Molecular marker and detection kit for tumor immunotherapy prediction

Abstract

The invention relates to a molecular marker for tumor immunotherapy prediction and a detection kit, and belongs to the technical field of biological detection. The invention provides a molecular marker for tumor immunotherapy prediction. The molecular marker comprises 95 + 3 related gene targets capable of detecting and covering a tumor immune microenvironment (non-small cell lung cancer). Compared with the existing PD-L1 immunohistochemistry, the molecular marker disclosed by the invention has obvious advantages in the aspect of predicting the response result of immunotherapy. Experiments show that in pre-treatment clinical samples of 32 + 17 non-small cell lung cancer patients, the possibility of distinguishing response and non-response patients by using in-situ sequencing-tumor immune microenvironment characteristics based on the molecular marker is 77.3%, and in verification of postoperative samples of 14 + 17 non-small cell lung cancer patients, the possibility of distinguishing response and non-response patients by using in-situ sequencing-tumor immune microenvironment characteristics based on the molecular marker is 77.3%. The AUC value of a response patient and a non-response patient is distinguished by using in-situ sequencing-tumor immune microenvironment characteristics based on the molecular marker to reach 100%.

Description

TECHNICAL FIELD

[0001] The present application relates to a molecular marker and a detection kit for tumor immunotherapy prediction, and belongs to the technical field of biological detection. BACKGROUND

[0002] Lung cancer is a high-incidence cancer, among which non-small cell lung cancer accounts for about 80-85%. Non-small cell lung cancer is already in the middle and late stages when it is found, and the five-year survival rate is very low, and it is basically incurable. Tumor immunotherapy is a tumor treatment method that restores the body's normal anti-tumor immune response by restarting and maintaining the tumor-immune cycle, thereby controlling and eliminating tumors. At present, tumor immunotherapy has made great breakthroughs in the control of non-small cell lung cancer, significantly improving the survival rate of non-small cell lung cancer patients. However, only about 20-40% of non-small cell lung cancer patients in clinical practice are sensitive to tumor immunotherapy, and most non-small cell lung cancer patients still cannot benefit from tumor immunotherapy. Therefore, it is necessary to predict whether non-small cell lung cancer patients respond to tumor immunotherapy to determine the diagnosis and treatment plan for non-small cell lung cancer patients.

[0003] Predictors for predicting whether tumor immunotherapy responds include PD-L1, tumor mutation burden (TMB), and microsatellite instability (MSI). However, the accuracy of using these predictors to predict whether non-small cell lung cancer patients respond to tumor immunotherapy is not high. At present, no biomarker or method has been found that can accurately predict the effect of tumor immunotherapy on non-small cell lung cancer patients to stratify treatment of non-small cell lung cancer patients. Therefore, it is urgent to find a biomarker or method that can accurately predict whether non-small cell lung cancer patients respond to tumor immunotherapy. SUMMARY

[0004] To solve the above problems, the application provides a molecular marker for tumor immunotherapy prediction,The molecular markers include CD103 protein, ITGAE protein, TIGIT protein, FOXP3 protein, TBX21 protein, CD4 protein, CCL5 protein, CD69 protein, GZMB protein, CD3G protein, CD8A protein, CD8B protein, GZMA protein, FASLG protein, CD3E protein, BANK1 protein, MZB1 protein, CD19 protein, HLA-DRB1 protein, HLA-DRA protein, CD79A protein, MS4A1 protein, FAP protein, CA9 protein, DPT protein, LUM protein, COL1A1 protein, ACTA2 protein, MMP2 protein, PDGFRA protein, PDGFRB protein, POSTN protein, VEGFC protein, VEGFA protein, AXL protein, VEGFB protein, VWF protein, ESM1 protein, PECAM1 protein, CD86 protein, CX3CR1 protein, MMP12 protein, CD68 protein, IL10 protein, CD80 protein, CCL2 protein, CCL7 protein, CCL8 protein, MRC1 protein, FGL2 protein, LYZ protein, CEACAM8 protein, FCGR3B protein, STK11 protein, MYBL2 protein, ZNF423 protein, TJP3 protein, APC protein, KEAP1 protein, CD47 protein, CD274 protein, PDCD1LG2 protein, LAG3 protein, HAVCR2 protein, PDCD1 protein, CDH1 protein, CSMD1 protein, GLTPD2 protein, L1TD1 protein, TDO2 protein, LOXL2 protein, MKI67 protein, TWIST2 protein, PPIB protein, DAPB protein, UBC protein, CCNE1 protein, CCNB1 protein, MYBL2 protein, STK15 protein, BTLA protein, VSIR protein, CD160 protein, CD244 protein, IDO1 protein, TGFB1 protein, EPCAM protein, TP63 protein, PRF1 protein, CTLA4 protein, MMP11 protein, IFNG protein, IL6 protein, EOMES protein, CD11c protein (ITGAX protein), CD14 protein, PTPRC protein, SNAI2 protein, SNAI1 protein, ICOS protein, HLA-A protein, HLA-C protein, TTF1 protein, CD28 protein, CD40 protein, TWIST1 protein, NKG7 protein, NCR1 protein, ITK protein, IL1B protein, CD40LG protein, TNF protein, IFNB1 protein, CCL22 protein, CXCR1 protein, PGLYRP1 protein, CXCL8 protein, ARG1 protein, MSR1 protein, CDH5 protein, CLEC14A protein, MPO protein, CD94 protein (KLRD1 protein), and / or CD117 protein (KIT protein),

[0005] Alternatively, the molecular marker comprises a gene encoding a CD103 protein, an ITGAE protein, a TIGIT protein, a FOXP3 protein, a TBX21 protein, a CD4 protein, a CCL5 protein, a CD69 protein, a GZMB protein, a CD3G protein, a CD8A protein, a CD8B protein, a GZMA protein, a FASLG protein, a CD3E protein, a BANK1 protein, a MZB1 protein, a CD19 protein, a HLA-DRB1 protein, a HLA-DRA protein, a CD79A protein, a MS4A1 protein, a FAP protein, a CA9 protein, a DPT protein, a LUM protein, a COL1A1 protein, a ACTA2 protein, a MMP2 protein, a PDGFRA protein, a PDGFRB protein, a POSTN protein, a VEGFC protein, a VEGFA protein, a AXL protein, a VEGFB protein, a VWF protein, a ESM1 protein, a PECAM1 protein, a CD86 protein, a CX3CR1 protein, a MMP12 protein, a CD68 protein, a IL10 protein, a CD80 protein, a CCL2 protein, a CCL7 protein, a CCL8 protein, a MRC1 protein, a FGL2 protein, a LYZ protein, a CEACAM8 protein, a FCGR3B protein, a STK11 protein, a MYBL2 protein, a ZNF423 protein, a TJP3 protein, a APC protein, a KEAP1 protein, a CD47 protein, a CD274 protein, a PDCD1LG2 protein, a LAG3 protein, a HAVCR2 protein, a PDCD1 protein, a CDH1 protein, a CSMD1 protein, a GLTPD2 protein, a L1TD1 protein, a TDO2 protein, a LOXL2 protein, a MKI67 protein, a TWIST2 protein, a PPIB protein, a DAPB protein, a UBC protein, a CCNE1 protein, a CCNB1 protein, a MYBL2 protein, a STK15 protein, a BTLA protein, a VSIR protein, a CD160 protein, a CD244 protein, a IDO1 protein, a TGFB1 protein, a EPCAM protein, a TP63 protein, a PRF1 protein, a CTLA4 protein, a MMP11 protein, a IFNG protein, a IL6 protein, a EOMES protein, a CD11c protein (ITGAX protein), a CD14 protein, a PTPRC protein, a SNAI2 protein, a SNAI1 protein, a ICOS protein, a HLA-A protein, a HLA-C protein, a TTF1 protein, a CD28 protein, a CD40 protein, a TWIST1 protein, a NKG7 protein, a NCR1 protein, a ITK protein, a IL1B protein, a CD40LG protein, a TNF protein, a IFNB1 protein, a CCL22 protein, a CXCR1 protein, a PGLYRP1 protein, a CXCL8 protein, a ARG1 protein, a MSR1 protein, a CDH5 protein, a CLEC14A protein, a MPO protein, a CD94 protein (KLRD1 protein), and / or a CD117 protein (KIT protein).

[0006] In one embodiment of the application, the molecular markers comprise TIGIT protein, FOXP3 protein, TBX21 protein, CD4 protein, CCL5 protein, CD69 protein, GZMB protein, CD3G protein, CD8A protein, CD8B protein, GZMA protein, FASLG protein, CD3E protein, CD19 protein, HLA-DRB1 protein, HLA-DRA protein, CD79A protein, MS4A1 protein, LUM protein, COL1A1 protein, ACTA2 protein, MMP2 protein, PDGFRA protein, PDGFRB protein, POSTN protein, VEGFC protein, VEGFA protein, VWF protein, ESM1 protein, PECAM1 protein, CX3CR1 protein, MMP12 protein, CD68 protein, IL10 protein, CD80 protein, CCL2 protein, CCL7 protein, CCL8 protein, MRC1 protein, FGL2 protein, FCGR3B protein, STK11 protein, MYBL2 protein, CD274 protein, PDCD1LG2 protein, LAG3 protein, HAVCR2 protein, PDCD1 protein, LOXL2 protein, MKI67 protein, TWIST2 protein, PPIB protein, DAPB protein, UBC protein, CCNE1 protein, CCNB1 protein, MYBL2 protein, STK15 protein, BTLA protein, VSIR protein, CD160 protein, CD244 protein, IDO1 protein, TGFB1 protein, EPCAM protein, TP63 protein, PRF1 protein, CTLA4 protein, MMP11 protein, IFNG protein, IL6 protein, EOMES protein, CD11c protein (ITGAX protein), CD14 protein, PTPRC protein, SNAI2 protein, SNAI1 protein, ICOS protein, HLA-A protein, HLA-C protein, TTF1 protein, CD28 protein, CD40 protein, TWIST1 protein, NKG7 protein, NCR1 protein, ITK protein, IL1B protein, CD40LG protein, TNF protein, IFNB1 protein, CCL22 protein, CXCR1 protein, PGLYRP1 protein, CXCL8 protein, ARG1 protein, MSR1 protein, CDH5 protein, CLEC14A protein, MPO protein, CD94 protein (KLRD1 protein), and / or CD117 protein (KIT protein);

[0007] Alternatively, the molecular marker comprises a gene encoding a TIGIT protein, a FOXP3 protein, a TBX21 protein, a CD4 protein, a CCL5 protein, a CD69 protein, a GZMB protein, a CD3G protein, a CD8A protein, a CD8B protein, a GZMA protein, a FASLG protein, a CD3E protein, a CD19 protein, a HLA-DRB1 protein, a HLA-DRA protein, a CD79A protein, a MS4A1 protein, a LUM protein, a COL1A1 protein, a ACTA2 protein, a MMP2 protein, a PDGFRA protein, a PDGFRB protein, a POSTN protein, a VEGFC protein, a VEGFA protein, a VWF protein, a ESM1 protein, a PECAM1 protein, a CX3CR1 protein, a MMP12 protein, a CD68 protein, a IL10 protein, a CD80 protein, a CCL2 protein, a CCL7 protein, a CCL8 protein, a MRC1 protein, a FGL2 protein, a FCGR3B protein, a STK11 protein, a MYBL2 protein, a CD274 protein, a PDCD1LG2 protein, a LAG3 protein, a HAVCR2 protein, a PDCD1 protein, a LOXL2 protein, a MKI67 protein, a TWIST2 protein, a PPIB protein, a DAPB protein, a UBC protein, a CCNE1 protein, a CCNB1 protein, a MYBL2 protein, a STK15 protein, a BTLA protein, a VSIR protein, a CD160 protein, a CD244 protein, a IDO1 protein, a TGFB1 protein, a EPCAM protein, a TP63 protein, a PRF1 protein, a CTLA4 protein, a MMP11 protein, a IFNG protein, a IL6 protein, a EOMES protein, a CD11c protein (ITGAX protein), a CD14 protein, a PTPRC protein, a SNAI2 protein, a SNAI1 protein, a ICOS protein, a HLA-A protein, a HLA-C protein, a TTF1 protein, a CD28 protein, a CD40 protein, a TWIST1 protein, a NKG7 protein, a NCR1 protein, a ITK protein, a IL1B protein, a CD40LG protein, a TNF protein, a IFNB1 protein, a CCL22 protein, a CXCR1 protein, a PGLYRP1 protein, a CXCL8 protein, a ARG1 protein, a MSR1 protein, a CDH5 protein, a CLEC14A protein, a MPO protein, a CD94 protein (KLRD1 protein), and / or a CD117 protein (KIT protein).

[0008] The application also provides a detection kit for tumor immunotherapy prediction, which comprises double connection probe hybridization reagent, double connection probe connection reagent, double connection probe cyclization reagent, rolling circle amplification reagent and detection probe hybridization reagent; the double connection probe hybridization reagent comprises several double connection probe groups; the double connection probe group comprises at least one pair of double connection probe pairs targeting the above-mentioned molecular markers designed according to the target sequences on the above-mentioned molecular markers; the double connection probe pairs can recognize and hybridize with the target sequences corresponding thereto; each pair of double connection probe pairs comprises an upstream double connection probe and a downstream double connection probe; the upstream double connection probe contains an upstream tag sequence, the downstream double connection probe contains a downstream tag sequence, and the upstream tag sequence and the downstream tag sequence can form a complete tag sequence for interpreting the target sequence corresponding thereto; the double connection probe connection reagent is used for connecting the upstream tag sequence and the downstream tag sequence in the double connection probe pairs to form a connection product; the double connection probe cyclization reagent is used for cyclizing the connection product to form a cyclization product; the rolling circle amplification reagent is used for rolling circle amplification of the cyclization product to form a rolling circle amplification product; the detection probe hybridization reagent comprises a detection probe group; the detection probe in the detection probe group can hybridize with the rolling circle amplification product, and the detection probe in the detection probe group is coupled with a label.

[0009] In an embodiment of the application, the double connection probe group comprises at least two pairs of double connection probe pairs targeting the above-mentioned molecular markers designed according to the target sequences on the above-mentioned molecular markers; after the double connection probe group is input into cells or tissues, different double connection probe pairs in the double connection probe group targeting different molecular markers can recognize and respectively hybridize with the target sequences corresponding thereto.

