Application of reagent for overexpressing IFITM1 gene in promotion of virus infection and recombinant LLC-PK1 cell line
By constructing a recombinant lentiviral plasmid overexpressing the IFITM1 gene and obtaining a recombinant LLC-PK1 cell line that stably expresses the IFITM1 protein, the shortcomings of PEDV infection research were addressed, the replication of the PEDV gene and the generation of progeny viruses were promoted, and a basis for a cell model of viral infection was provided.
Patent Information
- Application Number
- CN202511018495.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-23
- Publication Date
- 2025-10-24
AI Technical Summary
There are few studies on the effects of existing technologies on porcine epidemic diarrhea virus (PEDV) infection, and there is a lack of construction and application of cell lines that stably express IFITM1.
A recombinant lentiviral plasmid overexpressing the IFITM1 gene was constructed, and a recombinant LLC-PK1 cell line stably expressing the IFITM1 protein was obtained through transfection and screening. The recombinant cell line was used to promote PEDV gene replication and progeny virus generation.
A recombinant LLC-PK1 cell line stably expressing IFITM1 was successfully established, which significantly promoted PEDV gene replication and progeny virus generation, providing a tool for studying the pathogenic mechanism of the virus and laying the foundation for preparing a cell model of virus infection.
Smart Images

Figure CN120829935A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of a reagent for overexpressing IFITM1 gene in promoting viral infection and a recombinant LLC-PK1 cell line. BACKGROUND
[0002] Interferon (IFN)-mediated innate immune response is the first line of defense against viral infection in host cells. Interferon-induced transmembrane proteins (IFITMs), including IFITM1, IFITM2 and IFITM3, are located in the cytoplasmic membrane and endosomes, and are restriction factors for inhibiting the entry of many enveloped RNA viruses. In recent years, it has been found that IFITM can promote the infection of some RNA viruses. For example, human IFITM2 and IFITM3 can effectively enhance the infection of human coronavirus (HCoV-OC43) through the receptor binding / endocytosis mechanism. IFITM1 can also enhance the virus invasion mediated by Lloviu virus glycoprotein by inhibiting the SVKS motif mutation. Human cytomegalovirus utilizes IFITM1 to promote the formation of virus assembly complex (VAC). VAC is a perinuclear membrane structure, and the endosome-labeled vesicle occupies the central region, and the Golgi-labeled vesicle forms a circle around it. IFITMs may regulate endosome transport / fusion during the formation of VAC, and may also promote membrane fusion under certain conditions. IFITM1 can promote the transport of cholesterol from endosomes and endoplasmic reticulum to Golgi, thereby promoting the replication of RNA viruses. At present, there are few studies on the influence of IFITM1 on porcine epidemic diarrhea virus (PEDV) infection, and there is no report on the construction of a stable IFITM1-expressing cell line and its application.
[0003] Porcine epidemic diarrhea virus (PEDV) is a single-stranded positive RNA virus belonging to the Coronaviridae family of the Coronavirinae genus. Its genome contains 7 open reading frames (ORFs) responsible for encoding 4 structural proteins of envelope [E], membrane [M], spike [S] and nucleocapsid [N], 2 polyproteins (pp1a and pp1ab) and 1 accessory protein (ORF3). The S protein of PEDV is the major envelope type I glycoprotein of the virion, which interacts with cellular receptors during viral entry and induces the production of neutralizing antibodies. The M protein, which is essential for assembly, is the most abundant in the viral envelope and can induce virion formation. The E protein can facilitate the budding of virions. The N protein plays an important function in viral replication and pathogenesis mechanism. The N protein can interact with viral genomic RNA and bind to other protein molecules to protect the viral genome. The S, E and M proteins are inserted into the endoplasmic reticulum to assemble the envelope, and then anchored in the Golgi to assemble with the helical nucleocapsid structure in the endoplasmic reticulum-Golgi intermediate compartment (ERGIC) to form virions, and then release mature progeny virions through exocytosis. IFITM1 has been studied to some extent in promoting the function of cholesterol transport from endosomes and endoplasmic reticulum to Golgi, but the effect of IFITM1 on PEDV replication is not clear. SUMMARY
[0004] Therefore, the present application aims to provide an application of a reagent overexpressing IFITM1 gene in promoting viral infection.
