A method for increasing yield in rice

Abstract

The application belongs to the technical field of plant genetic engineering, and discloses a method for increasing rice yield, aiming to solve the technical problem of light inhibition of rice under high light intensity, which leads to reduced photosynthetic efficiency and then reduced yield. OsJAB1 The method increases the expression amount of the target gene in the plant, increases the vitamin C content in the plant, improves the photosynthetic electron transfer efficiency, promotes dry matter accumulation and grain development, and finally increases the rice yield.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and specifically relates to a method for increasing rice yield, particularly a method for increasing rice yield using the OsJAB1 protein. Background Technology

[0002] Rice (Oryza sativa L.) is a major global food crop, and its yield stability is directly related to national food security and sustainable agricultural development. With continued population growth and increasingly scarce arable land resources, improving rice yield through bio-breeding techniques has become an important direction in agricultural research. Photosynthesis is the material basis for crop yield formation, and its efficiency directly affects rice biomass and grain yield.

[0003] While sufficient sunlight is essential for photosynthesis, excessive sunlight can trigger photoinhibition, damaging the photosynthetic apparatus of rice, reducing light energy conversion efficiency, and decreasing the accumulation of photosynthetic assimilates. This phenomenon is particularly prominent in the sun-drenched rice-growing regions of Northwest and South my country, often resulting in incomplete grain filling and yield reductions of 10%–15%, making it a key factor limiting high and stable rice yields.

[0004] Currently, most methods to alleviate photoinhibition rely on cultivation measures (such as adjusting planting density and optimizing water and fertilizer management) or breeding stress-resistant varieties. While these methods have some effect, they generally suffer from problems such as complex operation, high cost, and difficulty in promotion, and they fail to fundamentally solve the problem of oxidative damage to the photosynthetic system under high light stress. High light intensity induces a large accumulation of reactive oxygen species (ROS), exceeding the plant's endogenous antioxidant system's scavenging capacity, leading to damage to thylakoid membrane structure, decreased photosynthetic enzyme activity, and enhanced photorespiration, further weakening net photosynthetic efficiency. Existing breeding methods are unable to simultaneously enhance high light resistance and antioxidant capacity while increasing yield, failing to overcome the physiological bottleneck of rice under high light conditions.

[0005] Therefore, precisely regulating the antioxidant defense system of rice at the molecular level to reduce oxidative damage caused by high light and maintain photosynthetic electron transfer efficiency, thereby significantly improving photosynthetic efficiency and material accumulation under strong light conditions, has become a core technical problem that urgently needs to be solved in the current genetic improvement of rice. Summary of the Invention

[0006] To achieve the above-mentioned objectives, the present invention is implemented through the following technical solution:

[0007] A method for increasing rice yield includes the following steps:

[0008] Overexpression of the OsJAB1 protein in rice OsJAB1 Genes, making the OsJAB1Increased gene expression levels lead to larger rice grains, thereby increasing rice yield.

[0009] Among them, the OsJAB1 The nucleotide sequence of the gene is shown in SEQ ID NO.1. OsJAB1 The amino acid sequence of the OsJAB1 protein encoded by the gene is shown in SEQ ID NO.2.

[0010] Furthermore, overexpression in rice OsJAB1 Genes, including the following steps:

[0011] (1) Insert the nucleotide sequence shown in SEQ ID NO.1 into the cloning site of the pCAMBIA1307 vector. Spe I and Sal I Between these steps, the recombinant plasmid pCAMBIA1307- was obtained. OsJAB1 ;

[0012] (2) The recombinant plasmid pCAMBIA1307- from step (1) is used to... OsJAB1 Introducing Agrobacterium tumefaciens yields recombinant Agrobacterium tumefaciens;

[0013] (3) Transform rice plants with the recombinant Agrobacterium described in step (2) to obtain a homozygous transgenic line that can be stably inherited.

[0014] Furthermore, the recombinant plasmid pCAMBIA1307- OsJAB1 The construction method is as follows:

[0015] (1) Design specific primers F1 and R1, and use PCR amplification OsJAB1 Gene;

[0016] (2) Using restriction endonucleases Spe I and Sal The PCR amplification product obtained by the double enzyme digestion step (1) is used to obtain the double enzyme digestion product; the pCAMBIA1307 vector;

[0017] (3) Using restriction endonucleases Spe I and Sal The pCAMBIA1307 vector was double-digested with enzyme I to obtain the vector backbone.

