region;

[0021] A third treatment, a fourth treatment and a fifth treatment are performed on a second region of the first side of the flexible substrate layer to form a photo-biological detection region with a fourth hydrophilic group on the first side of the flexible substrate layer.

[0022] In some embodiments, the first treatment comprises a plasma treatment, the second hydrophilic group comprises a hydroxyl group; the second treatment comprises a carboxy pyrene treatment or a chloroacetic acid treatment, the third hydrophilic group is a carboxyl group; the third treatment comprises a plasma treatment; the fourth treatment comprises a carboxylation treatment; the fifth treatment comprises a carboxyl activation treatment; and the fourth hydrophilic group comprises a succinimidyl group.

[0023] In some embodiments, after the organic conductive polymer material is bonded in the first electrode region to form a first electrode, in the second electrode region to form a second electrode, and in the third electrode region to form a third electrode, the method further comprises:

[0024] The first electrode, the second electrode and the third electrode are subjected to a hydrophobic treatment to make the first electrode, the second electrode and the third electrode hydrophobic.

[0025] In some embodiments, the first hydrophilic group is selected from carboxyl; the hydrophobic treatment is a metal ion treatment, the metal ion is selected from calcium ion, iron ion or lead ion; or

[0026] The first hydrophilic group is selected from hydroxyl; the hydrophobic treatment is a hydrophobic organosilane treatment.

[0027] In some embodiments, the optical biomaterials include nanospheres bonded with fluorescent materials, L double-stranded DNA and Y type DNA mixed hybridization DNA hydrogel; the electrochemical biomaterials include L double-stranded DNA and Y type DNA.

[0028] In some embodiments, the method further comprises: disposing a first insulating layer on the first side, and / or disposing a second insulating layer on the second side; wherein the first insulating layer is provided with a first hollow area; the first hollow area covers the orthographic projection of the optical biological detection area on the second insulating layer and the orthographic projection of the electrochemical field effect biological detection area on the second insulating layer.

[0029] The embodiments of the present application also provide a multi-modal biosensor prepared by the preparation method of the multi-modal biosensor.

[0030] As can be seen from the above, the multi-modal biosensor and the preparation method thereof provided by the embodiments of the present application can prepare an electrochemical-fluorescent-visible light three-modal biosensor by bonding optical biomaterials to electrochemical field effect biological detection areas and bonding electrochemical biomaterials to optical biological detection areas. Among them, electrochemical detection has the characteristics of high sensitivity and fast response speed. Optical detection has the advantages of good selectivity and non-invasiveness. In this way, the errors and interferences of a single detection method can be reduced, thereby improving the accuracy and reliability of the detection results and obtaining more comprehensive detection results. BRIEF DESCRIPTION OF DRAWINGS

[0031] In order to more clearly illustrate the technical solutions in the present application or related art, the following will briefly introduce the drawings needed to be used in the embodiments or related art descriptions. Obviously, the drawings in the following description are only embodiments of the present application, and those skilled in the art can obtain other drawings according to these drawings without creative labor.

[0032] Figure 1 It is a flowchart of the preparation method of the multi-modal biosensor of the embodiments of the present application;

[0033] Figure 2 It is an exploded view of the multi-modal biosensor of the embodiments of the present application;

[0034] Figure 3 Electrochemical field effect transistor wiring diagram for the multi-modal sensor of the embodiments of the present application;

[0035] Figure 4 Schematic diagram for the multi-modal sensor of the embodiments of the present application;

[0036] Figure 5 Schematic diagram for different sensitive regions and photoelectric signal detection regions of the multi-modal biosensor of the embodiments of the present application;

[0037] Figure 6 Fluorescence signal change schematic diagram for the fluorescence method for determining 1 cfu / ml-10 5 cfu / ml of Staphylococcus aureus of the embodiments of the present application;

[0038] Figure 7 Voltage-current signal change schematic diagram for the electrochemical method for determining 1 cfu / ml-10 5 cfu / ml of Staphylococcus aureus of the embodiments of the present application;

[0039] Figure 8 Absorbance intensity change schematic diagram for the ultraviolet-visible light method for determining 1 cfu / ml-10 5 cfu / ml of Staphylococcus aureus of the embodiments of the present application;

[0040] Figure 9 Electrochemical field effect transistor performance curve schematic diagram for the multi-modal biosensor of the embodiments of the present application. DETAILED DESCRIPTION

[0041] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with reference to specific embodiments and drawings.

[0042] It should be noted that, unless otherwise defined, the technical terms or scientific terms used in the embodiments of the present application should be understood as the common meanings understood by those with ordinary skills in the art to which the present application belongs. The terms "first", "second" and similar terms used in the embodiments of the present application do not represent any order, number or importance, but are only used to distinguish different components. The terms "include" or "contain" and similar terms mean that the elements or objects before the terms cover the elements or objects listed after the terms and their equivalents, and do not exclude other elements or objects. The terms "connect" or "connected" and similar terms are not limited to physical or mechanical connections, but can include electrical connections, whether direct or indirect.