[0005] Preferably, the nucleotide sequence of the IFITM1 gene is shown as SEQ ID NO: 1, and the amino acid sequence is shown as SEQ ID NO: 2.
[0006] Preferably, the reagent overexpressing IFITM1 gene includes a recombinant lentivirus plasmid overexpressing IFITM1 gene.
[0007] Preferably, the improvement of viral infectivity includes promoting the replication level of viral genes and progeny viruses.
[0008] The present application provides a recombinant cell line stably expressing IFITM1, which overexpresses IFITM1 protein.
[0009] The present application provides a construction method of the recombinant cell line stably expressing IFITM1, which includes the following steps:
[0010] 1) Constructing a recombinant lentivirus plasmid overexpressing IFITM1 gene;
[0011] 2) Co-transfecting the recombinant lentivirus plasmid overexpressing IFITM1 gene in step 1) and a helper plasmid to rescue a recombinant lentivirus overexpressing IFITM1;
[0012] 3) The rescued recombinant lentivirus is used to infect LLC-PK1 cells, and a stable recombinant cell line expressing IFITM1 is obtained through screening.
[0013] Preferably, in step 1), the IFITM1 gene is amplified by a primer containing a BamH I enzyme cutting site, the amplified fragment and the lentivirus vector pLOV-CMV are cut by BamH I, the cut fragments and the linearized vector are connected, and identified to obtain a recombinant lentivirus plasmid overexpressing the IFITM1 gene.
[0014] The primer containing the BamH I enzyme cutting site includes a forward primer (containing a FLAG tag sequence) with a nucleotide sequence as shown in SEQ ID NO: 3 (TTCAGGTGTCGTGAGGATCCGCCACCATGGATTACAAGGATGACGACGATAAGCTCAGGGAGGAGCACGA) and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 4 (AGCCGGCGCGGCCGCGGATCCCTAGTAGCCTCTGTTACTCTTTGCG). The amplification conditions are preferably 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, and 72℃ extension for 30 s. The method of cutting and connection in the present application is not particularly limited, and the cutting and connection method known in the art can be used.
[0015] The co-transfected cells preferably include components with a mass fraction of 4 parts of the recombinant lentivirus plasmid, 3 parts of the psPAX2 auxiliary plasmid, and 1 part of the pMD2.G auxiliary plasmid. The transfection reagent for co-transfecting the cells is preferably Lipofectamine 3000. The present application does not limit the type of cells, and the cells known in the art can be used. In the embodiments of the present application, HEK-293T cells are used as the infection cells.
[0016] The rescue of the IFITM1 overexpressing recombinant lentivirus is preferably screened by 3 μg / mL puromycin. Through RT-qPCR detection, the IFITM1 mRNA level in the screened cell line is significantly increased, indicating that the IFITM1 overexpressing recombinant cell line is successfully constructed.
[0017] Through Western Blot analysis, the IFITM1 protein expression levels of the recombinant LLC-PK1 cell line at the 5th and 20th generations of recombinant cell lines have no significant difference, indicating that the recombinant LLC-PK1 cell line can stably express the IFITM1 protein.
[0018] In the present application, the recombinant LLC-PK1 cell line stably expressing IFITM1 can promote PEDV gene replication and progeny virus production.
[0019] The application provides application of the recombinant LLC-PK1 cell line stably expressing IFITM1 or the recombinant LLC-PK1 cell line stably expressing IFITM1 obtained by the construction method in preparation of a virus-infected cell model.