[0010] In one embodiment of the present application, the double-connected probe set comprises 3 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding CD103 protein and ITGAE protein as shown in SEQ ID NO. 1 to SEQ ID NO. 6, 7 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding TIGIT protein as shown in SEQ ID NO. 7 to SEQ ID NO. 20, 8 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding FOXP3 protein as shown in SEQ ID NO. 21 to SEQ ID NO. 36, 8 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding TBX21 protein as shown in SEQ ID NO. 37 to SEQ ID NO. 52, 8 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding CD4 protein as shown in SEQ ID NO. 53 to SEQ ID NO. 68, 4 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding CCL5 protein as shown in SEQ ID NO. 69 to SEQ ID NO. 76, 5 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding CD69 protein as shown in SEQ ID NO. 77 to SEQ ID NO. 86, 3 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding GZMB protein as shown in SEQ ID NO. 87 to SEQ ID NO. 92, 6 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding CD3G protein as shown in SEQ ID NO. 93 to SEQ ID NO. 104, 3 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding CD8A protein as shown in SEQ ID NO. 105 to SEQ ID NO. 110, 3 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding CD8B protein as shown in SEQ ID NO. 111 to SEQ ID NO. 116, 3 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding GZMA protein as shown in SEQ ID NO. 117 to SEQ ID NO. 122, 3 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding FASLG protein as shown in SEQ ID NO. 123 to SEQ ID NO. 128, 8 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding CD3E protein as shown in SEQ ID NO. 129 to SEQ ID NO. 144, 3 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding BANK1 protein as shown in SEQ ID NO. 145 to SEQ ID NO. 150, 3 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding MZB1 protein as shown in SEQ ID NO. 151 to SEQ ID NO. 156, 3 pairs of double-connected probe pairs targeting nucleotide sequences of genes encoding CD19 protein as shown in SEQ ID NO. 157 to SEQ ID NO.172, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding HLA-DRB1 protein, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding HLA-DRA protein as shown in SEQ ID NO. 189 to SEQ ID NO. 204, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CD79A protein as shown in SEQ ID NO. 205 to SEQ ID NO. 210, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding MS4A1 protein as shown in SEQ ID NO. 211 to SEQ ID NO. 226, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding FAP protein as shown in SEQ ID NO. 227 to SEQ ID NO. 232, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CA9 protein as shown in SEQ ID NO. 233 to SEQ ID NO. 238, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding DPT protein as shown in SEQ ID NO. 239 to SEQ ID NO. 244, 5 pairs of double connection probes targeting the nucleotide sequence of the gene encoding LUM protein as shown in SEQ ID NO. 245 to SEQ ID NO. 254, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding COL1A1 protein as shown in SEQ ID NO. 255 to SEQ ID NO. 270, 2 pairs of double connection probes targeting the nucleotide sequence of the gene encoding ACTA2 protein as shown in SEQ ID NO. 271 to SEQ ID NO. 274, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding MMP2 protein as shown in SEQ ID NO. 275 to SEQ ID NO. 290, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding PDGFRA protein as shown in SEQ ID NO. 291 to SEQ ID NO. 306, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding PDGFRB protein as shown in SEQ ID NO. 307 to SEQ ID NO. 322, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding POSTN protein as shown in SEQ ID NO. 323 to SEQ ID NO. 338, 7 pairs of double connection probes targeting the nucleotide sequence of the gene encoding VEGFC protein as shown in SEQ ID NO. 339 to SEQ ID NO. 352, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding VEGFA protein as shown in SEQ ID NO. 353 to SEQ ID NO. 368, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding AXL protein as shown in SEQ ID NO.369~SEQ ID NO. 374, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding VWF protein as shown in SEQ ID NO. 391~SEQ ID NO. 406, 5 pairs of double connection probes targeting the nucleotide sequence of the gene encoding PECAM1 protein as shown in SEQ ID NO. 407~SEQ ID NO. 416, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CD86 protein as shown in SEQ ID NO. 417~SEQ ID NO. 432, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CX3CR1 protein as shown in SEQ ID NO. 433~SEQ ID NO. 438, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding MMP12 protein as shown in SEQ ID NO. 439~SEQ ID NO. 454, 6 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CD68 protein as shown in SEQ ID NO. 455~SEQ ID NO. 466, 6 pairs of double connection probes targeting the nucleotide sequence of the gene encoding IL10 protein as shown in SEQ ID NO. 467~SEQ ID NO. 478, 7 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CD80 protein as shown in SEQ ID NO. 479~SEQ ID NO. 492, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL2 protein as shown in SEQ ID NO. 493~SEQ ID NO. 498, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL7 protein as shown in SEQ ID NO. 499~SEQ ID NO. 504, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL8 protein as shown in SEQ ID NO. 505~SEQ ID NO. 510, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding MRC1 protein as shown in SEQ ID NO. 511~SEQ ID NO. 516, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding FGL2 protein as shown in SEQ ID NO. 517~SEQ ID NO. 532, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding LYZ protein as shown in SEQ ID NO. 533~SEQ ID NO. 548, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL2 protein as shown in SEQ ID NO. 549~SEQ ID NO.554 the nucleotide sequence of the gene encoding the CEACAM8 protein is shown in three pairs of dual connection probes as shown in SEQ ID NO. 555 to SEQ ID NO. 560, the nucleotide sequence of the gene encoding the FCGR3B protein is shown in eight pairs of dual connection probes as shown in SEQ ID NO. 561 to SEQ ID NO. 576, the nucleotide sequence of the gene encoding the STK11 protein is shown in three pairs of dual connection probes as shown in SEQ ID NO. 577 to SEQ ID NO. 582, the nucleotide sequence of the gene encoding the MYBL2 protein is shown in three pairs of dual connection probes as shown in SEQ ID NO. 583 to SEQ ID NO. 588, the nucleotide sequence of the gene encoding the ZNF423 protein is shown in three pairs of dual connection probes as shown in SEQ ID NO. 589 to SEQ ID NO. 594, the nucleotide sequence of the gene encoding the TJP3 protein is shown in three pairs of dual connection probes as shown in SEQ ID NO. 595 to SEQ ID NO. 600, the nucleotide sequence of the gene encoding the APC protein is shown in three pairs of dual connection probes as shown in SEQ ID NO. 601 to SEQ ID NO. 606, the nucleotide sequence of the gene encoding the KEAP1 protein is shown in three pairs of dual connection probes as shown in SEQ ID NO. 607 to SEQ ID NO. 612, the nucleotide sequence of the gene encoding the CD47 protein is shown in three pairs of dual connection probes as shown in SEQ ID NO. 613 to SEQ ID NO. 618, the nucleotide sequence of the gene encoding the CD274 protein is shown in eight pairs of dual connection probes as shown in SEQ ID NO. 619 to SEQ ID NO. 634, the nucleotide sequence of the gene encoding the PDCD1LG2 protein is shown in eight pairs of dual connection probes as shown in SEQ ID NO. 635 to SEQ ID NO. 650, the nucleotide sequence of the gene encoding the LAG3 protein is shown in eight pairs of dual connection probes as shown in SEQ ID NO. 651 to SEQ ID NO. 666, the nucleotide sequence of the gene encoding the HAVCR2 protein is shown in eight pairs of dual connection probes as shown in SEQ ID NO. 667 to SEQ ID NO. 682, the nucleotide sequence of the gene encoding the PDCD1 protein is shown in eight pairs of dual connection probes as shown in SEQ ID NO. 683 to SEQ ID NO. 698, the nucleotide sequence of the gene encoding the CDH1 protein is shown in three pairs of dual connection probes as shown in SEQ ID NO. 699 to SEQ ID NO. 704, the nucleotide sequence of the gene encoding the CSMD1 protein is shown in SEQ ID NO. 705 to SEQ ID NO.710 3 pairs of double connection probes, the nucleotide sequence of the gene encoding the GLTPD2 protein is shown as SEQ ID NO. 711-SEQ ID NO. 716 3 pairs of double connection probes, the nucleotide sequence of the gene encoding the L1TD1 protein is shown as SEQ ID NO. 717-SEQ ID NO. 722 3 pairs of double connection probes, the nucleotide sequence of the gene encoding the TDO2 protein is shown as SEQ ID NO. 723-SEQ ID NO. 728 8 pairs of double connection probes, the nucleotide sequence of the gene encoding the LOXL2 protein is shown as SEQ ID NO. 729-SEQ ID NO. 744 10 pairs of double connection probes, the nucleotide sequence of the gene encoding the MKI67 protein is shown as SEQ ID NO. 745-SEQ ID NO. 764 6 pairs of double connection probes, the nucleotide sequence of the gene encoding the TWIST2 protein is shown as SEQ ID NO. 765-SEQ ID NO. 776 5 pairs of double connection probes, the nucleotide sequence of the gene encoding the PPIB protein is shown as SEQ ID NO. 777-SEQ ID NO. 786 5 pairs of double connection probes, the nucleotide sequence of the gene encoding the DAPB protein is shown as SEQ ID NO. 787-SEQ ID NO. 796 5 pairs of double connection probes, the nucleotide sequence of the gene encoding the UBC protein is shown as SEQ ID NO. 797-SEQ ID NO. 806 6 pairs of double connection probes, the nucleotide sequence of the gene encoding the CCNE1 protein is shown as SEQ ID NO. 807-SEQ ID NO. 818 7 pairs of double connection probes, the nucleotide sequence of the gene encoding the CCNB1 protein is shown as SEQ ID NO. 819-SEQ ID NO. 832 8 pairs of double connection probes, the nucleotide sequence of the gene encoding the MYBL2 protein is shown as SEQ ID NO. 833-SEQ ID NO. 848 7 pairs of double connection probes, the nucleotide sequence of the gene encoding the STK15 protein is shown as SEQ ID NO. 849-SEQ ID NO. 862 8 pairs of double connection probes, the nucleotide sequence of the gene encoding the BTLA protein is shown as SEQ ID NO. 863-SEQ ID NO. 878 8 pairs of double connection probes, the nucleotide sequence of the gene encoding the VSIR protein is shown as SEQ ID NO. 879-SEQ ID NO. 894 6 pairs of double connection probes, the nucleotide sequence of the gene encoding the CD160 protein is shown as SEQ ID NO. 895-SEQ ID NO. 906 6 pairs of double connection probes, the nucleotide sequence of the gene encoding the CD244 protein is shown as SEQ ID NO.nucleotide sequences of the genes encoding the IDO1 protein are shown in 8 pairs of double connection probes shown in SEQ ID NO. 907~SEQ ID NO. 922, the nucleotide sequences of the genes encoding the TGFB1 protein are shown in 7 pairs of double connection probes shown in SEQ ID NO. 937~SEQ ID NO. 952, the nucleotide sequences of the genes encoding the EPCAM protein are shown in 7 pairs of double connection probes shown in SEQ ID NO. 953~SEQ ID NO. 966, the nucleotide sequences of the genes encoding the TP63 protein are shown in 8 pairs of double connection probes shown in SEQ ID NO. 967~SEQ ID NO. 982, the nucleotide sequences of the genes encoding the PRF1 protein are shown in 8 pairs of double connection probes shown in SEQ ID NO. 983~SEQ ID NO. 998, the nucleotide sequences of the genes encoding the CTLA4 protein are shown in 6 pairs of double connection probes shown in SEQ ID NO. 999~SEQ ID NO. 1010, the nucleotide sequences of the genes encoding the MMP11 protein are shown in 8 pairs of double connection probes shown in SEQ ID NO. 1011~SEQ ID NO. 1026, the nucleotide sequences of the genes encoding the IFNG protein are shown in 5 pairs of double connection probes shown in SEQ ID NO. 1027~SEQ ID NO. 1036, the nucleotide sequences of the genes encoding the IL6 protein are shown in 5 pairs of double connection probes shown in SEQ ID NO. 1037~SEQ ID NO. 1046, the nucleotide sequences of the genes encoding the EOMES protein are shown in 8 pairs of double connection probes shown in SEQ ID NO. 1047~SEQ ID NO. 1062, the nucleotide sequences of the genes encoding the CD11c protein (ITGAX protein) are shown in 7 pairs of double connection probes shown in SEQ ID NO. 1063~SEQ ID NO. 1076, the nucleotide sequences of the genes encoding the CD14 protein are shown in 7 pairs of double connection probes shown in SEQ ID NO. 1077~SEQ ID NO. 1090, the nucleotide sequences of the genes encoding the PTPRC protein are shown in 8 pairs of double connection probes shown in SEQ ID NO. 1091~SEQ ID NO. 1106, the nucleotide sequences of the genes encoding the SNAI2 protein are shown in 7 pairs of double connection probes shown in SEQ ID NO. 1107~SEQ ID NO. 1120, the nucleotide sequences of the genes encoding the SNAI1 protein are shown in 7 pairs of double connection probes shown in SEQ ID NO. 1121~SEQ ID NO. 1134, the nucleotide sequences of the genes encoding the ICOS protein are shown in 7 pairs of double connection probes shown in SEQ ID NO. 1135~SEQ ID NO.1150 the 8 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding HLA-A protein, the 3 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding HLA-C protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding TTF1 protein, the 7 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CD28 protein, the 7 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CD40 protein, the 6 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding TWIST1 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding NKG7 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding NCR1 protein, the 8 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding ITK protein, the 8 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding IL1B protein, the 8 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CD40LG protein, the 8 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding TNF protein, the 8 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding IFNB1 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCL22 protein, the 7 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CXCR1 protein, the 7 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding PGLYRP1 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR5 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR2 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR3 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR4 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR6 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR7 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR8 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR9 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR10 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR11 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR12 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR13 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR14 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR15 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR16 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR17 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR18 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR19 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR20 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR21 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR22 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR23 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR24 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR25 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR26 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR27 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR28 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR29 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR30 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR31 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR32 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR33 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR34 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR35 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR36 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR37 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR38 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR39 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR40 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR41 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR42 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR43 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR44 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR45 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR46 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR47 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR48 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR49 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR50 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR51 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR52 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR53 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR54 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR55 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR56 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR57 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR58 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR59 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR60 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR61 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR62 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR63 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR64 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR65 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR66 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR67 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR68 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR69 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR70 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR71 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR72 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR73 protein, the 5 pairs of double connected probe pairs targeting the nucleotide sequence of the gene encoding CCR74 protein, the1352, 6 pairs of double-connected probes targeting the nucleotide sequence of the gene encoding the ARG1 protein as shown in SEQ ID NO. 1365 to SEQ ID NO. 1376, 8 pairs of double-connected probes targeting the nucleotide sequence of the gene encoding the CDH5 protein as shown in SEQ ID NO. 1393 to SEQ ID NO. 1408, 8 pairs of double-connected probes targeting the nucleotide sequence of the gene encoding the CLEC14A protein as shown in SEQ ID NO. 1409 to SEQ ID NO. 1424, 6 pairs of double-connected probes targeting the nucleotide sequence of the gene encoding the MPO protein as shown in SEQ ID NO. 1425 to SEQ ID NO. 1436, 8 pairs of double-connected probes targeting the nucleotide sequence of the gene encoding the CD94 protein (KLRD1 protein) as shown in SEQ ID NO. 1437 to SEQ ID NO. 1452, 8 pairs of double-connected probes targeting the nucleotide sequence of the gene encoding the CD117 protein (KIT protein) as shown in SEQ ID NO. 1453 to SEQ ID NO. 1468, and / or 5 pairs of double-connected probes targeting the nucleotide sequence of the gene encoding the CD79A protein as shown in SEQ ID NO. 1469 to SEQ ID NO. 1478.

[0011] In an embodiment of the present application, the double-connected probe hybridization reagent further comprises polyethylene glycol-4000.

[0012] In an embodiment of the present application, the concentration of the polyethylene glycol-4000 in the double-connected probe hybridization reagent is 2-10% (w / v, g / mL).

[0013] In an embodiment of the present application, the concentration of the polyethylene glycol-4000 in the double-connected probe hybridization reagent is 5% (w / v, g / mL).

[0014] In an embodiment of the present application, the double-connected probe ligation reagent comprises a DNA ligase; the DNA ligase is capable of ligating the upstream tag sequence and the downstream tag sequence in the pair of double-connected probes to form a ligation product.

[0015] In an embodiment of the present application, the DNA ligase in the double-connected probe ligation reagent comprises a Splint R ligase.

[0016] In an embodiment of the present application, the double ligation probe circularization reagent comprises a DNA ligase and a rolling circle amplification primer; the DNA ligase can, under the action of the rolling circle amplification primer, ligate the gap formed by the two free ends of the ligation product approaching each other according to base complementarity, to form a circularization product.

[0017] In an embodiment of the present application, the DNA ligase in the double ligation probe circularization reagent comprises T4 DNA ligase.

[0018] In an embodiment of the present application, the nucleotide sequence of the rolling circle amplification primer is as shown in SEQ ID NO. 1479.

[0019] In an embodiment of the present application, the rolling circle amplification reagent comprises dNTPs and a DNA polymerase; the dNTPs can, under the action of the DNA polymerase, perform rolling circle amplification of the circularization product to form a rolling circle amplification product.

[0020] In an embodiment of the present application, the DNA polymerase in the rolling circle amplification reagent comprises Phi29 polymerase.

[0021] In an embodiment of the present application, the detection probe hybridization reagent further comprises an anchor primer set.

[0022] In an embodiment of the present application, the anchor primer set comprises an anchor primer with a nucleotide sequence as shown in SEQ ID NO. 1480 and / or an anchor primer with a nucleotide sequence as shown in SEQ ID NO. 1481.

[0023] In one embodiment of the present application, the detection probe set comprises a detection probe with a nucleotide sequence as shown in SEQ ID NO. 1482, a detection probe with a nucleotide sequence as shown in SEQ ID NO. 1483, a detection probe with a nucleotide sequence as shown in SEQ ID NO. 1484, a detection probe with a nucleotide sequence as shown in SEQ ID NO. 1485, a detection probe with a nucleotide sequence as shown in SEQ ID NO. 1486, a detection probe with a nucleotide sequence as shown in SEQ ID NO. 1487, a detection probe with a nucleotide sequence as shown in SEQ ID NO. 1488, a detection probe with a nucleotide sequence as shown in SEQ ID NO. 1489, a detection probe with a nucleotide sequence as shown in SEQ ID NO. 1490, a detection probe with a nucleotide sequence as shown in SEQ ID NO. 1491, a detection probe with a nucleotide sequence as shown in SEQ ID NO. 1492, a detection probe with a nucleotide sequence as shown in SEQ ID NO. 1493, a detection probe with a nucleotide sequence as shown in SEQ ID NO. 1494, a detection probe with a nucleotide sequence as shown in SEQ ID NO. 1495, a detection probe with a nucleotide sequence as shown in SEQ ID NO. 1496, and / or a detection probe with a nucleotide sequence as shown in SEQ ID NO. 1497.

[0024] In one embodiment of the present application, the detection probe hybridization reagent comprises a first detection probe hybridization reagent, a second detection probe hybridization reagent, a third detection probe hybridization reagent, and a fourth detection probe hybridization reagent; the first detection probe hybridization reagent, the second detection probe hybridization reagent, the third detection probe hybridization reagent, and the fourth detection probe hybridization reagent comprise a first detection probe set, a second detection probe set, a third detection probe set, and a fourth detection probe set, respectively; the first detection probe set comprises detection probes with nucleotide sequences as shown in SEQ ID NO. 1482-SEQ ID NO. 1485; the second detection probe set comprises detection probes with nucleotide sequences as shown in SEQ ID NO. 1486-SEQ ID NO. 1489; the third detection probe set comprises detection probes with nucleotide sequences as shown in SEQ ID NO. 1490-SEQ ID NO. 1493; and the fourth detection probe set comprises detection probes with nucleotide sequences as shown in SEQ ID NO. 1494-SEQ ID NO. 1497.