[0043] The chitin fiber paper sensor has great significance in large-scale preparation. In the medical and health field, it can be used for wearable monitoring, has good biocompatibility, is suitable for early diagnosis of diseases, and is suitable for various medical scenes. In the environmental monitoring aspect, it is biodegradable and can detect specific substances to help environmental protection. In the field of smart wear, its comfort, flexibility and integration of multifunction can improve user experience. In food safety, it can ensure safety and rapid detection. In industrial production, it can realize quality control and safety monitoring. At the same time, it can effectively utilize waste to promote resource utilization and sustainable development, and provide potential technical and material support for progress and change in many fields.

[0044] Based on this, the embodiment of the present application provides a multi-modal biosensor. A transparent chitin fiber paper is prepared, and an electrochemical-fluorescent-visible light three-modal biosensor is prepared by taking the transparent chitin fiber paper as a transparent flexible substrate material. The obtained multi-modal biosensor has the advantages of low cost, green environmental protection, simple preparation method, and large-scale production.

[0045] Please refer to Figure 1 The preparation method of the multi-modal biosensor provided by the embodiment of the present application comprises the following steps:

[0046] S100, a flexible substrate layer 1 is provided. Please refer to Figure 2 The first side of the flexible substrate layer 1 has a first electrode area 2, a second electrode area 3, an electrochemical field effect biological detection area 4 and a photo-biological detection area 5; the second side of the flexible substrate layer 1 has a third electrode area 6; the electrochemical field effect biological detection area 4, the photo-biological detection area 5, the first electrode area 2 and the second electrode area 3 do not overlap in the horizontal plane; the material of the flexible substrate layer 1 is a transparent flexible material;

[0047] S200, an organic conductive polymer material is provided;

[0048] S300, the organic conductive polymer material is bonded in the first electrode area 2 to form a first electrode 7; the organic conductive polymer material is bonded in the second electrode area 3 to form a second electrode 8; and the organic conductive polymer material is bonded in the third electrode area 6 to form a third electrode 9;

[0049] S400, a photo-biological material and an electrochemical biological material are provided;

[0050] S500, the electrochemical biological material is bonded in the electrochemical field effect biological detection area 4; and the photo-biological material is bonded in the photo-biological detection area 5.

[0051] In some embodiments, the flexible substrate layer 1 can be a transparent chitin fiber paper, which can be prepared from chitin as a raw material. The structural formula of chitin can be shown as formula (1). The chitin raw material has a wide source, for example, it can be derived from the shells of crustacean animals such as shrimp, crab, and insect animals and mold cells. Therefore, the use of chitin fiber paper as the flexible substrate layer 1 can provide sufficient raw materials for large-scale production of multi-modal biosensors. At the same time, compared with ordinary plant fibers and other raw materials, the chitin fiber paper prepared from chitin has various performance advantages. These performance advantages include good film-forming property and flexibility, smooth surface for printing, not easy to break when bending and folding, good antibacterial property, good biocompatibility, and good antistatic property. It can reduce microbial contamination on the surface of the multi-modal biosensor, maintain the performance stability of the sensor, and improve the reliability of multi-modal detection. In a water environment, even in a complex biological environment, such as sweat or saliva, it can prevent microorganisms from interfering with the sensor to some extent, so that various detection modes can operate normally. When used in the human body, it can coexist harmoniously with biological tissues and cells without causing immune reactions or cytotoxicity.

[0052] In this way, by using chitin fiber paper as the flexible substrate layer 1, the flexible substrate layer 1 has high tensile strength through the strong hydrogen bond between chitin molecules, high tear strength through the regular fiber structure between chitin molecules, low allergenicity through the good biocompatibility of chitin, good antibacterial property through the broad-spectrum antibacterial property of chitin, and good environmental friendliness through the biodegradability of chitin. In addition, through the optical transparency of chitin, it is convenient to obtain biological information by detecting changes in fluorescent signals, and at the same time, it does not affect the performance of other detection modes, and the detection is more intuitive.

[0053] In some embodiments, the providing of the flexible substrate layer 1 can include preparing the flexible substrate layer 1. The flexible substrate layer 1 can be prepared by the following steps:

[0054] The chitin is subjected to a purification treatment. The purification treatment can include immersing the chitin in a NaOH aqueous solution and washing with deionized water until the pH of the washing water is substantially unchanged; then immersing the chitin in an HCL aqueous solution and washing with deionized water until the pH of the washing water is substantially unchanged; and then immersing the chitin in ethanol until the color of the ethanol is colorless.

[0055] The purified chitin is used for reaction to obtain a chitin solution. The preparation method can specifically include the following steps: mixing the purified chitin with a NaOH / Urea / water solution, performing ultrasonic dispersion or strong stirring, freezing and thawing, and centrifuging. The supernatant is obtained, and then epoxy chloropropane (ECH) is added for stirring reaction and centrifugation. The mixing ratio of the purified chitin and the NaOH / Urea / water solution can be 1:20. The mass fraction ratio of NaOH, Urea and water can be 11:4:85.

[0056] The chitin solution is laid on a glass substrate to form a thin film. The film can be formed by a flow casting method.

[0057] The glass substrate with the chitin film is immersed in anhydrous ethanol, and then the chitin fiber paper in the form of a hydrogel is obtained by standing.