[0020] Beneficial effects
[0021] The application provides application of a reagent overexpressing an IFITM1 gene in promoting virus infection. Experiments prove that an IFITM1 fragment is obtained by amplification through an RT-PCR technique, is cloned into a lentivirus vector to construct a recombinant lentivirus plasmid, and then is packaged into a lentivirus through virus rescue, and then is used to infect LLC-PK1 cells to obtain a recombinant LLC-PK1 cell line expressing IFITM1. PEDV is used as a virus model to determine gene replication of PEDV on the recombinant LLC-PK1 cells and a level of progeny virus, and finally to evaluate an influence of the recombinant cells on the replication ability of PEDV, and the results show that the recombinant LLC-PK1 cells stably expressing IFITM1 can promote gene replication of PEDV and generation of progeny virus. It can be seen that overexpression of the IFITM1 gene can promote infection of PEDV. This provides a tool for studying a virus pathogenic mechanism and provides a basis for subsequent preparation of a virus-infected cell model. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 It is an amplification result of the IFITM1 gene;
[0023] Figure 2 It is an expression result of the IFITM1 recombinant lentivirus plasmid in HEK-293T cells;
[0024] Figure 3 It is an expression analysis result of IFITM1 protein in the LLC-PK1-IFITM1 recombinant cell strain;
[0025] Figure 4 It is an IFITM1 mRNA level detection result in the LLC-PK1-IFITM1 recombinant cell strain;
[0026] Figure 5 It is an indirect immunofluorescence result of IFITM1 in the LLC-PK1-IFITM1 recombinant cell strain;
[0027] Figure 6 It is a level comparison result of expression of IFITM1 protein in the 5th and 20th generations of recombinant cell lines;
[0028] Figure 7 It is a result of detection of influence of the LLC-PK1-IFITM1 recombinant cells on PEDV protein expression at different time points through a Western Blot test.
[0029] Figure 8 Results of detection of PEDV mRNA levels in the recombinant LLC-PK1 cells stably expressing IFITM1 at different time points;
[0030] Figure 9 Results of detection of virus content on the recombinant LLC-PK1 cells stably expressing IFITM1 at different time points. DETAILED DESCRIPTION
[0031] The technical solutions of the present application will be described clearly and completely below in combination with the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.
[0032] Example 1: A method for constructing a recombinant lentiviral plasmid overexpressing IFITM1 gene
[0033] Primer design and synthesis
[0034] The primers were designed according to the sequence of IFITM1 gene on NCBI to amplify the IFITM1 gene in LLC-PK1 cells by RT-PCR. The upstream primer was 5'- TTCAGGTGTCGTGAGGATCCGCCACCATGGATTACAAGGATGACGACGATAAGCTCAGGGAGGAGCACGA-3' (SEQ ID NO: 3), and the downstream primer was 5'- AGCCGGCGCGGCCGCGGATCCCTAGTAGCCTCTGTTACTCTTTGCG-3' (SEQ ID NO: 4). The above primers were synthesized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.
[0035] The IFITM1 gene was amplified using the above designed and synthesized primers. The PCR reaction conditions were as follows: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; and 72℃ re-extension for 10 min. The results of agarose gel electrophoresis showed that the LLC-PK1 gene in LLC-PK1 cells was successfully amplified. The electrophoretogram is shown in Figure 1 , and the size of the amplified product band was about 375 bp. After 1% agarose gel electrophoresis, the PCR product was recovered by DNA agarose gel, and the recovered product was sent to Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. for sequencing.
[0036] Construction of recombinant lentiviral plasmid overexpressing IFITM1
[0037] The lentivirus vector pLOV-CMV was digested by BamH I, and a 8500 bp fragment was recovered. The recovered fragment and the IFITM1 amplified fragment were connected to construct a recombinant lentivirus plasmid, which was named pLOV-Flag-IFITM1. The pLOV-Flag-IFITM1 plasmid was preliminarily identified by enzyme digestion, and the positive plasmid was sent to Shanghai SunGene Biological Engineering Technology Service Co., Ltd. for sequencing. The positive recombinant plasmid was extracted in large quantities, and the helper plasmids pMD2.G and psPAX2 were identified correctly and stored for future use.