[0018] (4) The double enzyme digestion product obtained in step (2) and the vector backbone obtained in step (3) are ligated to obtain the recombinant plasmid pCAMBIA1307- OsJAB1 ;

[0019] The nucleotide sequence of the specific primer F1 is shown in SEQ ID NO.3, and the nucleotide sequence of the specific primer R1 is shown in SEQ ID NO.4. Beneficial effects

[0020] This invention achieves this by overexpressing in rice OsJAB1 This gene effectively increased the endogenous vitamin C content in the plant, ensuring stable photosynthesis under high light intensity conditions. This method improved the actual photochemical efficiency (ETR) and carbon assimilation capacity of rice, promoting the accumulation of photosynthetic products. Ultimately, it significantly increased the thousand-grain weight, resulting in a significant increase in rice yield. Attached Figure Description

[0021] Figure 1 yes OsJAB1 Schematic diagram of plant overexpression vector.

[0022] Figure 2 yes OsJAB1 The results of expression level detection in different overexpression transgenic materials (OE2 and OE3) are shown in the figure.

[0023] Figure 3 yes OsJAB1 The results of vitamin C (AsA) content in overexpression transgenic materials (OE2 and OE3) are shown in the figure.

[0024] Figure 4 yes OsJAB1 Overexpression of transgenic materials (OE2 and OE3) at low (36 μmol / m 2 .s), medium (336 umol / m 2 .s) and high light intensity (611, 801 and 1251 umol / m 2 The results of photosynthetic electron transport efficiency (ETR) under .s).

[0025] Figure 5 yes OsJAB1 Photos of overexpression transgenic materials (OE2 and OE3) and WT rice grain size.

[0026] Figure 6 yes OsJAB1 The results of overexpression transgenic materials (OE2 and OE3) and WT rice thousand-grain weight are shown in the figure. Detailed Implementation

[0027] To enable those skilled in the art to better understand the technical solutions of this invention, the present application will be further described in detail below with reference to embodiments. Example 1

[0028] I. Construction of Recombinant Plasmids

[0029] 1. Total RNA was extracted from rice flower 11 and then reverse transcribed to obtain cDNA.

[0030] 2. Using the cDNA obtained in step 1 as a template, PCR amplification was performed using specific primers F1 (SEQ ID NO.3) and R1 (SEQ ID NO.4), and the PCR amplification products were recovered.

[0031] 3. Using restriction endonucleases Spe I and Sal The PCR amplification product obtained from step 2 of double enzyme digestion was recovered.

[0032] 4. Using restriction endonucleases Spe I and Sal The pCAMBIA1307 vector was digested with two enzymes, and the vector backbone was recovered.

[0033] 5. Ligate the enzyme digestion product obtained in step 3 with the vector backbone obtained in step 4 to obtain the recombinant plasmid pCAMBIA1307- OsJAB1 Recombinant plasmid pCAMBIA1307- OsJAB1 See the component diagram. Figure 1 .

[0034] II. Genetically Modified Organisms OsJAB1 The acquisition of genetically modified rice

[0035] 1. The recombinant plasmid pCAMBIA1307- OsJAB1 Agrobacterium LBA4404 was introduced to obtain recombinant Agrobacterium.

[0036] 2. The recombinant Agrobacterium obtained in step 1 was suspended in liquid ASAA medium to obtain OD. 600nm Bacterial solution with a value of 0.3.

[0037] Liquid ASAA medium: Liquid NB medium containing 2 mg / L 2,4-D and 100 μM / L AS.

[0038] 3. Take the seeds of rice Zhonghua 17, sterilize them with 75% ethanol, then place them on solid NB medium plates and incubate them in the dark at 28 ℃ for 2 weeks. Then transfer the callus tissue to a new solid NB medium plate and incubate it in the dark at 28 ℃ for 2 weeks. Finally, transfer the callus tissue to a new solid NB medium plate and incubate it in the dark at 28 ℃ for 2 weeks.

[0039] 4. After completing step 3, place the naturally dispersed, light yellow embryogenic callus particles from the callus tissue onto a subculture medium plate and incubate in the dark at 28°C for 3 days.

[0040] Subculture medium: solid NB medium containing 2 mg / L 2,4-D.

[0041] 5. After completing step 4, take the callus tissue and soak it in the bacterial solution obtained in step 2 for 15 minutes, gently shaking it during the process.

[0042] 6. After completing step 5, take the callus tissue, blot the surface bacterial solution with filter paper, and then place it on a co-culture medium plate and incubate in the dark at 22 ℃ for 3 days.

[0043] Co-culture medium: solid NB medium containing 2 mg / L 2,4-D and 100 μM AS.