[0058] In this way, the prepared chitin fiber paper has a transparency greater than 80% and a haze less than 2%.

[0059] In some embodiments, after the chitin fiber paper is prepared, a first treatment is required on both sides (for example, a first side and a second side) of the chitin fiber paper in the thickness direction to form a first electrode area 2, a second electrode area 3 and a third electrode area 6. Generally, the first electrode area 2 is used to bond a first electrode 7 (for example, a source electrode), the second electrode area 3 is used to bond a second electrode 8 (for example, a drain electrode), and the third electrode area 6 is used to bond a third electrode 9 (for example, a gate electrode). The first electrode area 2 and the second electrode area 3 can be arranged on the same side (for example, the first side) of the chitin fiber paper, and the third electrode area 6 can be arranged on the other side (for example, the second side) of the chitin fiber paper.

[0060] In some embodiments, the reagent used in the first treatment can be determined according to the groups introduced on the surface of the conductive polymer used in the first electrode 7, the second electrode 8 and the third electrode 9.

[0061] In some embodiments, a second treatment is required on a first region of the first side of the chitin fiber paper after the first treatment to form an electrochemical field effect biological detection area 4 on the first side of the flexible substrate layer 1. A third treatment, a fourth treatment and a fifth treatment are required on a second region of the first side after the first treatment to form a photo-biological detection area 5 on the first side of the flexible substrate layer 1. The electrochemical field effect biological detection area 4 is used to bond the electrochemical biological material, and the photo-biological material area is used to bond the photo-biological material. Generally, the electrochemical field effect biological detection area 4, the photo-biological detection area 5, the first electrode area 2 and the second electrode area 3 do not overlap in the horizontal projection.

[0062] In some embodiments, the providing the flexible substrate layer 1 can further include:

[0063] The first side and the second side of the flexible substrate layer 1 are respectively subjected to a first treatment to form the first electrode region 2 and the second electrode region 3 with second hydrophilic groups on the first side of the flexible substrate layer 1. The first treatment can be a plasma treatment, and the second hydrophilic groups can be hydroxyl groups. In this way, the flexible substrate layer 1 can be made hydrophilic after the treatment, for example, to facilitate the fixation of the first electrode 7, the second electrode 8, and the third electrode 9.

[0064] The first region of the first side of the flexible substrate layer 1 is provided with a semiconductor material and subjected to a second treatment to form the electrochemical field-effect biological detection region 4 with third hydrophilic groups. The semiconductor material can include graphene, single-walled carbon nanotubes, organic semiconductor thin films, titanium carbide, and silicon nanomaterials. Generally, the resistance of the semiconductor material is much higher than that of the first electrode 7 / second electrode 8 / third electrode 9, for example, the resistance of the semiconductor material can be 20 times or more than that of the first electrode 7 / second electrode 8 / third electrode 9. The semiconductor material can be provided in the first region by techniques such as inkjet printing, screen printing, pen direct writing, or 3D printing. The second treatment can be carboxy pyrene treatment or chloroacetic acid treatment, and the third hydrophilic groups can be carboxyl groups. In this way, the surface of the semiconductor material can be provided with carboxyl groups through treatment with reagents such as carboxy pyrene or chloroacetic acid, and then the surface of the semiconductor material can be modified with electrochemical biological materials.

[0065] The second region of the first side of the flexible substrate layer 1 subjected to the first treatment is subjected to a third treatment, a fourth treatment, and a fifth treatment to form the optical biological detection region 5 with fourth hydrophilic groups on the first side of the flexible substrate layer 1. The third treatment can include a plasma treatment; the fourth treatment can include a carboxylation treatment; the fifth treatment can include a carboxyl activation treatment; and the fourth hydrophilic groups can include succinimidyl ester groups. The second region can be provided with hydrophilic hydroxyl groups after the third treatment (plasma treatment).

[0066] In some embodiments, the carboxylation treatment can be performed using a 1% chloroacetic acid ethanol solution. After the carboxylation treatment, the second region can be provided with a large number of hydrophilic carboxyl groups.

[0067] In some embodiments, the carboxyl group activation process can use EDC (1-(3- Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride) and NHS (N-Hydroxysuccinimide) to activate the carboxyl group. In this way, it is convenient for subsequent modification of the optical bio-detection material in the second region. Specifically, the second region can be reacted with a DNA sequence containing an amino group, and then the biological material is fixed on the surface.

[0068] In some embodiments, in step S200, the organic conductive polymer material has hydrophilicity; and the providing of the organic conductive polymer material can include:

[0069] The organic conductive polymer is provided. Generally, the organic conductive polymer can include polyacetylene, polypyrrole, polyaniline, polythiophene, polyphenylene, and 3,4- ethylenedioxythiophene, etc.

[0070] The first hydrophilic group is modified on the surface of the organic conductive polymer or the organic conductive polymer is polymerized with a hydrophilic polymer to obtain an organic conductive polymer with hydrophilicity. Generally, the first hydrophilic group can include a hydroxyl group, a carboxyl group / carboxylate sodium, a sulfonic acid group, an amino group, a quaternary ammonium group, or a carboxylate group, etc. The hydrophilic polymer can include polyvinyl alcohol, polyethylene glycol, polypropylene glycol, polylactic acid, or polyglycine, etc. In this way, after modification or polymerization, the organic conductive polymer ink soluble in water can be synthesized.