[0025] In one embodiment of the present application, the label comprises a fluorescent label.

[0026] In an embodiment of the present application, the fluorescent label comprises a fluorescent group; the fluorescent group comprises CY5, CY3, TXR and / or Alexa Fluor 750.

[0027] In an embodiment of the present application, the nucleic acid detection kit further comprises a mounting agent.

[0028] In an embodiment of the present application, the mounting agent is an anti-fluorescence quenching mounting agent.

[0029] In an embodiment of the present application, the tumor comprises non-small cell lung cancer.

[0030] The present application also provides a nucleic acid detection method, which is not for the purpose of diagnosis and treatment of diseases, and the detection method uses the above-mentioned detection kit to detect nucleic acid in a sample to be tested.

[0031] In an embodiment of the present application, the method comprises the following steps:

[0032] The permeation step: after adding the acid solution containing protease to the section of the sample to be tested to completely cover the tissue sample, permeation incubation is performed;

[0033] The double connection probe hybridization step: after adding the double connection probe hybridization reagent to the section to completely cover the tissue sample, incubation is performed to allow the double connection probes in the double connection probe set to sufficiently hybridize with the target sequence; after incubation, the section is washed;

[0034] The double connection probe connection step: after adding the double connection probe connection reagent to the section to completely cover the tissue sample, incubation is performed; after incubation, the section is washed;

[0035] The double connection probe circularization step: after adding the double connection probe circularization reagent to the section to completely cover the tissue sample, incubation is performed; after incubation, the section is washed;

[0036] The rolling circle amplification step: after adding the rolling circle amplification reagent to the section to completely cover the tissue sample, incubation is performed; after incubation, the section is washed; after adding the paraformaldehyde solution to the section to completely cover the tissue sample, incubation is performed to fix the tissue; after recovering the waste liquid on the section, the section is washed;

[0037] The detection probe hybridization step: after adding the first detection probe hybridization reagent to the section to completely cover the tissue sample, incubation is performed; after incubation, the section is washed;

[0038] The mounting step: after drying the section, the mounting agent is added to the section, and then a cover glass is placed on the section for mounting;

[0039] The detection step: the slice produces signal points through fluorescence microscope observation, and the localization and quantitative analysis of the molecular markers in the sample are carried out through bioinformatics method;

[0040] The detection probe elution step: the slice is removed; the slice is washed after the cover glass is removed; the detection probe group connected on the tissue sample is eluted; after the detection probe group elution is completed, the slice is washed; the polyformaldehyde solution is added on the slice to completely cover the tissue sample, and then incubation is carried out to fix the tissue; after the waste liquid on the slice is recovered, the slice is washed;

[0041] The next detection step: the detection probe hybridization step, the sealing step, the detection step and the probe elution step are repeated; when the detection probe hybridization step is repeated, the first detection probe hybridization reagent is replaced by the second detection probe hybridization reagent, the third detection probe hybridization reagent and the fourth detection probe hybridization reagent respectively; after the detection step is completed in the last repetition, the probe elution step is not required.

[0042] In an embodiment of the present application, in the permeabilization step, the temperature of the permeabilization incubation is 35-40℃, and the time is 20-40 min.

[0043] In an embodiment of the present application, the acidic solution comprises hydrochloric acid.

[0044] In an embodiment of the present application, the acidic solution is hydrochloric acid with a concentration of 0.05-0.5 mol / L.

[0045] In an embodiment of the present application, the acidic solution is hydrochloric acid with a concentration of 0.1 mol / L.

[0046] In an embodiment of the present application, the protease comprises pepsin.

[0047] In an embodiment of the present application, the concentration of the protease in the acidic solution is 0.1-0.5 mg / mL.

[0048] In an embodiment of the present application, the concentration of the protease in the acidic solution is 0.3 mg / mL.

[0049] In an embodiment of the present application, in the double connection probe hybridization step, the temperature of the incubation is 35-40℃, and the time is 230-250 min.

[0050] In an embodiment of the present application, in the double connection probe connection step, the temperature of the incubation is 35-40℃, and the time is 20-40 min.

[0051] In an embodiment of the present application, in the double connection probe cyclization step, the temperature of the incubation is 35-40℃, and the time is 20-40 min.

[0052] In one embodiment of the present application, in the rolling circle amplification step, the temperature of the incubation is 27-32℃ and the time is 15-17h.

[0053] In one embodiment of the present application, in the detection probe hybridization step, the temperature of the incubation is 35-40℃ and the time is 40-50min.

[0054] In one embodiment of the present application, in the detection probe elution step, the detection probe group connected on the tissue sample is eluted using an elution buffer.

[0055] In one embodiment of the present application, the elution buffer is DEPC water containing 0.05×SSC buffer, 10-30mM Tris-hydrochloric acid buffer, 0.01-1% (w / v, g / mL) SDS and 30-65% (w / v, g / mL) formamide.

[0056] In one embodiment of the present application, the elution buffer is DEPC water containing 0.05×SSC buffer, 20mM Tris-hydrochloric acid buffer, 0.05% (w / v, g / mL) SDS and 50% (w / v, g / mL) formamide.

[0057] The present application also provides the use of the above-mentioned molecular marker, the above-mentioned detection kit or the above-mentioned nucleic acid detection method in nucleic acid detection, and the use is not for the purpose of diagnosis and treatment of diseases.

[0058] The technical scheme of the present application has the following advantages:

[0059] 1. The present application provides a kind of molecular marker for tumor immunotherapy prediction, the molecular marker includes TIGIT, FOXP3, TBX21, CD4, CCL5, CD69, GZMB, CD3G, CD8A, CD8B, GZMA, FASLG, CD3E, CD19, HLA-DRB1, HLA-DRA, CD79A, MS4A1, LUM, COL1A1, ACTA2, MMP2, PDGFRA, PDGFRB, POSTN, VEGFC, VEGFA, VWF, ESM1, PECAM1, CX3CR1, MMP12, CD68, IL10, CD80, CCL2, CCL7, CCL8, MRC1, FGL2, FCGR3B, STK11, MYBL2, CD274, PDCD1LG2, LAG3, HAVCR2, PDCD1, LOXL2, MKI67, TWIST2, PPIB, DAPB, UBC, CCNE1, CCNB1, MYBL2, STK15, BTLA, VSIR, CD160, CD244, IDO1, TGFB1, EPCAM, TP63, PRF1, CTLA4, MMP11, IFNG, IL6, EOMES, CD11c (ITGAX), CD14, PTPRC, SNAI2, SNAI1, ICOS, HLA-A, HLA-C, TTF1, CD28, CD40, TWIST1, NKG7, NCR1, ITK, IL1B, CD40LG, TNF, IFNB1, CCL22, CXCR1, PGLYRP1, CXCL8, ARG1, MSR1, CDH5, CLEC14A, MPO, CD94 (KLRD1) And / or CD117 (KIT) Protein.Alternatively, the molecular marker comprises a gene encoding TIGIT, FOXP3, TBX21, CD4, CCL5, CD69, GZMB, CD3G, CD8A, CD8B, GZMA, FASLG, CD3E, CD19, HLA-DRB1, HLA-DRA, CD79A, MS4A1, LUM, COL1A1, ACTA2, MMP2, PDGFRA, PDGFRB, POSTN, VEGFC, VEGFA, VWF, ESM1, PECAM1, CX3CR1, MMP12, CD68, IL10, CD80, CCL2, CCL7, CCL8, MRC1, FGL2, FCGR3B, STK11, MYBL2, CD274, PDCD1LG2, LAG3, HAVCR2, PDCD1, LOXL2, MKI67, TWIST2, PPIB, DAPB, UBC, CCNE1, CCNB1, MYBL2, STK15, BTLA, VSIR, CD160, CD244, IDO1, TGFB1, EPCAM, TP63, PRF1, CTLA4, MMP11, IFNG, IL6, EOMES, CD11c (ITGAX), CD14, PTPRC, SNAI2, SNAI1, ICOS, HLA-A, HLA-C, TTF1, CD28, CD40, TWIST1, NKG7, NCR1, ITK, IL1B, CD40LG, TNF, IFNB1, CCL22, CXCR1, PGLYRP1, CXCL8, ARG1, MSR1, CDH5, CLEC14A, MPO, CD94 (KLRD1), and / or CD117 (KIT) protein. Studies have shown the importance of the tumor microenvironment (TME) in cancer biology, which collectively promotes tumor growth, invasion, metastasis, and response to therapy. The development of spatial transcriptomics provides a new tool for analyzing the tumor microenvironment. Spatial transcriptomic analysis can be used for immunotherapy prediction, measuring all gene expression in a tissue sample, and mapping the location where it occurs, thereby better understanding the relationship between gene expression and cell localization in tumor tissue;Among them, the in situ sequencing technology has the advantages of spatial single cell resolution, high gene detection sensitivity, full coverage of tissue panorama, and can be used for FFPE specimens. The present application uses the method of in situ sequencing to screen, verify and characterize a large number of genes, determine a tumor microenvironment Panel to realize the precise quantification and spatial localization analysis of cell types in tumor tissue, identify the specific location and activation state of immune cell infiltration, and various aspects of tumor microenvironment characteristics such as tertiary lymphoid structure, and finally based on the tumor microenvironment characteristics as the molecular marker of immunotherapy response. The molecular marker of the present application includes 95+3 gene targets related to tumor immune microenvironment (non-small cell lung cancer) that can be detected. Compared with the existing PD-L1 immunohistochemistry, the molecular marker of the present application has obvious advantages in predicting the response results of immunotherapy. Experiments show that in 32+17 cases of non-small cell lung cancer patient clinical samples before treatment, the possibility of using in situ sequencing-tumor immune microenvironment characteristics based on the molecular marker to distinguish between response and non-response patients is 77.3%, and in the verification of 14+17 cases of non-small cell lung cancer patient postoperative specimens, the AUC value of using in situ sequencing-tumor immune microenvironment characteristics based on the molecular marker to distinguish between response and non-response patients reaches 100%. Therefore, the molecular marker of the present application has great application prospect in cancer (non-small cell lung cancer) immunotherapy prediction.

[0060] 2. The application provides a detection kit for tumor immunotherapy prediction based on in situ sequencing-tumor immune microenvironment, which comprises double ligation probe hybridization reagent, double ligation probe ligation reagent, double ligation probe cyclization reagent, rolling circle amplification reagent and detection probe hybridization reagent; the double ligation probe hybridization reagent comprises several double ligation probe groups; the double ligation probe group comprises at least one pair of double ligation probes targeting the above-mentioned molecular markers according to the target sequence on the above-mentioned molecular markers; the double ligation probe pair can recognize and hybridize with the target sequence corresponding thereto; each pair of double ligation probes comprises an upstream double ligation probe and a downstream double ligation probe; the upstream double ligation probe contains an upstream tag sequence, and the downstream double ligation probe contains a downstream tag sequence, and the upstream tag sequence and the downstream tag sequence can form a complete tag sequence for interpreting the target sequence corresponding thereto; the double ligation probe ligation reagent is used for connecting the upstream tag sequence and the downstream tag sequence in the double ligation probe pair to form a ligation product; the double ligation probe cyclization reagent is used for cyclizing the ligation product to form a cyclization product; the rolling circle amplification reagent is used for rolling circle amplification of the cyclization product to form a rolling circle amplification product; the detection probe hybridization reagent comprises a detection probe group; the detection probe in the detection probe group can hybridize with the rolling circle amplification product, and the detection probe in the detection probe group is coupled with a label. The detection kit of the application can realize in situ detection of RNA in non-small cell lung cancer tissue by using in situ sequencing technology, and can detect 95+3 gene targets related to tumor immune microenvironment. Compared with the existing PD-L1 immunohistochemistry, the detection kit of the application has obvious advantages in predicting the response of immunotherapy. Experiments show that in 32+17 non-small cell lung cancer patient clinical samples before treatment, the possibility of using in situ sequencing-tumor immune microenvironment characteristics based on the detection kit to distinguish between responding and non-responding patients is 77.3%, and in the verification of 14+17 non-small cell lung cancer postoperative specimens, the AUC value of using in situ sequencing-tumor immune microenvironment characteristics based on the detection kit to distinguish between responding and non-responding patients reaches 100%. Therefore, the detection kit of the application has great application prospect in cancer (non-small cell lung cancer) immunotherapy prediction.

[0061] Further, the detection kit of the present application uses the double connection probe set to perform probe screening, first screening specific and highly expressed genes from a database, and then verifying the genes through cell subtype clustering and verifying the cell lines and tissues, and then improving the sensitivity of the probe (such as increasing the number of probes) to solve the problem of low detection rate in situ detection, and the selected 98-gene double connection probe is a specific probe, and when the nucleic acid detection kit of the present application is used for target nucleic acid detection, the detection rate of macrophage, endothelial cell and fibroblast related genes is improved with the increase of the number of double connection probes.

[0062] 3, The present application provides a nucleic acid detection method, which is not for the purpose of diagnosis and treatment of diseases, and the detection method uses the above-mentioned detection kit to detect nucleic acid in a sample to be tested, including a permeabilization step, a double connection probe hybridization step, a double connection probe connection step, a double connection probe circularization step, a rolling circle amplification step, a detection probe hybridization step, a sealing step, a detection step, a detection probe elution step, and a next detection step. The nucleic acid detection method of the present application can utilize in situ sequencing technology to achieve in situ detection of RNA in non-small cell lung cancer tissue, and can detect 95+3 gene targets covering the tumor immune microenvironment. Compared with the existing PD-L1 immunohistochemistry, the nucleic acid detection method of the present application has obvious advantages in predicting the response of immunotherapy. Experiments show that in 32+17 clinical samples of non-small cell lung cancer patients before treatment, the possibility of using in situ sequencing-tumor immune microenvironment characteristics based on the nucleic acid detection method to distinguish between responding and non-responding patients is 77.3%, and in the verification of 14+17 postoperative specimens of non-small cell lung cancer patients, the AUC value of using in situ sequencing-tumor immune microenvironment characteristics based on the nucleic acid detection method to distinguish between responding and non-responding patients reaches 100%. Therefore, the nucleic acid detection method of the present application has great application prospect in the prediction of cancer (non-small cell lung cancer) immunotherapy.

[0063] Further, when the nucleic acid detection method of the present application is permeabilized, 0.3 mg / mL of protease is selected for permeabilization, which can improve the gene detection rate.

[0064] Further, when the nucleic acid detection method of the present application is used for nucleic acid detection, 5% polyethylene glycol-4000 is added to the double connection probe hybridization reagent, which can improve the gene detection rate.

[0065] Further, when the nucleic acid detection method of the present application is used for nucleic acid detection, 4% paraformaldehyde (Beyotime) is added once in the rolling circle amplification step, which can improve the gene detection rate.

[0066] Further, the nucleic acid detection method of the present application uses 0.05xSSC buffer, 20mM Tris-hydrochloric acid buffer, 0.05%(w / v, g / mL) SDS and 50%(w / v, g / mL) formamide DEPC water as elution buffer for probe elution in the probe elution step when detecting nucleic acid, which can solve the problem of high background and improve the gene detection rate.

[0067] Further, the nucleic acid detection method of the present application uses 0.05xSSC buffer, 20mM Tris-hydrochloric acid buffer, 0.05%(w / v, g / mL) SDS and 50%(w / v, g / mL) formamide DEPC water as elution buffer for probe elution in the probe elution step when detecting nucleic acid, which can solve the problem of high background and improve the gene detection rate. BRIEF DESCRIPTION OF DRAWINGS

[0068] Figure 1 : Detection flow chart of the detection kit.

[0069] Figure 2 : Quantitative analysis of T lymphocyte related gene result graph.

[0070] Figure 3 : Quantitative analysis of B lymphocyte related gene result graph.

[0071] Figure 4 : Quantitative analysis of fibroblast related gene result graph.

[0072] Figure 5 : Quantitative analysis of endothelial cell related gene result graph.

[0073] Figure 6 : Quantitative analysis of macrophage related gene result graph.

[0074] Figure 7 : Quantitative analysis of neutrophil related gene result graph.

[0075] Figure 8 : Cell quantitative graph. Figure 8 In the figure, A: quantitative analysis of in situ sequencing and nTPM and in situ sequencing and single cell sequencing expression correlation result graph in A549 cells; B: quantitative analysis of in situ sequencing and nTPM expression correlation result graph in SKBR3 cells; C: quantitative analysis of in situ sequencing and nTPM expression correlation result graph in THP-1 cells.

[0076] Figure 9 : Quantitative comparison of T cell related gene multi-probe and few-probe pair comparison result graph.

[0077] Figure 10 : Quantitative comparison of B cell related gene multi-probe and few-probe pair comparison result graph.

[0078] Figure 11Quantitative comparison of macrophage related genes with multi-probe and few-probe count comparison results.