[0044] 7. After completing step 6, take the callus tissue and place it on a selection medium plate for dark incubation at 28°C for 2 weeks. Then transfer the callus tissue to a new selection medium plate for dark incubation at 28°C for 2 weeks. Finally, transfer the callus tissue to a new selection medium plate for dark incubation at 28°C for 2 weeks.

[0045] Screening medium: solid NB medium containing 2 mg / L 2,4-D and 50 mg / L hygromycin.

[0046] 8. After completing step 7, take fresh callus tissue that is growing vigorously and is milky white or slightly yellow, place it on a predifferentiation medium plate, first culture it in the dark at 28°C for 1 week, then culture it in the light at 28°C for 2 weeks, and then transfer it to a differentiation medium plate and culture it in the light at 28°C to obtain differentiated seedlings.

[0047] Predifferentiation medium: solid NB medium containing 5 mg / L ABA and 0.5 mg / L NAA.

[0048] Differentiation medium: solid NB medium containing 0.5 mg / L NAA and 3 mg / L 6-BA.

[0049] 9. After completing step 8, transfer the well-growing differentiated seedlings to Erlenmeyer flasks containing solid MS medium, culture at 28°C under light for 1-2 weeks, and then transplant them to a greenhouse for continued cultivation until the seeds are harvested, which are the T1 generation seeds.

[0050] 10. Cultivate T1 generation seeds into plants, which are T1 generation plants. Self-pollinate T1 generation plants to obtain T2 generation seeds.

[0051] 12. Cultivate T2 generation seeds into plants, which are T2 generation plants. Self-pollinate T2 generation plants to obtain T3 generation seeds.

[0052] 13. The T3 generation seeds are cultivated into plants, which are called T3 generation plants.

[0053] For a given T1 generation plant, if the following two conditions are met, the T1 generation plant is a transgenic plant with a single copy insertion: ① The T1 generation plant has hygromycin resistance; ② Among the T2 generation plants obtained by self-pollination of the T1 generation plant, the ratio of hygromycin-resistant plants to non-hygromycin-resistant plants is approximately 3:1.

[0054] For a given T2 generation plant, if the following three conditions are met, the T2 generation plant and its self-pollinated offspring are considered a homozygous transgenic line: ① The T2 generation plant has hygromycin resistance; ② Its T1 generation plant is a single-copy transgenic plant; ③ All sampled T3 generation plants have hygromycin resistance.

[0055] III. In transgenic lines OsJAB1 Detection of gene expression levels

[0056] Two lines, OE2 and OE3, were selected from the homozygous transgenic lines obtained in the above steps, and the T3 generation plants of these two lines were identified. Rice Zhonghua 17 was used as the wild-type WT control for the transgenic lines.

[0057] Total RNA was extracted from 4-week-old rice plants of both lines and reverse transcribed into cDNA. The cDNA was then used as a template for identification by quantitative PCR. OsJAB1 Gene expression levels.

[0058] PCR identification OsJAB1 The primers for the gene are shown in Table 1.

[0059] Table 1

[0060] Primer name Primer sequence (5'-3') F2 GGTAACTCGGGATAGCTC (SEQ ID NO.5) R2 TGCTTCAACCATAGGCTCAG (SEQ ID NO.6)

[0061] Rice plants of variety 17 OsJAB1 Gene expression level is used as 1 to calculate the expression level of the transgenic line in the plants. OsJAB1 The relative expression level of genes.

[0062] Depend on Figure 2 It can be seen that, compared with wild-type plants, the OE2 and OE3 lines... OsJAB1 Gene expression levels were significantly increased in all strains, particularly in the OE3 line. OsJAB1 The highest gene expression level indicates that OsJAB1 The gene has been successfully integrated into the genome of Zhonghua 17 rice and can be stably inherited.

[0063] IV. Determination of Vitamin C Content

[0064] The content of AsA in leaves was determined by high performance liquid chromatography (HPLC). 0.5 g of fresh leaves were ground in liquid nitrogen, extracted with 5% metaphosphoric acid solution, centrifuged at high speed, and the supernatant was filtered through a 0.22 µm filter before injection. A C18 column was used, the mobile phase was 0.1% phosphoric acid solution, and the detection wavelength was 254 nm.

[0065] Depend on Figure 3 It can be seen that, compared with wild-type plants, the overexpression of OsJAB1The OE2 and OE3 lines of the gene had significantly higher AsA content than the wild-type plants, indicating that overexpression of the gene in rice... OsJAB1 Genes can significantly increase the AsA content in rice leaves.