[0071] In some embodiments, in step S300, the organic conductive polymer with hydrophilicity can be prepared into a first electrode 7, a second electrode 8, and a third electrode 9 in a first electrode region 2, a second electrode region 3, and a third electrode region 6, respectively. That is, the organic conductive polymer material is bonded in the first electrode region 2 to form the first electrode 7; the organic conductive polymer material is bonded in the second electrode region 3 to form the second electrode 8; and the organic conductive polymer material is bonded in the third electrode region 6 to form the third electrode 9. Generally, the organic conductive polymer can be formed into different shapes by using techniques such as inkjet printing, screen printing, pen direct writing, or 3D printing, to obtain the first electrode 7 (such as a source electrode), the second electrode 8 (such as a drain electrode), and the third electrode 9 (such as a gate electrode), as shown in FIG. 1. Figure 3 The conductivities of the first electrode 7 (such as a source electrode), the second electrode 8 (such as a drain electrode), and the third electrode 9 (such as a gate electrode) can be set according to specific requirements, and specific adjustment of the conductivity can be achieved by adjusting the thickness of the organic conductive polymer. Generally, the surface resistance can be less than 500 ohms / cm2 .

[0072] In some embodiments, after step S300, the first electrode 7, the second electrode 8 and the third electrode 9 can be further subjected to a hydrophobic treatment to make the first electrode 7, the second electrode 8 and the third electrode 9 hydrophobic. That is, after the organic conductive polymer material is bonded in the first electrode area 2 to form the first electrode 7, in the second electrode area 3 to form the second electrode 8, and in the third electrode area 6 to form the third electrode 9, the first electrode 7, the second electrode 8 and the third electrode 9 are further subjected to a hydrophobic treatment to make the first electrode 7, the second electrode 8 and the third electrode 9 hydrophobic.

[0073] In some embodiments, the hydrophobic treatment corresponds to the type of the first hydrophilic group introduced on the surface of the conductive polymer as described above. It can be understood that the type of the first hydrophilic group determines the type of the hydrophobic treatment. In this way, a stable hydrophobic layer can be formed on the side of the conductive polymer that does not contact the chitin fiber paper.

[0074] In some embodiments, the first hydrophilic group is selected from a carboxyl group. The hydrophobic treatment is a metal ion treatment, and the metal ion is selected from calcium ion, iron ion or lead ion. Alternatively, the first hydrophilic group is selected from a hydroxyl group. The hydrophobic treatment can be a hydrophobic organosilane treatment.

[0075] In some embodiments, in step S400, the optical biological material and the electrochemical biological material can both be DNA materials, each including polynucleotides, etc. The optical biological material can include a DNA hydrogel obtained by mixing and hybridizing nanospheres with fluorescence, L double-stranded DNA and Y-type DNA. The electrochemical biological material includes the L double-stranded DNA and the Y-type DNA.

[0076] Specifically, the specific sequence of the DNA material can be determined according to the biological species to be detected. For example, for the detection of Staphylococcus aureus, the L double-stranded DNA can be formed by hybridization of a first polynucleotide and a second polynucleotide. The sequence of the first polynucleotide can be as described in SEQ ID NO: 1, and the sequence of the second polynucleotide can be as described in SEQ ID NO: 2. Generally, the first polynucleotide can be fixed on a substrate material, such as SA-substrate-NH2, and the second polynucleotide can also be fixed on a substrate material, such as SA-DNAzyme. The first nucleotide fixed on the substrate material SA-substrate-NH2 is specifically SA-substrate-NH2: CTAATGAGTACCTACTGTCTCTGGATGATCCTATGAACTGACT / rA / TGACCTCACTACCAAGGCGCTATCGGGAAGAGCGCTATCGGGAAG-NH2. Wherein rA represents riboadenine. The second nucleotide fixed on the substrate material SA-DNAzyme is specifically SA-DNAzyme: ATGCCATCCTACCAACCACGAAGTACATTTCAAACTCATAACAATCCATCGGTTAGGTCCTGGTTGGAGCTCTGAACTCGAGACAGTAGGTACTCATTAGAGCGCTATCGGGAAG. (Wherein the sequence direction can be 5'-3' direction)

[0077] For the detection of Staphylococcus aureus, the Y-type DNA can be obtained by hybridization of a third polynucleotide (such as Y-1), a fourth polynucleotide (such as Y-2) and a fifth polynucleotide (such as Y-3). The sequence of the third polynucleotide (such as Y-1) can be as described in SEQ ID NO: 3, which is CACGCAGAGTAACACATGACCGTCGAAGCTTCCCGATAGCGC; the sequence of the fourth polynucleotide (such as Y-2) can be as described in SEQ ID NO: 4, which is CTTCGACGGTCATGTACTAGATCAGAGGCTTCCCGATAGCGC; and the sequence of the fifth polynucleotide (such as Y-3) can be as described in SEQ ID NO: 5, which is CCTCTGATCTAGTATGTTACTCTGCGTGCTTCCCGATAGCGC. (Wherein the sequence direction can be 5'-3' direction)