[0079] Figure 12 Quantitative comparison of endothelial cell related genes with multi-probe and few-probe count comparison results.

[0080] Figure 13 Quantitative comparison of fibroblast related genes with multi-probe and few-probe count comparison results.

[0081] Figure 14 Quantitative analysis of different experimental conditions in non-small cell lung cancer sections (post-treatment surgical specimens of non-responders to immunotherapy 21AS02448-006) results chart.

[0082] Figure 15 Comparison chart of different detection probe washing conditions for lung adenocarcinoma sections.

[0083] Figure 16 Nucleic acid detection kit realizes co-localization of tumor cell related genes and immune cell related genes in 98 genes in lung squamous carcinoma sections (pre-treatment surgical specimens of responders to immunotherapy 19AS01728-004) results.

[0084] Figure 17 Nucleic acid detection kit realizes co-localization of tumor cell related genes and immune cell related genes in 98 genes in lung squamous carcinoma sections (post-treatment surgical specimens of responders to immunotherapy 21AS05859-001) results.

[0085] Figure 18 Realize cell attribution of target signal on the basis of cell boundaries, and realize annotation of cell types in combination with specific marker genes.

[0086] Figure 19 Nucleic acid detection kit realizes clustering analysis results chart of CD8 T cells, B cells and CD4 T cells in lung squamous carcinoma sections (post-treatment surgical specimens of non-responders to immunotherapy 23AS04755-002) (compared with TLS).

[0087] Figure 20 Statistical chart of different cell abundances of patients before treatment who are responders and non-responders to immunotherapy.

[0088] Figure 21 Statistical chart of different cell abundances of patients after treatment who are responders and non-responders to immunotherapy.

[0089] Figure 22 Nucleic acid detection kit based on response prediction logistics model of cell type abundance to subdivide tumor microenvironment.

[0090] Figure 23 AUC (Area Under Curve) result graph (predictive potential of TME subtypes, 32+17 cases of non-small cell lung cancer pre-treatment clinical sample test).

[0091] Figure 24 AUC (Area Under Curve) result graph (predictive potential of TME subtypes, 14+17 cases of non-small cell lung cancer postoperative clinical sample test).

[0092] Figure 25 AUC (Area Under Curve) result graph (predictive potential of PDL-1 detection). DETAILED DESCRIPTION

[0093] The following examples are provided to better enable those skilled in the art to which the application pertains to further understand the application and are not intended to limit the scope of the application or the meaning of the claims herein. Any product that is the same as or similar to the present application that is derived from the disclosure herein or from the combination of the present application and other prior art features falls within the scope of the present application.

[0094] In the following examples, the specific experimental procedures or conditions are not specified, which can be performed according to the conventional experimental procedures described in the literature or the conditions. The reagents or instruments used are not specified by the manufacturer, which are conventional reagents that can be obtained commercially.

[0095] The primer and probe sequences involved in the following examples are shown in Tables 1-2.

[0096] Table 1 Primer sequence

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132] Table 2 Primer and probe sequences

[0133] Name Primer and probe sequences 5' label 3' label Reverse-DP-1 GGCTCCACTAAATAGACGCA (SEQ ID NO. 1479) / / Anchor-Primer-L TGCGTCTATTTAGTG (SEQ ID NO. 1480) P / Anchor-Oligo-R CTATTTAGTGGAGCC (SEQ ID NO. 1481) / / Seq-base1-A ACTCANNAG (SEQ ID NO. 1482) CY5 / Seq-base1-C ACTCANNCT (SEQ ID NO. 1483) TXR / Seq-base1-G ACTCANNGA (SEQ ID NO. 1484) CY3 / Seq-base1-T ACTCANNTC (SEQ ID NO. 1485) AF750 / Seq-base2-A AGNNACTCA (SEQ ID NO. 1486) P CY5 Seq-base2-C CTNNACTCA (SEQ ID NO. 1487) P TXR Seq-base2-G GANNACTCA (SEQ ID NO. 1488) P CY3 Seq-base2-T TCNNACTCA (SEQ ID NO. 1489) P AF750 Seq-base3-A ACTCAAGNN (SEQ ID NO. 1490) CY5 / Seq-base3-C ACTCACTNN (SEQ ID NO. 1491) TXR / Seq-base3-G ACTCAGANN (SEQ ID NO. 1492) CY3 / Seq-base3-T ACTCATCNN (SEQ ID NO. 1493) AF750 / Seq-base4-A NNAGACTCA (SEQ ID NO. 1494) P CY5 Seq-base4-C NNCTACTCA (SEQ ID NO. 1495) P TXR Seq-base4-G NNGAACTCA (SEQ ID NO. 1496) P CY3 Seq-base4-T NNTCACTCA (SEQ ID NO. 1497) P AF750

[0134] The probes in Tables 1-2 are synthesized by Shanghai Sangon, wherein TXR refers to Texas Red, AF750 refers to Alexa Fluor 750, and P refers to a phosphate group.

[0135] Example 1: A detection kit for tumor immunotherapy prediction based on in situ sequencing-tumor immune microenvironment

[0136] The present example provides a detection kit for tumor immunotherapy prediction based on in situ sequencing-tumor immune microenvironment (see the detection principle diagram Figure 1 ), which comprises double connection probe hybridization reagent, double connection probe connection reagent, double connection probe cyclization reagent, rolling circle amplification reagent, first detection probe hybridization reagent, second detection probe hybridization reagent, third detection probe hybridization reagent, and fourth detection probe hybridization reagent, and sealing reagent;

[0137] The double connection probe hybridization reagent (50 μL) was prepared by 15 μL 20xSSC buffer (Sigma), 5 μL formamide (Sigma) with a concentration of 100% (v / v), 22.5 μL DEPC water, 1.25 μL of each double connection probe group targeting T lymphocyte related genes (SEQ ID NO. 1-SEQ ID NO. 12, SEQ ID NO. 21-SEQ ID NO. 26, SEQ ID NO. 37-SEQ ID NO. 42, SEQ ID NO. 53-SEQ ID NO. 58, SEQ ID NO. 69-SEQ ID NO. 74, SEQ ID NO. 87-SEQ ID NO. 98 and SEQ ID NO. 105-SEQ ID NO. 110, 30 pairs of double connection probes), 1.25 μL of each double connection probe group targeting B lymphocyte related genes (SEQ ID NO. 145-SEQ ID NO. 162, SEQ ID NO. 189-SEQ ID NO. 174 and SEQ ID NO. 205-SEQ ID NO. 210, 15 pairs of double connection probes), 1.25 μL of each double connection probe group targeting fibroblast related genes (SEQ ID NO. 227-SEQ ID NO. 250, SEQ ID NO. 255-SEQ ID NO. 260, SEQ ID NO. 271-SEQ ID NO. 280 and SEQ ID NO. 291-SEQ ID NO. 296, 22 pairs of double connection probes), 1.25 μL of each double connection probe group targeting endothelial related genes (SEQ ID NO. 339-SEQ ID NO. 345, SEQ ID NO. 353-SEQ ID NO. 358, SEQ ID NO. 369-SEQ ID NO. 380, SEQ ID NO. 391-SEQ ID NO. 396 and SEQ ID NO. 407-SEQ ID NO. 412, 18 pairs of double connection probes), 1.25 μL of each double connection probe group targeting macrophage related genes (SEQ ID NO. 433-SEQ ID NO. 444, SEQ ID NO. 467-SEQ ID NO. 482 and SEQ ID NO. 493-SEQ ID NO. 498, 24 pairs of double connection probes) and 1.25 μL of each double connection probe group targeting neutrophil related genes (SEQ ID NO. 555-SEQ ID NO.566, 6 pairs of dual-ligation probes); the sequences of the dual-ligation probes in the dual-ligation probe set are shown in Table 1.

[0138] The dual-ligation probe ligation reagent (50 μL) consists of 5 μL of 10x Splint R ligase reaction buffer (NEB), 12.5 μL of glycerol at a concentration of 100% (v / v), 1 μL of SplintR ligase (NEB) at a concentration of 25 U / μL, 1.25 μL of RiboLock RNase Inhibitor (Thermo) at a concentration of 40 U / μL, 5 μL of BSA (NEB) at a concentration of 2 μg / μL, and 25.25 μL of DEPC water;

[0139] The dual-ligation probe circularization reagent (50 μL) consists of 5 μL of 10x T4 DNA ligase buffer (Thermo), 5 μL of ATP (Thermo) at a concentration of 10 mM, 5 μL of BSA (NEB) at a concentration of 2 μg / μL, 1 μL of T4 DNA ligase (Thermo) at a concentration of 5 U / μL, 2.5 μL of rolling circle amplification primer (SEQ ID NO. 1479) at a concentration of 10 μM, 1.25 μL of RiboLock RNase Inhibitor (Thermo) at a concentration of 40 U / μL, and 30.25 μL of DEPC water;

[0140] The rolling circle amplification reagent (50 μL) consists of 5 μL of 10x Phi29 DNA polymerase buffer (NEB), 2 μL of dNTPs (Thermo) at a concentration of 25 mM, 5 μL of BSA (NEB) at a concentration of 2 μg / μL, 2.5 μL of glycerol at a concentration of 100% (v / v), 5 μL of Phi29 polymerase (NEB) at a concentration of 10 U / μL, 1.25 μL of RiboLock RNase Inhibitor (Thermo) at a concentration of 40 U / μL, and 29.25 μL of DEPC water;

[0141] The first detection probe hybridization reagent (50 μL) consists of 5 μL of 10x T4 DNA ligase buffer (Thermo), 5 μL of ATP (Thermo) at a concentration of 10 mM, 5 μL of BSA (NEB) at a concentration of 2 μg / μL, 1 μL of T4 DNA ligase (Thermo) at a concentration of 5 U / μL, 5 μL of the first anchor primer (SEQ ID NO. 1480) at a concentration of 2 μM, 5 μL of the second anchor primer (SEQ ID NO. 1481) at a concentration of 2 μM, 2.5 μL of each detection probe in the detection probe set (SEQ ID NO. 1482-SEQ ID NO. 1485) at a concentration of 2 μM, and 19 μL of DEPC water.

[0142] The second detection probe hybridization reagent (50 μL) was composed of 5 μL of 10x T4 DNA ligase buffer (Thermo), 5 μL of ATP at a concentration of 10 mM (Thermo), 5 μL of BSA at a concentration of 2 μg / μL (NEB), 1 μL of T4 DNA ligase at a concentration of 5 U / μL (Thermo), 5 μL of the second anchor primer (SEQ ID NO. 1481) at a concentration of 2 μM, 2.5 μL of each detection probe group (SEQ ID NO. 1486-SEQ ID NO. 1489) at a concentration of 2 μM, and 19 μL of DEPC water;

[0143] The third detection probe hybridization reagent (50 μL) was composed of 5 μL of 10x T4 DNA ligase buffer (Thermo), 5 μL of ATP at a concentration of 10 mM (Thermo), 5 μL of BSA at a concentration of 2 μg / μL (NEB), 1 μL of T4 DNA ligase at a concentration of 5 U / μL (Thermo), 5 μL of the first anchor primer (SEQ ID NO. 1480) at a concentration of 2 μM, 2.5 μL of each detection probe group (SEQ ID NO. 1490-SEQ ID NO. 1493) at a concentration of 2 μM, and 19 μL of DEPC water;

[0144] The fourth detection probe hybridization reagent (50 μL) was composed of 5 μL of 10x T4 DNA ligase buffer (Thermo), 5 μL of ATP at a concentration of 10 mM (Thermo), 5 μL of BSA at a concentration of 2 μg / μL (NEB), 1 μL of T4 DNA ligase at a concentration of 5 U / μL (Thermo), 5 μL of the second anchor primer (SEQ ID NO. 1481) at a concentration of 2 μM, 2.5 μL of each detection probe group (SEQ ID NO. 1494-SEQ ID NO. 1497) at a concentration of 2 μM, and 19 μL of DEPC water; the sequences of the detection probes of the detection probe group and the fluorescent group modification are shown in Table 2;

[0145] The mounting agent was an anti-fluorescence quenching mounting agent; the anti-fluorescence quenching mounting agent was Gold Antifade Mountan mounting agent (Fermantas) containing 0.5 μg / mL of DAPI (Thermo). Gold Antifade Mountan mounting agent (Fermantas).

[0146] Experimental Example 1: Feasibility verification of detection kit on tissue sections

[0147] The present experimental example characterizes the specificity of T lymphocyte related gene probes for T cell lymphoma 22AS11664-005 (experimental specimen) and fibroepithelial polyp 22AS08413-001 (interstitial tissue, control specimen) (both from Fudan Zhongshan Hospital); characterizes the specificity of B lymphocyte related gene probes for diffuse large B cell lymphoma 22AS08301-002 (experimental specimen) and fibroepithelial polyp 22AS08413-001 (interstitial tissue, control specimen) (both from Fudan Zhongshan Hospital); characterizes the specificity of fibroblast related gene probes for fibrosarcoma 22AS09322-006 (experimental specimen) and T cell lymphoma 22AS11664-005 (control specimen) (both from Fudan Zhongshan Hospital); characterizes the specificity of endothelial related gene probes for angiosarcoma 22AS04235-002 (experimental specimen) and T cell lymphoma 22AS11664-005 (control specimen) (both from Fudan Zhongshan Hospital); characterizes the specificity of macrophage related gene probes for nasal dorsal rash 22AS08413-001 (experimental specimen) and fibroepithelial polyp 22AS10720 (interstitial tissue, control specimen) (both from Fudan Zhongshan Hospital); and characterizes the specificity of neutrophil related gene probes for acute gangrene appendicitis 23AS000001-001 (experimental specimen) and fibroepithelial polyp (interstitial tissue, control specimen) 22AS10720 (both from Fudan Zhongshan Hospital), using the in situ sequencing-based tumor immune microenvironment-based detection kit for tumor immunotherapy prediction of Example 1, which specifically includes the following steps:

[0148] Tissue section deparaffinization step:

[0149] The tissue section is baked in a 60°C oven for 30 min. After baking, the tissue section is allowed to cool to room temperature (25°C). After cooling, the tissue section is immersed in xylene I tank for 15 min, and then taken out and immersed in xylene II tank for 10 min. After immersion, the tissue section is taken out and immersed in 99.5% (v / v) ethanol, 95% (v / v) ethanol, and 70% (v / v) ethanol for 2 min, respectively. After immersion, the tissue section is taken out and immersed in DEPC water for 5 min, and then taken out and immersed in DEPC-PBS solution for 2 min.

[0150] Tissue fixation step:

[0151] After adding 4% (w / v, g / 100 mL) paraformaldehyde (Beyotime) to the tissue section to completely cover the tissue sample, the tissue section is incubated at 37°C for 10 min. After incubation, the tissue section is washed with DEPC-PBS solution for 2 min.

[0152] Tissue permeation step:

[0153] Preheat hydrochloric acid with a concentration of 0.1 M to 37 °C, and add pepsin (Solarbio) with a concentration of 0.3 mg / mL in the hydrochloric acid to obtain a tissue permeation solution; after adding the tissue permeation solution on the tissue section to completely cover the tissue sample, incubate at 37 °C for 30 min; after the incubation is completed, immerse the tissue section in DEPC water for 5 min, and then take out the tissue section and immerse it in DEPC-PBS solution for 2 min; after immersion, take out the tissue section and immerse it in 70% (v / v) ethanol, 85% (v / v) ethanol, and 90% (v / v) ethanol, respectively, for 1 min; after immersion, draw a histology circle on the tissue section around the outer edge of the tissue, and wash the tissue section with DEPC-PBST solution for 3 times, each for 30 s;

[0154] Double ligation probe hybridization step:

[0155] After adding the double ligation probe hybridization reagent on the tissue section to completely cover the tissue sample, incubate at 37 °C for 4 h to allow the double ligation probe to hybridize with the target nucleic acid; after the incubation is completed, wash with DEPC-PBST solution for 3 times, each for 30 s; after washing, add 2xSSC buffer containing 0.5% (w / v, g / 100 mL) formamide on the tissue section to completely cover the tissue sample, and incubate in a 37 °C oven for 3 times, each for 10 min, to remove excess unhybridized double ligation probe;

[0156] Double ligation probe ligation step:

[0157] After adding the double ligation probe ligation reagent on the tissue section to completely cover the tissue sample, incubate at 37 °C for 30 min; after the incubation is completed, wash the section with DEPC-PBST solution for 3 times, each for 30 s;

[0158] Double ligation probe circularization step:

[0159] After adding the double ligation probe circularization reagent on the tissue section to completely cover the tissue sample, incubate at 37 °C for 30 min; after the incubation is completed, wash the section with DEPC-PBST solution for 3 times, each for 30 s;

[0160] Rolling circle amplification step:

[0161] After the rolling circle amplification reagent is added dropwise on the tissue section to completely cover the tissue sample, it is incubated at 30°C for 16h; after the incubation is completed, the section is washed with DEPC-PBST solution for 3 times, 30s each time; after washing, 4%(w / v, g / 100mL) paraformaldehyde (Beyotime) is added dropwise on the tissue section to completely cover the tissue sample, and the tissue is fixed by incubation at 37°C for 10min; after fixation, the waste liquid on the tissue section is recovered, and the tissue section is washed with DEPC-PBS solution for 3 times, 30s each time;

[0162] Detection probe hybridization step:

[0163] After the first detection probe hybridization reagent is added dropwise on the tissue section to completely cover the tissue sample, it is incubated at 30°C for 45min; after the incubation is completed, the section is washed with DEPC-PBST solution for 3 times, 30s each time;

[0164] Mounting step:

[0165] After the tissue section is air-dried, 20μL mounting agent is added dropwise on the tissue section, and a clean cover glass is placed on it for mounting;

[0166] Detection step: The signal points generated by the tissue section under fluorescence microscope observation are photographed and imaged;

[0167] Detection probe elution step:

[0168] After the tissue section after photographing and imaging is soaked in DEPC-PBS solution until the cover glass falls off; after the cover glass is removed, DEPC water containing 0.1%(w / v, g / 100mL) TritonX and 80%(w / v, g / 100mL) formamide (elution buffer) is added dropwise on the tissue section to completely cover the tissue sample, and it is incubated at 37°C for 3 times, 10min each time; after incubation, the section is washed with DEPC-PBST solution for 3 times, 30s each time;

[0169] Next detection step: The detection probe hybridization step, mounting step, detection step and probe elution step are repeated; when the detection probe hybridization step is repeated, the first detection probe hybridization reagent is replaced by the second detection probe hybridization reagent, the third detection probe hybridization reagent and the fourth detection probe hybridization reagent respectively; after the last repetition, the detection step is completed without the need for the probe elution step.