[0038] Example 2: Construction method of recombinant LLC-PK1 cell line
[0039] Rescue of IFITM1 overexpression recombinant lentivirus
[0040] Normal HEK-293T cells were plated in a T25 cell culture flask, and when the cells were in good condition and the density reached 70%, plasmid transfection was performed using Lipofectamine 3000 transfection reagent (2.0 μg recombinant lentivirus plasmid + 1.5 μg psPAX2 helper plasmid + 0.5 μg pMD2.G helper plasmid). After 6 h, 4 ml of high-glucose DMEM complete medium was gently added to the cell culture flask, and it was placed in a 37°C incubator for culture. After 72 h, the cell supernatant was collected and filtered with a 0.45 um filter. The filtered lentivirus liquid was stored at -80°C for future use.
[0041] Determination of the screening concentration of puromycin
[0042] LLC-PK1 cells were plated in a six-well plate, and when the cell density reached 90%, 1, 2, 3, 4, 5, and 6 μg / mL of puromycin were added to the cells, respectively, and the drug was added every 24 h. After 7 d, the survival of the cells in the six-well plate was observed, and the lowest drug concentration without cell survival was the optimal concentration for puromycin screening. LLC-PK1 cells were treated with gradient concentrations of puromycin, and it was observed that after one week of screening with the minimum concentration of 3 μg / mL of puromycin, the cells were all dead. The optimal puromycin concentration for screening the LLC-PK1 recombinant cell line was finally determined to be 3 μg / mL.
[0043] Construction of recombinant LLC-PK1 cell line stably expressing IFITM1
[0044] The lentivirus and complete cell culture medium were mixed at a ratio of 1:1 to prepare a mixed culture medium. Normal LLC-PK1 cells were plated in a six-well plate and cultured with the mixed culture medium. After 24 h, the cells infected with the lentivirus were treated with the optimal concentration of puromycin, and the complete culture medium with puromycin was replaced every 24 h. After 7 d, the surviving LLC-PK1 cells were almost all recombinant cells carrying the recombinant lentivirus plasmid. The recombinant LLC-PK1 cells overexpressing IFITM1 were counted and diluted to a single cell, which was added to a 96-well plate. After the cells grew into a group, a microscope was used to observe whether it was a single clone. After the cells grew, the single clone recombinant cells were expanded and frozen, and the expression level of IFITM1 in the single clone recombinant cells was detected by Western Blot and real-time fluorescent quantitative PCR (RT-qPCR). Figure 2 The Western Blot results showed that the recombinant cell strain LLC-PK1-IFITM1 successfully expressed IFITM1 protein compared with normal LLC-PK1 cells. Figure 3 The RT-qPCR results showed that the IFITM1 mRNA level in LLC-PK1-IFITM1 was significantly increased compared with normal LLC-PK1 cells. Figure 4 The indirect immunofluorescence results showed that LLC-PK1-IFITM1 cells all expressed IFITM1 protein, and the recombinant cell line LLC-PK1-IFITM1 had high purity. The above results showed that the recombinant LLC-PK1 cell line overexpressing IFITM1 was successfully established.
[0045] Example 3 Stability analysis of IFITM1 protein expression in recombinant LLC-PK1 cells stably expressing IFITM1
[0046] To analyze the stability of IFITM1 protein expression in the recombinant cell line, protein samples were collected from the 5th and 20th generations of cells to detect whether the expression of IFITM1 protein was stable. The stability of IFITM1 protein expression in the LLC-PK1-IFITM1 recombinant cells during the passage was analyzed by Western Blot. Figure 5 There was no significant difference in the expression level of IFITM1 protein between the 5th and 20th generations of recombinant cell lines, indicating that IFITM1 protein could be stably expressed in the recombinant cell line.