[0078] In some embodiments, for the optical biological material, L double-stranded DNA, Y-type DNA and nanospheres bonded with fluorescent materials can be mixed and hybridized at room temperature to form a stable DNA hydrogel. The fluorescent material can be fluorescent protein, quantum dots, organic fluorescent dye and metal complex, etc. The nanospheres can be nanogold, nanomagnetic spheres and polymer spheres, etc. The fluorescent material is combined with the surface of the nanospheres through a chemical bond to form a stable fluorescent sphere. In this way, in the light analysis area 1313 of the optical biological detection area 5, transmission analysis of fluorescence and ultraviolet visible light can be performed, for example, the fluorescence signal and the ultraviolet visible light signal can be obtained by using a fluorescence protractor and an ultraviolet visible light protractor for detection.

[0079] In some embodiments, in step S500, when the electrochemical field effect biological detection area 4 is bonded with the electrochemical biological material, the L double-stranded DNA and Y-type DNA can be modified on the electrochemical field effect biological detection area 4 in turn by using a layer-by-layer self-assembly method, and the modification can be repeated multiple times. When detecting, the L double-stranded DNA in the electrochemical biological material will be broken when reacting with Staphylococcus aureus, thereby reducing the negative electric property of the surface of the semiconductor material and affecting the conductivity, so as to realize the detection of Staphylococcus aureus.

[0080] In some embodiments, when detecting, in the optical biological detection area 5, the fluorescence signal and the ultraviolet visible light signal can be obtained by using a fluorescence protractor and an ultraviolet visible light protractor for detection. In this way, an electrochemical-fluorescence-visible light three-modal biosensor, i.e., a multi-modal biosensor, is obtained.

[0081] In some embodiments, the method can further include: disposing a first insulating layer 9 on a first side in the thickness direction of the obtained multi-modal biosensor, please refer to Figure 4 and Figure 5 Disposing a second insulating layer 11 on a second side in the thickness direction of the obtained multi-modal biosensor. The first insulating layer 9 can be provided with a first hollow area 12. The orthographic projection of the first hollow area 12 on the second insulating layer 11 covers the orthographic projection of the optical biological detection area 5 and the electrochemical field effect biological detection area 4 on the second insulating layer 11. The first insulating layer 9 and the second insulating layer 11 can play the role of preventing scratching, dust and static electricity, etc.

[0082] In some possible embodiments, the second insulating layer 11 can be provided with a second hollow area. The orthographic projection of the second hollow area on a reference plane (for example, a plane parallel to the second insulating layer 11) is located within the orthographic projection of the first hollow area 12 on the reference plane (for example, a plane parallel to the second insulating layer 11), and does not overlap with the orthographic projection of the optical biological detection area 5 and the electrochemical field effect biological detection area 4 on the reference plane.

[0083] In some possible embodiments, the multi-modal biosensor prepared by the embodiments of the present application can be directly observed by naked eyes, and the concentration range of the test sample to be detected can be roughly evaluated to achieve preliminary measurement. Generally, the color of the electrochemical field effect biosensing region starts from black and gradually fades to colorless with the increase of the concentration, while the color of the optical biosensing region starts from red and gradually fades to colorless with the increase of the concentration. The color of the electrochemical field effect biosensing region and the optical biosensing region after the reaction can be compared with the colorimetric card prepared in advance, so as to roughly determine the concentration of the test sample (for example, Staphylococcus aureus) to be detected.

[0084] Based on the same inventive concept, the embodiments of the present application also provide a multi-modal biosensor corresponding to the method of any of the above embodiments. The multi-modal biosensor is prepared by the preparation method of the multi-modal biosensor as described in any of the above embodiments.

[0085] Reference Figure 2 The multi-modal biosensor can include a flexible substrate layer 1, and the material of the flexible substrate layer 1 is a transparent flexible material. The first side of the flexible substrate layer 1 is bonded with a first electrode 7, a second electrode 8, optical biological materials and electrochemical biological materials. The optical biological materials are used for optical biological detection, and the electrochemical biological materials are used for electrochemical biological detection. The second side of the flexible substrate layer 1 is bonded with a third electrode 9. The first electrode 7, the second electrode 8 and the third electrode 9 are respectively prepared by using a conductive polymer material.

[0086] In some embodiments, the first side of the flexible substrate layer 1 is provided with a first electrode region 2, a second electrode region 3, an optical biosensing region 5 and an electrochemical field effect biosensing region 4. The electrochemical field effect biosensing region 4, the optical biosensing region 5, the first electrode region 2 and the second electrode region 3 do not overlap in the orthographic projection in the horizontal plane (i.e., the reference plane, for example, the plane parallel to the second insulating layer 11). The first electrode 7 is bonded and connected with the first electrode region 2, the second electrode 8 is bonded and connected with the second electrode region 3, the optical biological materials are bonded and connected with the optical biosensing region 5 (for example, the bonding can be realized by the reaction between the carboxyl group of the optical biosensing region 5 and the amino group in the optical biological materials), and the field effect biological materials are bonded and connected with the electrochemical field effect biosensing region 4 (for example, the bonding can be realized by the reaction between the carboxyl group of the electrochemical field effect biosensing region 4 and the amino group in the optical biological materials).