[0066] V. ETR Detection

[0067] In a greenhouse, T3 generation rice plants of the OE2 and OE3 lines and Zhonghua 17 (WT) rice were grown in pots. The planting conditions were set as follows: In July in Beijing, under natural conditions, Zhonghua 17 (WT) rice at the tillering stage (30 days after planting) and T3 generation rice plants of the OE2 and OE3 lines were placed in the dark for 12 hours, and then subjected to light treatment of different intensities.

[0068] The illumination treatments were: 36 (simulating low light intensity), 336 (simulating medium light intensity), and 611, 801, and 1251 µmol m. -2 s -1 (Simulated high light intensity) and the photosynthetic electron transfer efficiency (ETR) was detected using a chlorophyll fluorometer.

[0069] Depend on Figure 4 It can be seen that at a low light intensity of 36 µmol m -2 s -1 Neutral light intensity 336µmol m -2 s -1 Under light treatment, overexpression OsJAB1 There was no significant difference in ETR between the OE2 and OE3 lines and the wild-type lines; however, at high light intensities of 611, 801, and 1251 µmol / m², the difference was not significant. -2 s -1 Under light treatment, compared with the wild-type strain, the overexpressed... OsJAB1 The ETR of both the OE2 and OE3 lines was significantly increased, especially at 801 µmol m -2 s -1 The ETR was maximized under high light intensity treatment, indicating that overexpression in rice... OsJAB1 Genes can significantly increase ETR, thereby promoting dry matter accumulation.

[0070] VII. Thousand-grain weight determination

[0071] After the plant matures, 801 µmol m -2 s -1 The weight of 1000 grains of OE2, OE3 and WT rice under high light intensity treatment was randomly measured (and dried to constant weight).

[0072] Depend on Figure 5 It can be seen that, compared with the wild-type strain, the overexpression of OsJAB1The seeds of the OE2 and OE3 lines were significantly larger. Figure 6 It can be seen that, compared with the wild-type strain, the overexpression of OsJAB1 The thousand-grain weight of the OE2 and OE3 lines was significantly increased. This indicates that overexpression of the gene... OsJAB1 Genes can make rice grains larger, thereby increasing the thousand-grain weight and ultimately leading to increased yield.

[0073] In summary, this invention significantly enhances the antioxidant capacity of rice under high light stress by overexpressing the OsJAB1 gene, maintains efficient photosynthetic electron transport, improves photosynthetic efficiency, promotes dry matter accumulation, and ultimately significantly increases rice grain yield. The technical solution provided by this invention optimizes the physiological metabolic processes of rice at the gene level through precise molecular biology methods, solving the problem of yield decline caused by photoinhibition. It provides a solid theoretical foundation and practical methods for breeding high-yielding, high-quality, and widely adaptable new rice varieties, and has immeasurable value for ensuring global food security and promoting sustainable agricultural development.

Claims

1. A method for increasing rice yield, characterized in that, Includes the following steps: Overexpression of the OsJAB1 protein in rice OsJAB1 Genes, making the OsJAB1 Increased gene expression levels lead to larger rice grains, thereby increasing rice yield. Among them, the OsJAB1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. OsJAB1 The amino acid sequence of the OsJAB1 protein encoded by the gene is shown in SEQ ID NO.

2.

2. The method according to claim 1, characterized in that, Overexpression in rice OsJAB1 Genes, including the following steps: (1) Insert the nucleotide sequence shown in SEQ ID NO.1 into the cloning site of the pCAMBIA1307 vector. Spe I and Sal I Between these steps, the recombinant plasmid pCAMBIA1307- was obtained. OsJAB1 ; (2) The recombinant plasmid pCAMBIA1307- from step (1) is used to... OsJAB1 Introducing Agrobacterium tumefaciens yields recombinant Agrobacterium tumefaciens; (3) Transform rice plants with the recombinant Agrobacterium described in step (2) to obtain a homozygous transgenic line that can be stably inherited.

3. The method according to claim 2, characterized in that, The recombinant plasmid pCAMBIA1307- OsJAB1 The construction method is as follows: (1) Design specific primers F1 and R1, and use PCR amplification OsJAB1 Gene; (2) Using restriction endonucleases Spe I and Sal I. The PCR amplification product obtained from the double enzyme digestion step (1) is used to obtain the double enzyme digestion product; (3) Using restriction endonucleases Spe I and Sal The pCAMBIA1307 vector was double-digested with enzyme I to obtain the vector backbone. (4) The double enzyme digestion product obtained in step (2) and the vector backbone obtained in step (3) are ligated to obtain the recombinant plasmid pCAMBIA1307- OsJAB1 ; The nucleotide sequence of the specific primer F1 is shown in SEQ ID NO.3, and the nucleotide sequence of the specific primer R1 is shown in SEQ ID NO.4.

Images