[0170] After the detection is completed, the signal points detected are quantitatively analyzed by bioinformatics clustering analysis, and the results are shown in Figures 2-7 It can be seen from Figure 2 that, compared with the control sample, the T lymphocyte related genes are specifically expressed in T cell lymphoma; from Figure 3It can be seen that, relative to the control sample, the B lymphocyte related genes are specifically expressed in B cell lymphoma; by Figure 4 It can be seen that, relative to the control sample, the fibroblast related genes are specifically expressed in fibrosarcoma; by Figure 5 It can be seen that, relative to the control sample, the endothelial related genes are specifically expressed in angiosarcoma; by Figure 6 It can be seen that, relative to the control sample, the macrophage related genes are specifically expressed in angiosarcoma; by Figure 7 It can be seen that, relative to the control sample, the macrophage related genes are specifically expressed in acute gangrenous appendicitis. This result shows that the dual ligation probe used in Example 1 is specific.

[0171] Example 2: A detection kit for tumor immunotherapy prediction based on in situ sequencing-tumor immune microenvironment

[0172] The present embodiment provides a detection kit for tumor immunotherapy prediction based on in situ sequencing-tumor immune microenvironment (see detection principle diagram Figure 1 ), The detection kit comprises a dual ligation probe hybridization reagent, a dual ligation probe ligation reagent, a dual ligation probe cyclization reagent, a rolling circle amplification reagent, a first detection probe hybridization reagent, a second detection probe hybridization reagent, a third detection probe hybridization reagent, and a fourth detection probe hybridization reagent, and a mounting reagent;

[0173] The double connection probe hybridization reagent (50 μL) is composed of 15 μL 20x SSC buffer (Sigma), 5 μL formamide (Sigma) with a concentration of 100% (v / v), 22.5 μL DEPC water, and 1.25x 6 μL of each double connection probe set (SEQ ID NO. 69-SEQ ID NO. 74, SEQ ID NO. 77-SEQ ID NO. 82, SEQ ID NO. 87-SEQ ID NO. 98, SEQ ID NO. 105-SEQ ID NO. 134, SEQ ID NO. 173-SEQ ID NO. 178, SEQ ID NO. 189-SEQ ID NO. 134, SEQ ID NO. 173-SEQ ID NO. 178, SEQ ID NO. 189-SEQ ID NO. 194, SEQ ID NO. 205-SEQ ID NO. 216, SEQ ID NO. 255-SEQ ID NO. 260, SEQ ID NO. 271-SEQ ID NO. 280, SEQ ID NO. 291-SEQ ID NO. 296, SEQ ID NO. 307-SEQ ID NO. 312, SEQ ID NO. 323-SEQ ID NO. 328, SEQ ID NO. 369-SEQ ID NO. 380, SEQ ID NO. 391-SEQ ID NO. 396, SEQ ID NO. 407-SEQ ID NO. 412, SEQ ID NO. 417-SEQ ID NO. 422, SEQ ID NO. 493-SEQ ID NO. 522, SEQ ID NO. 533-SEQ ID NO. 538, SEQ ID NO. 549-SEQ ID NO. 566, SEQ ID NO. 577-SEQ ID NO. 624, SEQ ID NO. 635-SEQ ID NO. 640, SEQ ID NO. 651-SEQ ID NO. 656, SEQ ID NO. 667-SEQ ID NO. 672, and SEQ ID NO. 683-SEQ ID NO. 688) with a concentration of 0.05 μM each; the sequences of the double connection probes in the double connection probe set are shown in Table 1.

[0174] The double connection probe ligation reagent (50 μL) consists of 5 μL of 10x Splint R ligase reaction buffer (NEB), 12.5 μL of glycerol at a concentration of 100% (v / v), 1 μL of SplintR ligase (NEB) at a concentration of 25 U / μL, 1.25 μL of RiboLock RNase Inhibitor (Thermo) at a concentration of 40 U / μL, 5 μL of BSA (NEB) at a concentration of 2 μg / μL, and 25.25 μL of DEPC water;

[0175] The double connection probe ligation reagent (50 μL) consists of 5 μL of 10x Splint R ligase reaction buffer (NEB), 12.5 μL of glycerol at a concentration of 100% (v / v), 1 μL of SplintR ligase (NEB) at a concentration of 25 U / μL, 1.25 μL of RiboLock RNase Inhibitor (Thermo) at a concentration of 40 U / μL, 5 μL of BSA (NEB) at a concentration of 2 μg / μL, and 25.25 μL of DEPC water;

[0176] The double connection probe ligation reagent (50 μL) consists of 5 μL of 10x Splint R ligase reaction buffer (NEB), 12.5 μL of glycerol at a concentration of 100% (v / v), 1 μL of SplintR ligase (NEB) at a concentration of 25 U / μL, 1.25 μL of RiboLock RNase Inhibitor (Thermo) at a concentration of 40 U / μL, 5 μL of BSA (NEB) at a concentration of 2 μg / μL, and 25.25 μL of DEPC water;

[0177] The double connection probe ligation reagent (50 μL) consists of 5 μL of 10x Splint R ligase reaction buffer (NEB), 12.5 μL of glycerol at a concentration of 100% (v / v), 1 μL of SplintR ligase (NEB) at a concentration of 25 U / μL, 1.25 μL of RiboLock RNase Inhibitor (Thermo) at a concentration of 40 U / μL, 5 μL of BSA (NEB) at a concentration of 2 μg / μL, and 25.25 μL of DEPC water;

[0178] The second detection probe hybridization reagent (50 μL) is composed of 5 μL of 10×T4 DNA ligase buffer (Thermo), 5 μL of ATP at a concentration of 10 mM (Thermo), 5 μL of BSA at a concentration of 2 μg / μL (NEB), 1 μL of T4 DNA ligase at a concentration of 5 U / μL (Thermo), 5 μL of the second anchor primer (SEQ ID NO. 1481) at a concentration of 2 μM, 2.5 μL of each detection probe group (SEQ ID NO. 1486-SEQ ID NO. 1489) at a concentration of 2 μM, and 19 μL of DEPC water;

[0179] The third detection probe hybridization reagent (50 μL) is composed of 5 μL of 10×T4 DNA ligase buffer (Thermo), 5 μL of ATP at a concentration of 10 mM (Thermo), 5 μL of BSA at a concentration of 2 μg / μL (NEB), 1 μL of T4 DNA ligase at a concentration of 5 U / μL (Thermo), 5 μL of the first anchor primer (SEQ ID NO. 1480) at a concentration of 2 μM, 2.5 μL of each detection probe group (SEQ ID NO. 1490-SEQ ID NO. 1493) at a concentration of 2 μM, and 19 μL of DEPC water;

[0180] The fourth detection probe hybridization reagent (50 μL) is composed of 5 μL of 10×T4 DNA ligase buffer (Thermo), 5 μL of ATP at a concentration of 10 mM (Thermo), 5 μL of BSA at a concentration of 2 μg / μL (NEB), 1 μL of T4 DNA ligase at a concentration of 5 U / μL (Thermo), 5 μL of the second anchor primer (SEQ ID NO. 1481) at a concentration of 2 μM, 2.5 μL of each detection probe group (SEQ ID NO. 1494-SEQ ID NO. 1497) at a concentration of 2 μM, and 19 μL of DEPC water; the sequences of the detection probes of the detection probe group and the fluorescent group modification are shown in Table 2;

[0181] The mounting agent is an anti-fluorescence quenching mounting agent; the anti-fluorescence quenching mounting agent is Gold Antifade Mountan mounting agent (Fermantas) containing 0.5 μg / mL of DAPI (Thermo). Gold Antifade Mountan mounting agent (Fermantas).

[0182] Experimental Example 2: Feasibility verification of detection kit on paraffin-embedded cell lines

[0183] In this experimental example, A549 cells, THP-1 cells, and SK-BR-3 cells (all from the National Laboratory Cell Resource Sharing Platform) were characterized. The characterization process used the in situ sequencing-tumor immune microenvironment-based detection kit for tumor immunotherapy prediction in Example 2, specifically including the following steps:

[0184] Cell embedding steps:

[0185] A549 cells, THP-1 cells and SK-BR-3 cells were cultured in cell culture dishes at a density of 2×10 6A549 cells and SK-BR-3 cells) and RPMI 1640 medium (Guangdong Huayue Hongda Biotechnology Co., Ltd., for THP-1 cells) at 37 °C, 5% (v / v) CO2 for 24 h to obtain a cell culture solution; 1 mL of trypsin (Biyun Tian) was added to the cell culture solution, and incubated at 37 °C for 2 min for digestion to obtain a cell suspension; the cell suspension was centrifuged at 600 g for 5 min, and the supernatant was discarded. 1 mL of 1x PBS buffer (Guangdong Huayue Hongda Biotechnology Co., Ltd.) was added to the precipitate and blown thoroughly to obtain a resuspension A; the resuspension A was centrifuged at 600 g for 5 min, and the supernatant was discarded. 1 mL of 1x PBS buffer was added to the precipitate and blown thoroughly to obtain a resuspension B; the resuspension B was centrifuged at 600 g for 5 min, and the supernatant was discarded. 1 mL of 4% formaldehyde (Shengwo) was added to the precipitate and mixed thoroughly to obtain a cell suspension; the cell suspension was allowed to stand for 24 h for fixation, and then centrifuged at 1000 g for 10 min. The supernatant was discarded, and 3 drops of reagent A (Aobiping) were vertically dropped into the centrifuge tube with the precipitate, and mixed thoroughly to obtain a mixture; the mixture was centrifuged at 600 g for 5 min, and the excess A liquid was discarded. 6 drops of reagent B (Aobiping) were dropped into the centrifuge tube with the precipitate along the tube wall, avoiding the residual reagent A on the wall. The cell mass was separated from the tube wall after standing for 1 min; the cell mass was transferred from the centrifuge tube to an embedding box, and was sequentially immersed in 50% (v / v) ethanol, 75% (v / v) ethanol, 75% (v / v) ethanol for 30 min, and then in 100% (v / v) ethanol, 100% (v / v) ethanol for 40 min, and finally in xylene for 30 min; after the immersion, the embedding box with a label was placed on an embedding mold, and was placed in paraffin for 1 h to form a wax block, and then the wax was added again to fill the mold; after the wax was added, the embedding mold was transferred to a cooling table, and the solidified embedding wax block (referred to as a wax block) was taken out from the embedding mold after the melted wax surface solidified. The excess paraffin around the wax block was removed with a blade or a wax trimming instrument; the trimmed wax block was placed on a paraffin sectioning machine to section, with a thickness of 5 μm; the section was floated on a 40 °C water surface of a section flattener to flatten it, and then a glass slide (Shetai) was used to take up the section and was placed in a 60 °C oven for baking; after the water baking and wax baking were completed, the paraffin-embedded cell section was taken out and stored at -80 °C for later use.

[0186] Cell section deparaffinization step:

[0187] The paraffin-embedded cell section is baked in a 60℃ oven for 30 min; after baking, the paraffin-embedded cell section is cooled to room temperature (25℃); after cooling, the paraffin-embedded cell section is placed in the xylene I cylinder for 15 min, then the paraffin-embedded cell section is taken out and placed in the xylene II cylinder for 10 min; after soaking, the paraffin-embedded cell section is taken out and sequentially soaked in 99.5% (v / v) ethanol, 95% (v / v) ethanol, and 70% (v / v) ethanol for 2 min; after soaking, the paraffin-embedded cell section is taken out and soaked in DEPC water for 5 min, then the paraffin-embedded cell section is taken out and soaked in DEPC-PBS solution for 2 min;

[0188] Cell fixation step:

[0189] After adding 4% (w / v, g / 100 mL) paraformaldehyde (Beyotime) to completely cover the cell sample on the paraffin-embedded cell section, incubate at 37℃ for 10 min; after incubation, wash the paraffin-embedded cell section with DEPC-PBS solution for 2 min;

[0190] Cell permeabilization step:

[0191] Preheat hydrochloric acid with a concentration of 0.1 M to 37℃, and add 0.1 mg / mL pepsin (Solarbio) to the hydrochloric acid to obtain a cell permeabilization solution; after adding the cell permeabilization solution to completely cover the cell sample on the paraffin-embedded cell section, incubate at 37℃ for 30 min; after incubation, place the paraffin-embedded cell section in DEPC water for 5 min, then take out the paraffin-embedded cell section and soak it in DEPC-PBS solution for 2 min; after soaking, take out the paraffin-embedded cell section and sequentially soak it in 70% (v / v) ethanol, 85% (v / v) ethanol, and 90% (v / v) ethanol for 1 min; after soaking, draw a histology circle on the paraffin-embedded cell section according to the shape of the cell mass, and wash the paraffin-embedded cell section with DEPC-PBST solution 3 times, 30 s each time;

[0192] Dual-ligation probe hybridization step:

[0193] After adding the dual-ligation probe hybridization reagent to completely cover the cell sample on the paraffin-embedded cell section, incubate at 37℃ for 4 h to allow the dual-ligation probe to hybridize with the target nucleic acid; after incubation, wash with DEPC-PBST solution 3 times, 30 s each time; after washing, add 2×SSC buffer containing 0.5% (w / v, g / 100 mL) formamide to completely cover the cell sample on the paraffin-embedded cell section, and incubate in a 37℃ oven 3 times, 10 min each time, to remove excess unhybridized dual-ligation probe;

[0194] Dual-ligation probe ligation step:

[0195] After the double connection probe connection reagent was added dropwise on the paraffin-embedded cell section to completely cover the cell sample, it was incubated at 37°C for 30 min; after incubation, the section was washed with DEPC-PBST solution for 3 times, 30 s each time;

[0196] Double connection probe circularization step:

[0197] After the double connection probe circularization reagent was added dropwise on the paraffin-embedded cell section to completely cover the cell sample, it was incubated at 37°C for 30 min; after incubation, the section was washed with DEPC-PBST solution for 3 times, 30 s each time;

[0198] Rolling circle amplification step:

[0199] After the rolling circle amplification reagent was added dropwise on the paraffin-embedded cell section to completely cover the cell sample, it was incubated at 30°C for 16 h; after incubation, the section was washed with DEPC-PBST solution for 3 times, 30 s each time; after washing, 4% (w / v, g / 100 mL) paraformaldehyde (Beyotime) was added dropwise on the paraffin-embedded cell section to completely cover the cell sample, and the tissue was fixed at 37°C for 10 min; after fixation, the waste liquid on the paraffin-embedded cell section was recovered, and the paraffin-embedded cell section was washed with DEPC-PBS solution for 3 times, 30 s each time;

[0200] Detection probe hybridization step:

[0201] After the first detection probe hybridization reagent was added dropwise on the paraffin-embedded cell section to completely cover the cell sample, it was incubated at 30°C for 45 min; after incubation, the section was washed with DEPC-PBST solution for 3 times, 30 s each time;

[0202] Mounting step:

[0203] The paraffin-embedded cell section was air-dried; after drying, 20 μL mounting agent was added dropwise on the paraffin-embedded cell section, and a clean cover glass was covered for mounting;

[0204] Detection step: the paraffin-embedded cell section was observed by fluorescence microscope to generate signal points and photographed for imaging;

[0205] Detection probe elution step:

[0206] After imaging, the paraffin-embedded cell section was immersed in DEPC-PBS solution until the cover glass fell off; after removing the cover glass, 0.1% (w / v, g / 100mL) Triton X and 80% (w / v, g / 100mL) formamide in DEPC water (elution buffer) were added dropwise on the paraffin-embedded cell section to completely cover the cell sample, and incubated at 37°C for 3 times, 10 min each time; after incubation, the section was washed with DEPC-PBST solution for 3 times, 30 s each time;

[0207] Next detection step: repeat the detection probe hybridization step, the sealing step, the detection step and the probe elution step; when repeating the detection probe hybridization step, the first detection probe hybridization reagent is replaced by the second detection probe hybridization reagent, the third detection probe hybridization reagent and the fourth detection probe hybridization reagent respectively; after the last repetition, the detection step ends without the need for a probe elution step.