[0087] In some embodiments, a third electrode region 6 can be disposed on the second side of the flexible substrate layer 1. The third electrode 9 is bonded to the third electrode region 6. The resistance of the electrochemical field effect bio-detection region 4 is 20 times or more than the resistance of the first electrode 7 / second electrode 8 / third electrode 9.

[0088] In some embodiments, the optical bio-detection region 5 and the electrochemical field effect bio-detection region 4 can be disposed in the detection region. One end of the detection region can be connected to the first electrode region 2 and the second electrode region 3, respectively.

[0089] In some embodiments, the multi-modal biosensor further comprises a first insulating layer 9 disposed on the first side of the flexible substrate layer 1 in the thickness direction. The first insulating layer 9 is provided with a first hollow region 12. The first hollow region 12 covers the projection of the electrochemical field effect bio-detection region 4 on the second insulating layer 11 and the projection of the optical bio-detection region 5 on the second insulating layer 11.

[0090] In some embodiments, the multi-modal biosensor further comprises a second insulating layer 11 disposed on the second side of the flexible substrate layer 1 in the thickness direction. That is, the second insulating layer 11 is disposed on the second side of the flexible substrate layer 1 in the thickness direction.

[0091] In some possible embodiments, the second insulating layer 11 can be provided with a second hollow region.

[0092] It should be understood that the multi-modal biosensor provided by the embodiments of the present application is prepared by the preparation method of the multi-modal biosensor of any of the foregoing embodiments, and therefore has the effects of the preparation method of the multi-modal biosensor of any of the foregoing embodiments.

[0093] The technical solutions of the present application will be further described in combination with specific embodiments.

[0094] In the following examples, the experimental methods are conventional methods unless otherwise specified.

[0095] In the following examples, the test materials used are commercially available from conventional biochemical reagent stores unless otherwise specified.

[0096] Example: Preparation of electrochemical-fluorescent-visible light three-modal biosensor

[0097] 1. Preparation of transparent chitin fiber paper by hydrogel method:

[0098] (1) Chitin hydrogel purification: weigh 10g chitin, soak in 5% NaOH aqueous solution for 48h, wash with deionized water for 3 times (10000rpm, 5min), until the pH of washing water is basically unchanged; then soak in 7% HCL aqueous solution for 49h, wash with deionized water for 3 times (10000rpm, 5min), until the pH of washing water is basically unchanged; then soak in ethanol for multiple times, use ice water mixture to cool, ultrasonic treatment for 12h, until the color of ethanol becomes colorless; centrifugal filtration, dry in 60℃ oven for 24h.

[0099] (2) Chitin hydrogel preparation: weigh a certain amount of purified chitin, add NaOH / Urea / water solution according to the ratio of 1:20, the mass fraction ratio is about 11:4:85, mix uniformly by ultrasonic treatment or strong stirring, then freeze at -40℃ for 4h, then take out and stir with a glass rod to thaw; repeat the freezing-thawing step for at least three times; then use a centrifuge at 0℃, 8000rpm for 15min; then transfer the supernatant to a clean beaker, stir in ice water, add epoxy chloropropane (ECH) 1mL drop by drop, continue to stir for 2h; then centrifuge at 0℃, 8000rpm for 5min to remove the residual gas in the liquid.

[0100] (3) Use casting to evenly spread the chitin solution on the glass substrate to form a thin film, use 0.22 micron plastic film on both sides, then use filter paper to absorb water.

[0101] (4) Formation of chitin fiber paper: place anhydrous ethanol at 4℃, then immerse the glass substrate in anhydrous ethanol, then stand for several hours, finally obtain chitin hydrogel, the transparency of transparent chitin fiber paper is greater than 80%, and the haze is less than 2%.

[0102] 2. Preparation of electrochemical field effect device

[0103] (1) Modify the hydrophilic group carboxyl on the surface of the organic conductive polymer structure 3,4-ethylenedioxythiophene to obtain a soluble conductive polymer composite material.

[0104] (2) Use plasma cleaning machine to treat the surface of chitin fiber paper to make the surface have rich hydroxyl groups, so that the surface treatment obtains a hydrophilic region, including the first electrode area 2, the second electrode area 3, and the fixation of the first electrode 7, the second electrode 8, the third electrode 9, the photo-biomaterial and the electrochemical biomaterial.

[0105] (3) Use inkjet printing technology to form different shapes of conductive polymers on the surface of the hydrophilic chitin fiber paper to obtain source, drain and gate, and the conductivity of the wire can be adjusted by the thickness of the material, and the surface resistance is less than 500 ohms / cm2 .

[0106] (4) The conductive polymer with hydroxyl groups is reacted with hydrophobic organosilane to form a stable hydrophobic layer.

[0107] (5) The semiconductor region (i.e. electrochemical field effect biological detection zone 4) uses semiconductor single-walled carbon nanotubes as the sensitive region of the field effect tube. The overall resistance is much higher than the wire resistance, more than 20 times. The semiconductor single-walled carbon nanotube material is treated with carboxyl pyrene dissolved in organic reagent, so that the surface of the semiconductor single-walled carbon nanotube material obtains carboxyl groups for subsequent modification.