[0047] Example 4 Effect of recombinant LLC-PK1 cells stably expressing IFITM1 on PEDV gene replication and viral protein expression
[0048] The recombinant LLC-PK1 cells were inoculated with virus at MOI of 1 and placed in a 37°C incubator, and cell samples were collected at 14 and 16 h, respectively. (1) Part of the cell samples were added with RNA lysis solution, and RNA was extracted and the N mRNA level of PEDV was detected by RT-qPCR. The upstream primer for amplifying PEDV N gene used in RT-qPCR was 5'-GAGGGTGTTTTCTGGGTTG-3' (SEQ ID NO: 5), and the downstream primer was 5'-CGTGAAGTAGGAGGTGTGTTAG-3' (SEQ ID NO: 6); the primers for amplifying the internal reference gene ACTIN were: the upstream primer was 5'-TCCCTGGAGAAGAGCTACGA-3' (SEQ ID NO: 7), and the downstream primer was 5'-AGCACTGTGTTGGCGTACAG-3' (SEQ ID NO: 8). The reverse transcription program was 37°C for 15 min and 85°C for 5 s. The amplification reaction program of the RT-qPCR method was pre-denaturation at 95°C for 30 s; 95°C for 5 s, 60°C for 30 s for 40 cycles; 95°C for 15 s, 60°C for 1 min, 95°C for 15 s. The relative mRNA copy number of PEDV N was calculated by the 2-ΔΔCT method. (2) Part of the cell samples were added with RIPA lysis solution, and the effect of the recombinant LLC-PK1 cells stably expressing IFITM1 on the expression of PEDV viral proteins was verified by Western Blot.
[0049] The effect of the LLC-PK1-IFITM1 recombinant cells on the replication of PEDV genes was detected by RT-qPCR test. As shown in Figure 2, for different time point samples, compared with the normal LLC-PK1 cells, the PEDV mRNA level in the recombinant LLC-PK1 cells stably expressing IFITM1 was significantly increased. Figure 6 The effect of the LLC-PK1-IFITM1 recombinant cells on the expression of PEDV proteins was detected by Western Blot test. As shown in Figure 3, for different time point samples, compared with the normal LLC-PK1 cells, the PEDV protein level in the recombinant LLC-PK1 cells stably expressing IFITM1 was significantly increased. Figure 7 The effect of the LLC-PK1-IFITM1 recombinant cells on the expression of PEDV proteins was detected by Western Blot test. As shown in Figure 3, for different time point samples, compared with the normal LLC-PK1 cells, the PEDV protein level in the recombinant LLC-PK1 cells stably expressing IFITM1 was significantly increased.
[0050] Example 5 Effect of the recombinant LLC-PK1 cells stably expressing IFITM1 on the propagation of the offspring PEDV
[0051] MOI of 1 of PEDV to stably express IFITM1 recombinant LLC-PK1 cells and normal LLC-PK1 cells, placed in a 37°C incubator, 6, 12, 18, 24, 32 and 36 h after the sample was collected, semi-tissue cell infectious dose (TCID50) test to determine the PEDV virus content in the sample. PEDV infected recombinant LLC-PK1 cells and normal LLC-PK1 cells were collected at different times, and the progeny PEDV was quantified by TCID50 test. As Figure 8 In all time points, the virus content on the recombinant LLC-PK1 cells stably expressing IFITM1 was significantly higher than that on the normal LLC-PK1 cells. The number of PEDV plaques reached a peak after 25 h of viral infection, and the number of plaques in LLC-PK1-IFITM1 was 2.2 times that in the control cells. The above results showed that the recombinant LLC-PK1 cells stably expressing IFITM1 enhanced the propagation of the progeny PEDV.
[0052] From the above examples, it can be seen that the IFITM1 fragment is obtained by RT-PCR technology, cloned into pLOV-CMV vector to construct a recombinant lentivirus plasmid, and then transfected into HEK-293T cells with the helper plasmids pMD2.G and psPAX2 using lipofectamine transfection technology. The lentivirus packaged by the HEK-293T cells is harvested, and then the LLC-PK1 cells are infected. After 10 days of continuous selection with puromycin, a recombinant LLC-PK1 cell line expressing IFITM1 is obtained. The single clone of the recombinant LLC-PK1 cell line stably expressing IFITM1 is screened by limiting dilution method. The genetic stability of IFITM1 protein expression in the 5th and 20th generation of recombinant LLC-PK1 cells is also detected, and it is found that the positive single clone of the recombinant LLC-PK1 cell line can stably express IFITM1 protein, indicating that the IFITM1 gene has been stably integrated into the LLC-PK1 cells, and also indicating that the target cells obtained have good genetic stability. In general, a recombinant LLC-PK1 cell line stably expressing IFITM1 has been successfully established.