[0208] After the detection, the signal points detected in A549 cells, THP-1 cells and SKBR3 cells were quantitatively analyzed by bioinformatics clustering analysis, and the results were compared with the nTPM values in the database (https: / / www.proteinatlas.org / ) and the single-cell sequencing expression correlation results graph, as shown in Figure 8 According to A in Figure 8 , the correlation coefficient R between the ISS results of A549 cell line and the database is 0.8, and the correlation coefficient R between the single-cell sequencing results is 0.74; according to B and C in Figure 8 , in SKBR3 cell line and THP-1 cell line, the correlation coefficient R between the ISS results and the database is 0.84 and 0.91 respectively, and the correlation is strong. This result shows that the double connection probe used in Example 2 has strong specificity.

[0209] Example 3: A detection kit for tumor immunotherapy prediction based on in situ sequencing-tumor immune microenvironment

[0210] The present embodiment provides a detection kit for tumor immunotherapy prediction based on in situ sequencing-tumor immune microenvironment (the detection principle diagram is shown in Figure 1 ), which comprises double connection probe hybridization reagent, double connection probe connection reagent, double connection probe cyclization reagent, rolling circle amplification reagent, first detection probe hybridization reagent, second detection probe hybridization reagent, third detection probe hybridization reagent and fourth detection probe hybridization reagent, and sealing agent;

[0211] The double connection probe hybridization reagent (50 μL) is composed of 15 μL 20x SSC buffer (Sigma), 5 μL formamide (Sigma) with a concentration of 100% (v / v), 22.5 μL DEPC water, and 1.25x 6 μL of each double connection probe set with a concentration of 0.05 μM (SEQ ID NO. 69-SEQ ID NO. 74, SEQ ID NO. 77-SEQ ID NO. 82, SEQ ID NO. 87-SEQ ID NO. 98, SEQ ID NO. 105-SEQ ID NO. 134, SEQ ID NO. 173-SEQ ID NO. 178, SEQ ID NO. 189-SEQ ID NO. 134, SEQ ID NO. 173-SEQ ID NO. 178, SEQ ID NO. 189-SEQ ID NO. 194, SEQ ID NO. 205-SEQ ID NO. 216, SEQ ID NO. 255-SEQ ID NO. 260, SEQ ID NO. 271-SEQ ID NO. 280, SEQ ID NO. 291-SEQ ID NO. 296, SEQ ID NO. 307-SEQ ID NO. 312, SEQ ID NO. 323-SEQ ID NO. 328, SEQ ID NO. 369-SEQ ID NO. 380, SEQ ID NO. 391-SEQ ID NO. 396, SEQ ID NO. 407-SEQ ID NO. 412, SEQ ID NO. 417-SEQ ID NO. 422, SEQ ID NO. 493-SEQ ID NO. 522, SEQ ID NO. 533-SEQ ID NO. 538, SEQ ID NO. 549-SEQ ID NO. 566, SEQ ID NO. 577-SEQ ID NO. 624, SEQ ID NO. 635-SEQ ID NO. 640, SEQ ID NO. 651-SEQ ID NO. 656, SEQ ID NO. 667-SEQ ID NO. 672, SEQ ID NO. 683-SEQ ID NO. 688, SEQ ID NO. 699-SEQ ID NO. 734, SEQ ID NO. 745-SEQ ID NO. 750, SEQ ID NO. 765-SEQ ID NO. 770, and SEQ ID NO. 777-SEQ ID NO. 796); the sequences of the double connection probes in the double connection probe set are shown in Table 1;

[0212] The double connection probe ligation reagent (50 μL) consists of 5 μL of 10x Splint R ligase reaction buffer (NEB), 12.5 μL of glycerol at a concentration of 100% (v / v), 1 μL of SplintR ligase (NEB) at a concentration of 25 U / μL, 1.25 μL of RiboLock RNase Inhibitor (Thermo) at a concentration of 40 U / μL, 5 μL of BSA (NEB) at a concentration of 2 μg / μL, and 25.25 μL of DEPC water;

[0213] The double connection probe ligation reagent (50 μL) consists of 5 μL of 10x Splint R ligase reaction buffer (NEB), 12.5 μL of glycerol at a concentration of 100% (v / v), 1 μL of SplintR ligase (NEB) at a concentration of 25 U / μL, 1.25 μL of RiboLock RNase Inhibitor (Thermo) at a concentration of 40 U / μL, 5 μL of BSA (NEB) at a concentration of 2 μg / μL, and 25.25 μL of DEPC water;

[0214] The double connection probe ligation reagent (50 μL) consists of 5 μL of 10x Splint R ligase reaction buffer (NEB), 12.5 μL of glycerol at a concentration of 100% (v / v), 1 μL of SplintR ligase (NEB) at a concentration of 25 U / μL, 1.25 μL of RiboLock RNase Inhibitor (Thermo) at a concentration of 40 U / μL, 5 μL of BSA (NEB) at a concentration of 2 μg / μL, and 25.25 μL of DEPC water;

[0215] The double connection probe ligation reagent (50 μL) consists of 5 μL of 10x Splint R ligase reaction buffer (NEB), 12.5 μL of glycerol at a concentration of 100% (v / v), 1 μL of SplintR ligase (NEB) at a concentration of 25 U / μL, 1.25 μL of RiboLock RNase Inhibitor (Thermo) at a concentration of 40 U / μL, 5 μL of BSA (NEB) at a concentration of 2 μg / μL, and 25.25 μL of DEPC water;

[0216] The second detection probe hybridization reagent (50 μL) is composed of 5 μL of 10×T4 DNA ligase buffer (Thermo), 5 μL of ATP at a concentration of 10 mM (Thermo), 5 μL of BSA at a concentration of 2 μg / μL (NEB), 1 μL of T4 DNA ligase at a concentration of 5 U / μL (Thermo), 5 μL of the second anchor primer (SEQ ID NO. 1481) at a concentration of 2 μM, 2.5 μL of each detection probe group (SEQ ID NO. 1486-SEQ ID NO. 1489) at a concentration of 2 μM, and 19 μL of DEPC water;

[0217] The third detection probe hybridization reagent (50 μL) is composed of 5 μL of 10×T4 DNA ligase buffer (Thermo), 5 μL of ATP at a concentration of 10 mM (Thermo), 5 μL of BSA at a concentration of 2 μg / μL (NEB), 1 μL of T4 DNA ligase at a concentration of 5 U / μL (Thermo), 5 μL of the first anchor primer (SEQ ID NO. 1480) at a concentration of 2 μM, 2.5 μL of each detection probe group (SEQ ID NO. 1490-SEQ ID NO. 1493) at a concentration of 2 μM, and 19 μL of DEPC water;

[0218] The fourth detection probe hybridization reagent (50 μL) is composed of 5 μL of 10×T4 DNA ligase buffer (Thermo), 5 μL of ATP at a concentration of 10 mM (Thermo), 5 μL of BSA at a concentration of 2 μg / μL (NEB), 1 μL of T4 DNA ligase at a concentration of 5 U / μL (Thermo), 5 μL of the second anchor primer (SEQ ID NO. 1481) at a concentration of 2 μM, 2.5 μL of each detection probe group (SEQ ID NO. 1494-SEQ ID NO. 1497) at a concentration of 2 μM, and 19 μL of DEPC water; the sequences of the detection probes of the detection probe group and the fluorescent group modification are shown in Table 2;

[0219] The mounting agent is an anti-fluorescence quenching mounting agent; the anti-fluorescence quenching mounting agent is Gold Antifade Mountan mounting agent (Fermantas) containing 0.5 μg / mL of DAPI (Thermo). Gold Antifade Mountan mounting agent (Fermantas).

[0220] Example 4: A detection kit for tumor immunotherapy prediction based on in situ sequencing-tumor immune microenvironment

[0221] The present embodiment provides a detection kit for tumor immunotherapy prediction based on in situ sequencing-tumor immune microenvironment (the detection principle diagram is shown inFigure 1 ), the detection kit is based on Example 3, the double connection probes in the double connection probe group targeting T lymphocyte related genes are increased from 3 pairs to 4 pairs and 5 pairs respectively (SEQ ID NO. 69-SEQ ID NO. 86), the double connection probes in the double connection probe group targeting B lymphocyte related genes are increased from 3 pairs to 4 pairs and 5 pairs respectively (SEQ ID NO. 211-SEQ ID NO. 226, SEQ ID NO. 1469-SEQ ID NO. 1478), the double connection probes in the double connection probe group targeting macrophage related genes are increased from 3 pairs to 8 pairs (SEQ ID NO. 517-SEQ ID NO. 548), the double connection probes in the double connection probe group targeting endothelial related genes are increased from 3 pairs to 5 pairs and 8 pairs respectively (SEQ ID NO. 407-SEQ ID NO. 432), the double connection probes in the double connection probe group targeting fibroblast related genes are increased from 3 pairs to 8 pairs (SEQ ID NO. 275-SEQ ID NO. 338).

[0222] Example 5: A detection kit for tumor immunotherapy prediction based on in situ sequencing-tumor immune microenvironment

[0223] The present embodiment provides a detection kit for tumor immunotherapy prediction based on in situ sequencing-tumor immune microenvironment (the detection principle diagram is shown in Figure 1 ), the detection kit comprises double connection probe hybridization reagent, double connection probe ligation reagent, double connection probe cyclization reagent, rolling circle amplification reagent, first detection probe hybridization reagent, second detection probe hybridization reagent, third detection probe hybridization reagent and fourth detection probe hybridization reagent, and sealing agent;

[0224] The double connection probe hybridization reagent (50 μL) is composed of 15 μL 20xSSC buffer (Sigma), 5 μL formamide (Sigma) with a concentration of 100% (v / v), 5 μL 5% (w / v, g / mL) polyethylene glycol-4000, 17.5 μL DEPC water, and 1.25x6 μL of each double connection probe with a concentration of 0.05 μM (SEQ ID NO. 7-SEQ ID NO. 144, SEQ ID NO. 157-SEQ ID NO. 226, SEQ ID NO. 245-SEQ ID NO. 368, SEQ ID NO. 391-SEQ ID NO. 432, SEQ ID NO. 439-SEQ ID NO. 548, SEQ ID NO. 561-SEQ ID NO. 576, SEQ ID NO. 583-SEQ ID NO. 588, SEQ ID NO. 619-SEQ ID NO. 698, SEQ ID NO. 729-SEQ ID NO. 1468); the sequences of the double connection probes in the double connection probe group are shown in Table 1;

[0225] The double connection probe ligation reagent (50 μL) is composed of 5 μL 10xSplint R ligase reaction buffer (NEB), 12.5 μL glycerol with a concentration of 100% (v / v), 1 μL SplintR ligase (NEB) with a concentration of 25 U / μL, 1.25 μL RiboLock RNase Inhibitor (Thermo) with a concentration of 40 U / μL, 5 μL BSA (NEB) with a concentration of 2 μg / μL, and 25.25 μL DEPC water;

[0226] The double connection probe ligation reagent (50 μL) is composed of 5 μL 10xSplint R ligase reaction buffer (NEB), 12.5 μL glycerol with a concentration of 100% (v / v), 1 μL SplintR ligase (NEB) with a concentration of 25 U / μL, 1.25 μL RiboLock RNase Inhibitor (Thermo) with a concentration of 40 U / μL, 5 μL BSA (NEB) with a concentration of 2 μg / μL, and 25.25 μL DEPC water;

[0227] The rolling circle amplification reagent (50 μL) is composed of 5 μL of 10x Phi29 DNA polymerase buffer (NEB), 2 μL of dNTPs with a concentration of 25 mM (Thermo), 5 μL of BSA with a concentration of 2 μg / μL (NEB), 2.5 μL of glycerol with a concentration of 100% (v / v), 5 μL of Phi29 polymerase with a concentration of 10 U / μL (NEB), 1.25 μL of RiboLock RNase Inhibitor with a concentration of 40 U / μL (Thermo), and 29.25 μL of DEPC water;

[0228] The first detection probe hybridization reagent (50 μL) is composed of 5 μL of 10x T4 DNA ligase buffer (Thermo), 5 μL of ATP with a concentration of 10 mM (Thermo), 5 μL of BSA with a concentration of 2 μg / μL (NEB), 1 μL of T4 DNA ligase with a concentration of 5 U / μL (Thermo), 5 μL of the first anchor primer (SEQ ID NO. 1480) with a concentration of 2 μM, 5 μL of the second anchor primer (SEQ ID NO. 1481) with a concentration of 2 μM, 2.5 μL of each detection probe group (SEQ ID NO. 1482-SEQ ID NO. 1485) with a concentration of 2 μM, and 19 μL of DEPC water;

[0229] The second detection probe hybridization reagent (50 μL) is composed of 5 μL of 10x T4 DNA ligase buffer (Thermo), 5 μL of ATP with a concentration of 10 mM (Thermo), 5 μL of BSA with a concentration of 2 μg / μL (NEB), 1 μL of T4 DNA ligase with a concentration of 5 U / μL (Thermo), 5 μL of the second anchor primer (SEQ ID NO. 1481) with a concentration of 2 μM, 2.5 μL of each detection probe group (SEQ ID NO. 1486-SEQ ID NO. 1489) with a concentration of 2 μM, and 19 μL of DEPC water;

[0230] The third detection probe hybridization reagent (50 μL) is composed of 5 μL of 10x T4 DNA ligase buffer (Thermo), 5 μL of ATP with a concentration of 10 mM (Thermo), 5 μL of BSA with a concentration of 2 μg / μL (NEB), 1 μL of T4 DNA ligase with a concentration of 5 U / μL (Thermo), 5 μL of the first anchor primer (SEQ ID NO. 1480) with a concentration of 2 μM, 2.5 μL of each detection probe group (SEQ ID NO. 1490-SEQ ID NO. 1493) with a concentration of 2 μM, and 19 μL of DEPC water;

[0231] The fourth detection probe hybridization reagent (50 μL) is composed of 5 μL of 10x T4 DNA ligase buffer (Thermo), 5 μL of ATP at a concentration of 10 mM (Thermo), 5 μL of BSA at a concentration of 2 μg / μL (NEB), 1 μL of T4 DNA ligase at a concentration of 5 U / μL (Thermo), 5 μL of the second anchor primer (SEQ ID NO. 1481) at a concentration of 2 μM, 2.5 μL of each detection probe in the detection probe group (SEQ ID NO. 1494-SEQ ID NO. 1497) at a concentration of 2 μM, and 19 μL of DEPC water; the sequences of the detection probes in the detection probe group and the fluorescent group modification are shown in Table 2.

[0232] The mounting agent is an anti-fluorescence quenching mounting agent; the anti-fluorescence quenching mounting agent is a Gold Antifade Mountan mounting agent (Fermantas) containing 0.5 μg / mL of DAPI (Thermo). Gold Antifade Mountan mounting agent (Fermantas).