[0108] 3. Pretreatment of flexible substrate layer 1 before preparation of optical sensitive device:

[0109] (1) The surface of the optical sensitive region (i.e. optical detection zone) is treated with a plasma cleaning machine to make the surface have abundant hydroxyl groups; then the region is treated with 1% chloroacetic acid ethanol solution to obtain a large number of carboxyl groups;

[0110] (2) EDC: 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, NHS: N-hydroxysuccinimide, activate the carboxyl groups so that they can react with DNA sequences containing amino groups, and then fix the biological materials on the surface.

[0111] 4. Bonding of corresponding materials in optical biological detection zone 5 and electrochemical field effect biological detection zone 4

[0112] Optical biological detection zone 5: Mix L double-stranded DNA, Y-type DNA and nanospheres containing fluorescent materials according to a molar ratio of 9:6:1, quickly drop coat on the optical biological detection zone 5, and react in a normal temperature and high humidity environment for 2 hours to form a stable gel structure. The nanospheres can be polymer spheres, and the fluorescence can be fluorescent protein. The fluorescent protein on the surface of the nanospheres is combined through chemical bonds to form stable fluorescent spheres.

[0113] Wherein, L double-stranded DNA is formed by hybridization of SA-substrate and SA-DNAzyme. SA-substrate-NH2: CTAATGAGTACCTACTGTCTCTGGATGATCCTATGAACTGACT / rA / TGACCTCACTACCAAGGCGCTATCGGGAAGAGCGCTATCGGGAAG-NH2. SA-DNAzyme: ATGCCATCCTACCAACCACGAAGTACATTCAAACTCATAACAATCCATCGGTTAGGTCCTGGTTGGAGCTCTGAAC TC GAGAC AGT AGGT ACT CATT AGAGC GCT ATC GGGAAG.

[0114] Y-type DNA is formed by hybridization of Y1, Y2 and Y3. Wherein, Y-1: CACGCAGAGTAACACATGACCGTCGAAGCTTCCCGATAGCGC. Y-2: CTT CGACGGTCATGTACTAGATCAGAGGCTTCCCGATAGCGC. Y-3: CCTCTGATCTAGTATGTTACTCTGCGTGCTTCCCGATAGCGC.

[0115] Electrochemical field-effect biological detection area 4: L double-stranded DNA and Y-type DNA are modified in sequence by layer-by-layer self-assembly, and multiple cycles of modification are performed.

[0116] In this way, an electrochemical-fluorescent-visible light three-modal biosensor for detecting Staphylococcus aureus is prepared.

[0117] Test example: test the performance of the multi-modal biosensor prepared in the embodiment

[0118] Experimental method: provide Staphylococcus aureus solutions with concentrations of 1 cfu / ml, 10 cfu / ml, 10 2 cfu / ml, 10 3 cfu / ml, 10 4 cfu / ml and 10 5 cfu / ml, respectively. Different concentrations of Staphylococcus aureus solution are added dropwise to the electrochemical field-effect biological detection area 4 and the optical biological detection area 5 of the multi-modal biosensor.

[0119] The change in the ultraviolet-visible light absorbance intensity of the multi-modal biosensor is detected by a UV spectrophotometer with model number DR6000.

[0120] The voltage-current signal change is tested by linear voltammetry of a type CHI760E electrochemical workstation;

[0121] The fluorescence signal change is tested by a fluorescence spectrophotometer of a type FS5 fluorescence spectrometer;

[0122] The performance curve of the electrochemical field effect transistor is tested by a double channel of the electrochemical workstation CHI760E.

[0123] The detection results are as shown in Table 1. Figures 6 to 9 Table 1 Figure 6 is a fluorescence signal change schematic diagram. Figure 7 is a voltage-current signal change schematic diagram. Figure 8 is a UV-Vis absorbance intensity change schematic diagram. Figure 9 is an electrochemical field effect transistor performance curve schematic diagram.

[0124] From the detection results, it can be known that the multi-modal biosensor prepared in the embodiments of the present application can realize accurate detection by using the related detection equipment of ultraviolet-visible light, electrochemistry, fluorescence and the like, and the detection concentration interval is expanded by using the different sensitivity and linear range of different detection methods; the electrochemical field effect biosensing area and the optical biosensing area both have good sensitivity during detection.

[0125] It should be understood by those skilled in the art that the discussion of any of the above embodiments is merely exemplary and is not intended to suggest that the scope of the disclosure (including the claims) is limited to these examples; under the idea of the present disclosure, the technical features in the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other changes of different aspects of the embodiments of the present disclosure as described above, which are not provided in details for the sake of brevity.

[0126] Although the present disclosure has been described in conjunction with the specific embodiments thereof, it will be readily apparent to those skilled in the art that numerous substitution, modification, and changes in the embodiments can be made thereto without departing from the spirit and scope of the disclosure as set forth in the preceding description.

[0127] The embodiments of the present disclosure are intended to cover all such alternatives, modifications, and variations as falling within the broad scope of the appended claims. Accordingly, any omission, modification, equivalent replacement, improvement, etc. made within the spirit and principle of the embodiments of the present disclosure should be included in the protection scope of the present disclosure.