[0053] The established recombinant LLC-PK1 cell line stably expressing IFITM1 is used to measure the gene replication of PEDV and the level of progeny virus on the recombinant LLC-PK1 cells, and finally to evaluate the effect of the recombinant cells on the replication ability of PEDV. The results show that the recombinant LLC-PK1 cells stably expressing IFITM1 can promote the gene replication of PEDV and the generation of progeny virus. In general, the recombinant LLC-PK1 cells stably expressing IFITM1 improve the replication ability of PEDV.
[0054] The foregoing description of the embodiments has been presented for the purpose of illustration and description. It is not intended to be exhaustive or to limit the application to the precise form disclosed. Many modifications and variations are possible in light of the above teaching. It is intended that the scope of the application be limited not with this detailed description, but rather by the claims appended hereto.
Claims
1. Use of a reagent overexpressing IFITM1 gene in promoting viral infection.
2. Use according to claim 1, characterized in that, The nucleotide sequence of the IFITM1 gene is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO:
2.
3. Use according to claim 1, characterized in that, The reagent overexpressing IFITM1 gene comprises a recombinant vector overexpressing IFITM1 gene.
4. The use according to claim 1, characterized in that, The improvement of viral infectivity comprises promotion of viral gene replication and offspring virus replication level.
5. A recombinant LLC-PK1 cell line stably expressing IFITM1, characterized in that, The recombinant LLC-PK1 cell line overexpresses IFITM1 protein.
6. A method for constructing the recombinant LLC-PK1 cell line stably expressing IFITM1 according to claim 5, characterized in that: The method comprises the following steps: 1) Constructing a recombinant lentivirus plasmid overexpressing IFITM1 gene; 2) Co-transfecting the recombinant lentivirus plasmid overexpressing IFITM1 gene and helper plasmid in step 1) into cells to rescue the recombinant lentivirus overexpressing IFITM1; 3) Infecting LLC-PK1 cells with the rescued recombinant lentivirus to obtain a recombinant LLC-PK1 cell line stably expressing IFITM1 through screening.
7. The method of claim 6, wherein, In step 1), the construction method comprises amplifying IFITM1 gene with primers containing BamH I enzyme cutting site, cutting the obtained amplification fragment and lentivirus vector pLOV-CMV with BamH I enzyme, and connecting the enzyme cutting fragment and linearized vector to obtain the recombinant lentivirus plasmid overexpressing IFITM1 gene.
8. The method of claim 7, wherein, The primers containing BamH I enzyme cutting site comprise a forward primer (containing FLAG tag sequence) with nucleotide sequence shown in SEQ ID NO: 3 (TTCAGGTGTCGTGAGGATCCGCCACCATGGATTACAAGGATGACGACGATAAGCTCAGGGAGGAGCACGA) and a reverse primer with nucleotide sequence shown in SEQ ID NO: 4 (AGCCGGCGCGGCCGCGGATCCCTAGTAGCCTCTGTTACTCTTTGCG); Preferably, the co-transfecting cells in step 2) preferably comprises components in mass parts: 4 parts of recombinant lentivirus plasmid, 3 parts of psPAX2 helper plasmid, and 1 part of pMD2.G helper plasmid; The transfection reagent for co-transfecting cells is preferably Lipofectamine 3000.
9. The method of claim 8, wherein HEK-293T cells are used as infection cells; preferably, the rescue of the recombinant lentivirus overexpressing IFITM1 is preferably screened with 3 μg / mL puromycin.
10. Use of the recombinant LLC-PK1 cell line stably expressing IFITM1 of claim 5 or the recombinant LLC-PK1 cell line stably expressing IFITM1 obtained by the method of any one of claims 6-9 in preparing a viral infection cell model.
Citation Information
Patent Citations
Construction method and application of HepG2.215 cell line capable of stably knocking out ifitm1 gene
CN119101704A
Pathogen Restriction Factors
US20120331576A1