[0233] Experimental Example 3: Influence of double connection probes on results of pairs of numbers

[0234] In this experimental example, three paraffin tissue section samples of lung squamous cell carcinoma were detected, and the three paraffin tissue section samples were 21AS05859-001 surgical specimen after immunotherapy (immunotherapy response, no tumor residual), 21AS02448-006 surgical specimen after immunotherapy (whether the treatment response is uncertain, 80% tumor residual), and 21AS09844-006 surgical specimen after immunotherapy (whether the treatment response is uncertain, 20% tumor residual) (all samples were taken from Xiamen Fudan Zhongshan Hospital). The detection process used the in situ sequencing-based tumor immune microenvironment-based detection kit for tumor immunotherapy prediction of Example 1 and Example 4, and the specific steps included the following steps:

[0235] Tissue section deparaffinization step:

[0236] The tissue section was baked in a 60°C oven for 30 min; after baking, the tissue section was cooled to room temperature (25°C); after cooling, the tissue section was placed in the xylene I cylinder for 15 min, then the tissue section was taken out and placed in the xylene II cylinder for 10 min; after soaking, the tissue section was taken out and sequentially soaked in 99.5% (v / v) ethanol, 95% (v / v) ethanol, and 70% (v / v) ethanol for 2 min; after soaking, the tissue section was taken out and soaked in DEPC water for 5 min, then the tissue section was taken out and soaked in DEPC-PBS solution for 2 min;

[0237] Tissue fixation step:

[0238] After adding 4% (w / v, g / 100mL) paraformaldehyde (Beyotime) to completely cover the tissue sample on the tissue section, incubate at 37°C for 10 min; after incubation, wash the tissue section with DEPC-PBS solution for 2 min;

[0239] Tissue permeation step:

[0240] Preheat hydrochloric acid with a concentration of 0.1M to 37°C, and add 0.3mg / mL pepsin (Solarbio) to the hydrochloric acid to obtain a tissue permeation solution; after adding the tissue permeation solution to completely cover the tissue sample on the tissue section, incubate at 37°C for 30 min; after incubation, soak the tissue section in DEPC water for 5 min, then take out the tissue section and soak it in DEPC-PBS solution for 2 min; after soaking, take out the tissue section and soak it in 70% (v / v) ethanol, 85% (v / v) ethanol, and 90% (v / v) ethanol for 1 min, respectively; after soaking, draw a histology circle on the tissue section around the outer edge of the tissue, and wash the tissue section with DEPC-PBST solution for 3 times, 30s each time;

[0241] Double ligation probe hybridization step:

[0242] After adding the double ligation probe hybridization reagent to completely cover the tissue sample on the tissue section, incubate at 37°C for 4h to allow the double ligation probe to hybridize with the target nucleic acid; after incubation, wash with DEPC-PBST solution for 3 times, 30s each time; after washing, add 2xSSC buffer containing 0.5% (w / v, g / 100mL) formamide to completely cover the tissue sample on the tissue section, and incubate in a 37°C oven for 3 times, 10 min each time, to remove excess unhybridized double ligation probe;

[0243] Double ligation probe ligation step:

[0244] After adding the double ligation probe ligation reagent to completely cover the tissue sample on the tissue section, incubate at 37°C for 30 min; after incubation, wash the section with DEPC-PBST solution for 3 times, 30s each time;

[0245] Double ligation probe circularization step:

[0246] After adding the double ligation probe circularization reagent to completely cover the tissue sample on the tissue section, incubate at 37°C for 30 min; after incubation, wash the section with DEPC-PBST solution for 3 times, 30s each time;

[0247] Rolling circle amplification step:

[0248] After the rolling circle amplification reagent is added dropwise on the tissue section to completely cover the tissue sample, it is incubated at 30°C for 16h; after the incubation is completed, the section is washed with DEPC-PBST solution for 3 times, 30s each time; after washing, 4%(w / v, g / 100mL) paraformaldehyde (Beyotime) is added dropwise on the tissue section to completely cover the tissue sample, and the tissue is fixed at 37°C for 10min; after fixation, the waste liquid on the tissue section is recovered, and the tissue section is washed with DEPC-PBS solution for 3 times, 30s each time;

[0249] Detection probe hybridization step:

[0250] After the first detection probe hybridization reagent is added dropwise on the tissue section to completely cover the tissue sample, it is incubated at 30°C for 45min; after the incubation is completed, the section is washed with DEPC-PBST solution for 3 times, 30s each time;

[0251] Mounting step:

[0252] After the tissue section is air-dried, 20μL mounting agent is added dropwise on the tissue section, and a clean cover glass is covered for mounting;

[0253] Detection step: The signal points generated by the tissue section are observed by fluorescence microscopy and photographed for imaging;

[0254] Detection probe elution step:

[0255] After the tissue section after photographing imaging is immersed in DEPC-PBS solution until the cover glass falls off; after the cover glass is removed, DEPC water containing 0.1%(w / v, g / 100mL) TritonX and 80%(w / v, g / 100mL) formamide (elution buffer) is added dropwise on the tissue section to completely cover the tissue sample, and it is incubated at 37°C for 3 times, 10min each time; after incubation, the section is washed with DEPC-PBST solution for 3 times, 30s each time;

[0256] Next detection step: The detection probe hybridization step, mounting step, detection step and probe elution step are repeated; when the detection probe hybridization step is repeated, the first detection probe hybridization reagent is replaced by the second detection probe hybridization reagent, the third detection probe hybridization reagent and the fourth detection probe hybridization reagent respectively; after the last repetition, the detection step is completed without the need for the probe elution step.

[0257] After the detection, the signal points detected by different gene numbers in the three samples of lung squamous carcinoma, the 21AS05859-001 surgical specimen after immunotherapy (immunotherapy response, no tumor residual), the 21AS02448-006 surgical specimen after immunotherapy (whether the treatment response is uncertain, 80% tumor residual), and the 21AS09844-006 surgical specimen after immunotherapy (whether the treatment response is uncertain, 20% tumor residual) were quantitatively analyzed by bioinformatics clustering analysis, and the results are shown in Figures 9-13 . According to Figures 9-10 , it can be known that the detection rate of T cell and B cell related genes does not increase with the increase of the number of double connection probe pairs; according to Figures 11-13 , it can be known that the detection rate of macrophage, endothelial cell, and fibroblast related genes is obviously improved with the increase of the number of double connection probe pairs. This result shows that the detection rate of macrophage, endothelial cell, and fibroblast related genes is improved with the increase of the number of double connection probe pairs, and the detection rate of T cell and B cell related genes does not increase with the increase of the number of double connection probe pairs, and therefore, the number of double connection probe pairs of macrophage, endothelial cell, and fibroblast related genes needs to be increased.

[0258] Experimental Example 4: Influence of detection conditions on detection results

[0259] In this experimental example, three paraffin tissue section samples of lung squamous carcinoma were detected, and the three paraffin tissue section samples were respectively the 21AS05859-001 surgical specimen after immunotherapy (immunotherapy response, no tumor residual), the 21AS02448-006 surgical specimen after immunotherapy (whether the treatment response is uncertain, 80% tumor residual), and the 21AS09844-006 surgical specimen after immunotherapy (whether the treatment response is uncertain, 20% tumor residual) (all samples were taken from Xiamen Fudan Zhongshan Hospital). The detection process used the in situ sequencing-based tumor immune microenvironment-based detection kit for tumor immunotherapy prediction of Example 3, and the specific steps included the following steps:

[0260] Scheme A: On the basis of Experimental Example 3, 0.1 mg / mL of pepsin in the permeation step was replaced by 0.3 mg / mL of pepsin;

[0261] Scheme B: On the basis of Experimental Example 3, 4% (w / v, g / mL) of paraformaldehyde (Beyotime) was added to the tissue section after the rolling amplification step to fix the tissue sample for 10 min;

[0262] Scheme C: On the basis of Experimental Example 3, 0.1 mg / mL of pepsin in the permeation step was replaced by 0.1 mg / mL of pepsin; 5% (w / v, g / mL) of polyethylene glycol-4000 was added to the double connection reagent in the double connection probe hybridization step;

[0263] Scheme D: Based on Experimental Example 3, an antigen retrieval was performed before the permeabilization step, i.e., citrate buffer containing 0.05% (w / v, g / mL) LDS was added, and the cells were incubated at 100°C for 10 min; the 0.1 mg / mL pepsin in the permeabilization step was replaced with 0.1 mg / mL pepsin; 5% (w / v, g / mL) polyethylene glycol-4000 was added to the double-ligation reagent in the double-ligation probe hybridization step; and 4% (w / v, g / mL) paraformaldehyde (Beyotime) was added to the tissue sections after the rolling amplification step to fix the tissue samples for 10 min.

[0264] After the test, bioinformatics cluster analysis was used to quantitatively analyze the signal points detected in different groups of sections in three samples of lung squamous cell carcinoma: 21AS05859-001 surgical specimen after immunotherapy (immunotherapy response, no tumor residue), 21AS02448-006 surgical specimen after immunotherapy (treatment response was not determined, 80% tumor residue), and 21AS09844-006 surgical specimen after immunotherapy (treatment response was not determined, 20% tumor residue). The results are shown in Figure 14 .pass Figure 14 It can be seen that in scheme C, the paraffin tissue sections have the most specific signal points, and the corresponding detection conditions are as follows: in the tissue permeabilization step, 0.1 M hydrochloric acid preheated to 37°C and containing 0.3 mg / mL pepsin is used as the tissue permeabilization solution; in the double-linked probe hybridization step, 5% polyethylene glycol-4000 is added to the double-linked reagent; in the rolling circle amplification step, after washing, 4% (w / v, g / 100 mL) paraformaldehyde (Beyotime) is added to the tissue sections to fix the tissue samples for 10 minutes.

[0265] Experimental Example 5: Effect of probe elution conditions on detection results

[0266] In this experimental example, two identical paraffin tissue section samples of lung squamous cell carcinoma were tested. The two identical paraffin tissue section samples were puncture specimens 21AS08475-001 before immunotherapy (immunotherapy non-responsive, obtained from Xiamen Fudan Zhongshan Hospital). The detection process used the detection kit for tumor immunotherapy prediction based on in situ sequencing-tumor immune microenvironment of Example 5, and specifically included the following steps:

[0267] Scheme A: Same as Example 3;

[0268] Scheme B: On the basis of Example 3, the detection probe elution step was replaced by: after the tissue section was imaged, the tissue section was immersed in DEPC-PBS solution until the cover glass fell off; after the cover glass was removed, 0.05xSSC buffer (Sigma), 20mM Tris-hydrochloric acid buffer (pH 7.5, Regen Bio), 0.01% (w / v, g / mL) SDS (Solarbio) and 50% (w / v, g / mL) formamide (Sigma) in DEPC water (elution buffer) were added dropwise on the tissue section to completely cover the tissue sample, and incubated at 60°C for 5 min; after incubation, the section was washed with DEPC-PBST solution for 3 times, 30 s each time; after washing, 4% (w / v, g / 100 mL) paraformaldehyde (Beyotime) was added dropwise on the tissue section to completely cover the tissue sample, and the tissue was fixed at 37°C for 10 min; after fixation, the waste liquid on the tissue section was recovered, and the tissue section was washed with DEPC-PBS solution for 3 times, 30 s each time.

[0269] After the detection was completed, the different groups of sections in the two samples 21AS08475-001 puncture specimens before immunotherapy of lung adenocarcinoma (immunotherapy non-response) were imaged and bioinformatics analyzed, and the results are shown in Figure 15 It can be seen from Figure 15 that compared with scheme A, the nuclear background of the paraffin tissue section using scheme B is significantly reduced, and the signal points are increased, and the corresponding probe elution condition is: 0.05xSSC buffer (Sigma), 20mM Tris-hydrochloric acid buffer (pH 7.5, Regen Bio), 0.01% (w / v, g / mL) SDS (Solarbio) and 50% (w / v, g / mL) formamide (Sigma) in DEPC water are selected as elution buffer for probe elution, and 4% paraformaldehyde (Beyotime) is added once after probe elution.

[0270] Experimental Example 6: Verification of detection effect of detection kit on tissue section

[0271] The different paraffin tissue section samples of lung squamous carcinoma were detected in the experimental example, and the paraffin tissue section samples included 91 puncture samples before immunotherapy and surgical samples after immunotherapy taken from 63 lung squamous carcinoma patients (all samples were taken from Xiamen Fudan Zhongshan Hospital, see Tables 2-3 for details), such as 22AS07589-001 puncture sample before immunotherapy (immunotherapy response, the corresponding number in Table 2 was S7589_230707), 21AS05859-001 surgical sample after immunotherapy (immunotherapy response, the corresponding number in Table 2 was S5859_230520), 23AS04755-002 surgical sample after immunotherapy (immunotherapy non-response, the corresponding number in Table 2 was S4755_231019), 21AS02448-006 surgical sample after immunotherapy (immunotherapy non-response, the corresponding number in Table 2 was S2448_230520), 22AS00124-004 surgical sample after immunotherapy (immunotherapy non-response, the corresponding number in Table 2 was S0124_230805), 23AS01776-004 surgical sample after immunotherapy (immunotherapy non-response, the corresponding number in Table 2 was S1776_230613), 21AS08082-009 surgical sample after immunotherapy (immunotherapy response, the corresponding number in Table 2 was S8082_23QX), 21AS08394-002 surgical sample after immunotherapy (immunotherapy response, the corresponding number in Table 2 was S8394_230822), 22AS01216-006 surgical sample after immunotherapy (immunotherapy response, the corresponding number in Table 2 was S1216_230613), 21AS00231-004 surgical sample after immunotherapy (immunotherapy response, the corresponding number in Table 2 was S0231_23QX), 23AS05297-010 surgical sample after immunotherapy (immunotherapy response, the corresponding number in Table 2 was S5297_230726), and the like. The detection process used the in situ sequencing-based tumor immune microenvironment kit for tumor immunotherapy prediction of Example 5, and specifically included the following steps:

[0272] Tissue section deparaffinization step:

[0273] The tissue section was baked in a 60°C oven for 30 min; after baking, the tissue section was cooled to room temperature (25°C); after cooling, the tissue section was placed in the xylene I cylinder for 15 min, and then the tissue section was taken out and placed in the xylene II cylinder for 10 min; after soaking, the tissue section was taken out and sequentially soaked in 99.5% (v / v) ethanol, 95% (v / v) ethanol, and 70% (v / v) ethanol for 2 min; after soaking, the tissue section was taken out and soaked in DEPC water for 5 min, and then the tissue section was taken out and soaked in DEPC-PBS solution for 2 min;

[0274] Tissue fixation step:

[0275] After adding 4% (w / v, g / 100 mL) paraformaldehyde (Beyotime) on the tissue slice to completely cover the tissue sample, incubate at 37°C for 10 min; after incubation, wash the tissue slice with DEPC-PBS solution for 2 min;

[0276] Tissue permeation step:

[0277] Preheat hydrochloric acid with a concentration of 0.1 M to 37°C, and add 0.3 mg / mL pepsin (Solarbio) to the hydrochloric acid to obtain a tissue permeation solution; after adding the tissue permeation solution on the tissue slice to completely cover the tissue sample, incubate at 37°C for 30 min; after incubation, immerse the tissue slice in DEPC water for 5 min, then take out the tissue slice and immerse it in DEPC-PBS solution for 2 min; after immersion, take out the tissue slice and immerse it in 70% (v / v) ethanol, 85% (v / v) ethanol, and 90% (v / v) ethanol for 1 min each; after immersion, draw a histology circle on the tissue slice around the tissue edge, and wash the tissue slice with DEPC-PBST solution for 3 times, 30 s each time;

[0278] Double connection probe hybridization step:

[0279] After adding the double connection probe hybridization reagent on the tissue slice to completely cover the tissue sample, incubate at 46°C for 4 h to allow the double connection probe to hybridize with the target nucleic acid; after incubation, wash with DEPC-PBST solution for 3 times, 30 s each time; after washing, add 2×SSC buffer containing 0.5% (w / v, g / 100 mL) formamide on the tissue slice to completely cover the tissue sample, and incubate in an oven at 46°C for 3 times, 5 min each time, to remove excess unhybridized double connection probe;

[0280] Double connection probe connection step:

[0281] After adding the double connection probe connection reagent on the tissue slice to completely cover the tissue sample, incubate at 37°C for 30 min; after incubation, wash the slice with DEPC-PBST solution for 3 times, 30 s each time;

[0282] Double connection probe circularization step:

[0283] After adding the double connection probe circularization reagent on the tissue slice to completely cover the tissue sample, incubate at 37°C for 30 min; after incubation, wash the slice with DEPC-PBST solution for 3 times, 30 s each time;

[0284] Rolling circle amplification step:

[0285] After the rolling circle amplification reagent is added dropwise on the tissue section to completely cover the tissue sample, it is incubated at 30°C for 16h; after the incubation is completed, the section is washed with DEPC-PBST solution for 3 times, 30s each time; after washing, 4% (w / v, g / 100mL) paraformaldehyde (Beyotime) is added dropwise on the tissue section to completely cover the tissue sample, and the tissue is fixed at 37°C for 10min; after fixation, the waste liquid on the tissue section is recovered, and the tissue section is washed with DEPC-PBS solution for 3 times, 30s each time;

[0286] Detection probe hybridization step:

[0287] After the first detection probe hybridization reagent is added dropwise on the tissue section to completely cover the tissue sample, it is incubated at 30°C for 45min; after the incubation is completed, the section is washed with DEPC-PBST solution for 3 times, 30s each time;

[0288] Mounting step:

[0289] After the tissue section is air-dried, 20μL mounting agent is added dropwise on the tissue section, and a clean cover glass is covered for mounting;

[0290] Detection step: the signal points generated by the tissue section under fluorescence microscope observation are photographed and imaged;

[0291] Detection probe elution step:

[0292] After the tissue section after photographing and imaging is soaked in DEPC-PBS solution until the cover glass falls off; after the cover glass is removed, DEPC water containing 0.05×SSC buffer (Sigma), 20mM Tris-hydrochloric acid buffer (PH7.5, Regen Bio), 0.01% (w / v, g / mL) SDS (Solarbio) and 50% (w / v, g / mL) formamide (Sigma) (elution buffer) is added dropwise on the tissue section to completely cover the tissue sample, and it is incubated at 60°C for 5min; after incubation, the section is washed with DEPC-PBST solution for 3 times, 30s each time; then 4% paraformaldehyde (Beyotime) is added dropwise on the tissue section for 10min; after incubation, the section is washed with DEPC-PBST solution for 3 times, 30s each time.