Claims

1. A method of preparing a multi-modal biosensor, characterized by, The application relates to a multi-modal biosensor, comprising: providing a flexible substrate layer; the first side of the flexible substrate layer is provided with a first electrode area, a second electrode area, an electrochemical field effect biosensing area and a photo-biosensing area; the second side of the flexible substrate layer is provided with a third electrode area; the electrochemical field effect biosensing area, the photo-biosensing area, the first electrode area and the second electrode area do not overlap in the orthographic projection of a horizontal plane; wherein the material of the flexible substrate layer is a transparent flexible material; the first side and the second side are oppositely arranged; providing an organic conductive polymer material; the organic conductive polymer material has hydrophilicity; bonding the organic conductive polymer material in the first electrode area to form a first electrode; bonding the organic conductive polymer material in the second electrode area to form a second electrode; and bonding the organic conductive polymer material in the third electrode area to form a third electrode; providing photo-biological materials and electrochemical biological materials; the photo-biological materials and the electrochemical biological materials respectively comprise nucleotides; bonding the electrochemical biological materials in the electrochemical field effect biosensing area; and bonding the photo-biological materials in the photo-biosensing area, so as to obtain the multi-modal biosensor; wherein the providing of the organic conductive polymer material comprises: providing an organic conductive polymer; and modifying a first hydrophilic group on the surface of the organic conductive polymer or polymerizing the organic conductive polymer with a hydrophilic polymer, so as to obtain the organic conductive polymer material with hydrophilicity.

2. The method of claim 1, wherein the method further comprises: The material of the flexible substrate layer is chitin fiber paper.

3. The method of claim 2, wherein the method further comprises: The providing of the flexible substrate layer further comprises: respectively performing a first treatment on the first side and the second side of the flexible substrate layer, so as to form the first electrode area and the second electrode area with a second hydrophilic group on the first side of the flexible substrate layer, and form the third electrode area with a second hydrophilic group on the second side of the flexible substrate layer; performing a second treatment on a first area of the first side of the flexible substrate layer, so as to form the electrochemical field effect biosensing area with a third hydrophilic group on the first area; performing a third treatment, a fourth treatment and a fifth treatment on a second area of the first side of the flexible substrate layer, so as to form the photo-biosensing area with a fourth hydrophilic group on the first side of the flexible substrate layer.

4. The method of claim 3, wherein the method further comprises: The first treatment comprises plasma treatment; the second hydrophilic group comprises a hydroxyl group; the second treatment comprises carboxy pyrene treatment or chloroacetic acid treatment; the third hydrophilic group is a carboxyl group; the third treatment comprises plasma treatment; the fourth treatment comprises carboxylation treatment; the fifth treatment comprises carboxyl activation treatment; and the fourth hydrophilic group comprises a succinimidyl group.

5. The method of claim 3, wherein the plurality of modalities are selected from the group consisting of: electrical, optical, thermal, mechanical, magnetic, chemical, and biological. bonding the organic conductive polymer material in the first electrode area to form a first electrode; bonding the organic conductive polymer material in the second electrode area to form a second electrode; after the bonding of the organic conductive polymer material in the third electrode area to form a third electrode, further comprising: The first electrode, the second electrode and the third electrode are subjected to a hydrophobic treatment so as to have hydrophobicity.

6. The method of claim 5, wherein the plurality of modalities are selected from the group consisting of: electrical, optical, thermal, mechanical, magnetic, chemical, and biological. The first hydrophilic group is selected from a carboxyl group; and the hydrophobic treatment is a metal ion treatment, and the metal ion is selected from a calcium ion, an iron ion or a lead ion.

7. The method of claim 5, wherein the plurality of modalities are selected from the group consisting of: electrical, optical, thermal, mechanical, magnetic, chemical, and biological. The first hydrophilic group is selected from a hydroxyl group; and the hydrophobic treatment is a hydrophobic organosilane treatment.

8. The method of claim 1, wherein the multi-modal biosensor is prepared by, The optical biomaterials include nanospheres bonded with fluorescent materials, L double-stranded DNA and Y-type DNA mixed hybridization DNA hydrogels; and the electrochemical biomaterials include L double-stranded DNA and Y-type DNA.

9. The method of claim 1, wherein the multi-modal biosensor is prepared by, The method further comprises: disposing a first insulating layer on the first side, and / or disposing a second insulating layer on the second side; wherein the first insulating layer is provided with a first hollow area; and a normal projection of the first hollow area on the second insulating layer covers a normal projection of the optical biomaterial detection area on the second insulating layer and a normal projection of the electrochemical field effect biomaterial detection area on the second insulating layer.

10. A multi-modal biosensor, characterized in that, The preparation method of the multi-modal biosensor is prepared by using the preparation method of any one of claims 1-9. The preparation method of the multi-modal biosensor is prepared by using the preparation method of any one of claims 1-9.

Citation Information

Patent Citations

  • Unmarked biosensor with high stability and manufacturing method of unmarked biosensor

    CN112378972A

  • Electrochemical luminescence biosensor, preparation method thereof and electrochemical luminescence system

    CN117110276A