[0293] Next detection step: the detection probe hybridization step, mounting step, detection step and probe elution step are repeated; when the detection probe hybridization step is repeated, the first detection probe hybridization reagent is replaced by the second detection probe hybridization reagent, the third detection probe hybridization reagent and the fourth detection probe hybridization reagent respectively; after the last repetition, the detection step is completed without the probe elution step.

[0294] After the detection is completed, the signal points detected by different gene numbers in the 91 samples of lung squamous carcinoma are quantitatively analyzed by bioinformatics clustering analysis, and the results are shown in Figures 16-25 According to Figure 16 , the kit can show the spatial distribution of gene expression related to the main cell types of the 22AS07589-001 puncture specimen before immunotherapy (immunotherapy response); according to Figure 17 , the kit can show the spatial distribution of gene expression related to the main cell types of the 21AS05859-001 post-immunotherapy surgical specimen (immunotherapy response); according to Figure 18 , based on in situ sequencing, the annotation of cell types can be realized in combination with specific marker genes; according to Figure 19 , the kit can locate and quantify CD8 T cells, B cells and CD4 T cells in the 23AS04755-002 post-immunotherapy surgical specimen (immunotherapy non-response); Figure 20 In order to distinguish the differences between B cells, CD8 T, DCs and Fibroblast in the pre-immunotherapy response patients and non-response patients, Figure 21 In order to distinguish the differences between B cells, Cancer cell, DCs and Fibroblasts in the post-immunotherapy response patients and non-response patients; according to Figure 22 , the kit can distinguish the tumor microenvironment based on the response prediction logistics model of cell type abundance for the 21AS02448-006 post-immunotherapy surgical specimen (immunotherapy non-response), the 22AS00124-004 post-immunotherapy surgical specimen (immunotherapy non-response), the 23AS01776-004 post-immunotherapy surgical specimen (immunotherapy non-response), the 21AS08082-009 post-immunotherapy surgical specimen (immunotherapy response), the 21AS08394-002 post-immunotherapy surgical specimen (immunotherapy response), the 22AS01216-006 post-immunotherapy surgical specimen (immunotherapy response), the 21AS00231-004 post-immunotherapy surgical specimen (immunotherapy response) and the 23AS05297-010 post-immunotherapy surgical specimen (immunotherapy response); according to Figures 23-25 , for 32+17 pre-treatment clinical samples, the kit can distinguish the possibility of response and non-response patients according to the tumor microenvironment characteristics, which is 77.3%, for 14+17 postoperative specimens, the AUC of the kit for distinguishing the response and non-response patients according to the tumor microenvironment characteristics can reach 100%, and compared with the existing PD-L1 immunohistochemistry, the kit has obvious advantages in predicting the response results of immunotherapy, so the nucleic acid detection method of the present application has great application prospect in the prediction of immunotherapy of cancer (non-small cell lung cancer).

[0295] Table 2 sample information

[0296]

[0297]

[0298]

[0299] Table 3 sample information

[0300]

[0301] It is apparent that the above-described embodiments are merely illustrative for the sake of clarity and are not intended to limit the scope of the application. Other variations and modifications can be made by those skilled in the art based on the above description. All of the embodiments are not required to be exhaustive. The scope of the present application is defined by the appended claims rather than the embodiments described above.

Claims

1. A molecular marker for tumor immunotherapy prediction, characterized in that, The molecular markers include CD103 protein, ITGAE protein, TIGIT protein, FOXP3 protein, TBX21 protein, CD4 protein, CCL5 protein, CD69 protein, GZMB protein, CD3G protein, CD8A protein, CD8B protein, GZMA protein, FASLG protein, CD3E protein, BANK1 protein, MZB1 protein, CD19 protein, HLA-DRB1 protein, HLA-DRA protein, CD79A protein, MS4A1 protein, FAP protein, CA9 protein, DPT protein, LUM protein, COL1A1 protein, ACTA2 protein, MMP2 protein, PDGFRA protein, PDGFRB protein, POSTN protein, VEGFC protein, VEGFA protein, AXL protein, VEGFB protein, VWF protein, ESM1 protein, PECAM1 protein, CD86 protein, CX3CR1 protein, MMP12 protein, CD68 protein, IL10 protein, CD80 protein, CCL2 protein, CCL7 protein, CCL8 protein, MRC1 protein, FGL2 protein, LYZ protein, CEACAM8 protein, FCGR3B protein, STK11 protein, MYBL2 protein, ZNF423 protein, TJP3 protein, APC protein, KEAP1 protein, CD47 protein, CD274 protein, PDCD1LG2 protein, LAG3 protein, HAVCR2 protein, PDCD1 protein, CDH1 protein, CSMD1 protein, GLTPD2 protein, L1TD1 protein, TDO2 protein, LOXL2 protein, MKI67 protein, TWIST2 protein, PPIB protein, DAPB protein, UBC protein, CCNE1 protein, CCNB1 protein, MYBL2 protein, STK15 protein, BTLA protein, VSIR protein, CD160 protein, CD244 protein, IDO1 protein, TGFB1 protein, EPCAM protein, TP63 protein, PRF1 protein, CTLA4 protein, MMP11 protein, IFNG protein, IL6 protein, EOMES protein, CD11c protein, CD14 protein, PTPRC protein, SNAI2 protein, SNAI1 protein, ICOS protein, HLA-A protein, HLA-C protein, TTF1 protein, CD28 protein, CD40 protein, TWIST1 protein, NKG7 protein, NCR1 protein, ITK protein, IL1B protein, CD40LG protein, TNF protein, IFNB1 protein, CCL22 protein, CXCR1 protein, PGLYRP1 protein, CXCL8 protein, ARG1 protein, MSR1 protein, CDH5 protein, CLEC14A protein, MPO protein, CD94 protein, and / or CD117 protein. Alternatively, the molecular marker comprises a gene encoding a CD103 protein, an ITGAE protein, a TIGIT protein, a FOXP3 protein, a TBX21 protein, a CD4 protein, a CCL5 protein, a CD69 protein, a GZMB protein, a CD3G protein, a CD8A protein, a CD8B protein, a GZMA protein, a FASLG protein, a CD3E protein, a BANK1 protein, a MZB1 protein, a CD19 protein, a HLA-DRB1 protein, a HLA-DRA protein, a CD79A protein, a MS4A1 protein, a FAP protein, a CA9 protein, a DPT protein, a LUM protein, a COL1A1 protein, a ACTA2 protein, a MMP2 protein, a PDGFRA protein, a PDGFRB protein, a POSTN protein, a VEGFC protein, a VEGFA protein, a AXL protein, a VEGFB protein, a VWF protein, a ESM1 protein, a PECAM1 protein, a CD86 protein, a CX3CR1 protein, a MMP12 protein, a CD68 protein, a IL10 protein, a CD80 protein, a CCL2 protein, a CCL7 protein, a CCL8 protein, a MRC1 protein, a FGL2 protein, a LYZ protein, a CEACAM8 protein, a FCGR3B protein, a STK11 protein, a MYBL2 protein, a ZNF423 protein, a TJP3 protein, a APC protein, a KEAP1 protein, a CD47 protein, a CD274 protein, a PDCD1LG2 protein, a LAG3 protein, a HAVCR2 protein, a PDCD1 protein, a CDH1 protein, a CSMD1 protein, a GLTPD2 protein, a L1TD1 protein, a TDO2 protein, a LOXL2 protein, a MKI67 protein, a TWIST2 protein, a PPIB protein, a DAPB protein, a UBC protein, a CCNE1 protein, a CCNB1 protein, a MYBL2 protein, a STK15 protein, a BTLA protein, a VSIR protein, a CD160 protein, a CD244 protein, a IDO1 protein, a TGFB1 protein, a EPCAM protein, a TP63 protein, a PRF1 protein, a CTLA4 protein, a MMP11 protein, a IFNG protein, a IL6 protein, a EOMES protein, a CD11c protein, a CD14 protein, a PTPRC protein, a SNAI2 protein, a SNAI1 protein, a ICOS protein, a HLA-A protein, a HLA-C protein, a TTF1 protein, a CD28 protein, a CD40 protein, a TWIST1 protein, a NKG7 protein, a NCR1 protein, a ITK protein, a IL1B protein, a CD40LG protein, a TNF protein, a IFNB1 protein, a CCL22 protein, a CXCR1 protein, a PGLYRP1 protein, a CXCL8 protein, a ARG1 protein, a MSR1 protein, a CDH5 protein, a CLEC14A protein, a MPO protein, a CD94 protein, and / or a CD117 protein.

2. The molecular marker of claim 1, wherein The molecular markers include TIGIT protein, FOXP3 protein, TBX21 protein, CD4 protein, CCL5 protein, CD69 protein, GZMB protein, CD3G protein, CD8A protein, CD8B protein, GZMA protein, FASLG protein, CD3E protein, CD19 protein, HLA-DRB1 protein, HLA-DRA protein, CD79A protein, MS4A1 protein, LUM protein, COL1A1 protein, ACTA2 protein, MMP2 protein, PDGFRA protein, PDGFRB protein, POSTN protein, VEGFC protein, VEGFA protein, VWF protein, ESM1 protein, PECAM1 protein, CX3CR1 protein, MMP12 protein, CD68 protein, IL10 protein, CD80 protein, CCL2 protein, CCL7 protein, CCL8 protein, MRC1 protein, FGL2 protein, FCGR3B protein, STK11 protein, MYBL2 protein, CD274 protein, PDCD1LG2 protein, LAG3 protein, HAVCR2 protein, PDCD1 protein, LOXL2 protein, MKI67 protein, TWIST2 protein, PPIB protein, DAPB protein, UBC protein, CCNE1 protein, CCNB1 protein, MYBL2 protein, STK15 protein, BTLA protein, VSIR protein, CD160 protein, CD244 protein, IDO1 protein, TGFB1 protein, EPCAM protein, TP63 protein, PRF1 protein, CTLA4 protein, MMP11 protein, IFNG protein, IL6 protein, EOMES protein, CD11c protein, CD14 protein, PTPRC protein, SNAI2 protein, SNAI1 protein, ICOS protein, HLA-A protein, HLA-C protein, TTF1 protein, CD28 protein, CD40 protein, TWIST1 protein, NKG7 protein, NCR1 protein, ITK protein, IL1B protein, CD40LG protein, TNF protein, IFNB1 protein, CCL22 protein, CXCR1 protein, PGLYRP1 protein, CXCL8 protein, ARG1 protein, MSR1 protein, CDH5 protein, CLEC14A protein, MPO protein, CD94 protein, and / or CD117 protein; Alternatively, the molecular marker comprises a gene encoding a TIGIT protein, a FOXP3 protein, a TBX21 protein, a CD4 protein, a CCL5 protein, a CD69 protein, a GZMB protein, a CD3G protein, a CD8A protein, a CD8B protein, a GZMA protein, a FASLG protein, a CD3E protein, a CD19 protein, a HLA-DRB1 protein, a HLA-DRA protein, a CD79A protein, a MS4A1 protein, a LUM protein, a COL1A1 protein, a ACTA2 protein, a MMP2 protein, a PDGFRA protein, a PDGFRB protein, a POSTN protein, a VEGFC protein, a VEGFA protein, a VWF protein, a ESM1 protein, a PECAM1 protein, a CX3CR1 protein, a MMP12 protein, a CD68 protein, a IL10 protein, a CD80 protein, a CCL2 protein, a CCL7 protein, a CCL8 protein, a MRC1 protein, a FGL2 protein, a FCGR3B protein, a STK11 protein, a MYBL2 protein, a CD274 protein, a PDCD1LG2 protein, a LAG3 protein, a HAVCR2 protein, a PDCD1 protein, a LOXL2 protein, a MKI67 protein, a TWIST2 protein, a PPIB protein, a DAPB protein, a UBC protein, a CCNE1 protein, a CCNB1 protein, a MYBL2 protein, a STK15 protein, a BTLA protein, a VSIR protein, a CD160 protein, a CD244 protein, a IDO1 protein, a TGFB1 protein, a EPCAM protein, a TP63 protein, a PRF1 protein, a CTLA4 protein, a MMP11 protein, a IFNG protein, a IL6 protein, a EOMES protein, a CD11c protein, a CD14 protein, a PTPRC protein, a SNAI2 protein, a SNAI1 protein, a ICOS protein, a HLA-A protein, a HLA-C protein, a TTF1 protein, a CD28 protein, a CD40 protein, a TWIST1 protein, a NKG7 protein, a NCR1 protein, a ITK protein, a IL1B protein, a CD40LG protein, a TNF protein, a IFNB1 protein, a CCL22 protein, a CXCR1 protein, a PGLYRP1 protein, a CXCL8 protein, a ARG1 protein, a MSR1 protein, a CDH5 protein, a CLEC14A protein, a MPO protein, a CD94 protein, and / or a CD117 protein.

3. A test kit for tumor immunotherapy prediction, characterized by, The detection kit comprises a dual-ligation probe hybridization reagent, a dual-ligation probe ligation reagent, a dual-ligation probe circularization reagent, a rolling circle amplification reagent, and a detection probe hybridization reagent; the dual-ligation probe hybridization reagent comprises a plurality of dual-ligation probe groups; each dual-ligation probe group comprises at least one pair of dual-ligation probes targeting the molecular marker and designed according to the target sequence on the molecular marker; the pair of dual-ligation probes can recognize and hybridize to the target sequence corresponding thereto; each pair of dual-ligation probes comprises an upstream dual-ligation probe and a downstream dual-ligation probe; the upstream dual-ligation probe comprises an upstream tag sequence, and the downstream dual-ligation probe comprises a downstream tag sequence; the upstream tag sequence and the downstream tag sequence can form a complete tag sequence for interpreting the target sequence corresponding thereto; the dual-ligation probe ligation reagent is used to ligate the upstream tag sequence and the downstream tag sequence in the pair of dual-ligation probes to form a ligation product; the dual-ligation probe circularization reagent is used to circularize the ligation product to form a circularization product; and the rolling circle amplification reagent is used to perform rolling circle amplification on the circularization product to form a rolling circle amplification product. The detection probe hybridization reagent comprises a detection probe group; the detection probe in the detection probe group can hybridize to the rolling circle amplification product, and the detection probe in the detection probe group is coupled with a label.

4. The test kit of claim 3, wherein The dual-ligation probe group comprises at least two pairs of dual-ligation probes targeting different molecular markers and designed according to the target sequences on the molecular markers; after the dual-ligation probe group is input into cells or tissues, different pairs of dual-ligation probes in the dual-ligation probe group targeting different molecular markers can recognize and hybridize to the target sequences corresponding thereto, respectively.

5. The detection kit according to claim 3 or 4, characterized in that The double connection probe set comprises 3 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding CD103 protein and ITGAE protein as shown in SEQ ID NO. 1-6, 7 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding TIGIT protein as shown in SEQ ID NO. 7-20, 8 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding FOXP3 protein as shown in SEQ ID NO. 21-36, 8 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding TBX21 protein as shown in SEQ ID NO. 37-52, 8 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding CD4 protein as shown in SEQ ID NO. 53-68, 4 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding CCL5 protein as shown in SEQ ID NO. 69-76, 5 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding CD69 protein as shown in SEQ ID NO. 77-86, 3 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding GZMB protein as shown in SEQ ID NO. 87-92, 6 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding CD3G protein as shown in SEQ ID NO. 93-104, 3 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding CD8A protein as shown in SEQ ID NO. 105-110, 3 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding CD8B protein as shown in SEQ ID NO. 111-116, 3 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding GZMA protein as shown in SEQ ID NO. 117-122, 3 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding FASLG protein as shown in SEQ ID NO. 123-128, 8 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding CD3E protein as shown in SEQ ID NO. 129-144, 3 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding BANK1 protein as shown in SEQ ID NO. 145-150, 3 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding MZB1 protein as shown in SEQ ID NO. 151-156, 3 pairs of double connection probe pairs targeting nucleotide sequences of genes encoding CD19 protein as shown in SEQ ID NO. 157-172, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding HLA-DRB1 protein, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding HLA-DRA protein as shown in SEQ ID NO. 189 to SEQ ID NO. 204, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CD79A protein as shown in SEQ ID NO. 205 to SEQ ID NO. 210, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding MS4A1 protein as shown in SEQ ID NO. 211 to SEQ ID NO. 226, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding FAP protein as shown in SEQ ID NO. 227 to SEQ ID NO. 232, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CA9 protein as shown in SEQ ID NO. 233 to SEQ ID NO. 238, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding DPT protein as shown in SEQ ID NO. 239 to SEQ ID NO. 244, 5 pairs of double connection probes targeting the nucleotide sequence of the gene encoding LUM protein as shown in SEQ ID NO. 245 to SEQ ID NO. 254, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding COL1A1 protein as shown in SEQ ID NO. 255 to SEQ ID NO. 270, 2 pairs of double connection probes targeting the nucleotide sequence of the gene encoding ACTA2 protein as shown in SEQ ID NO. 271 to SEQ ID NO. 274, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding MMP2 protein as shown in SEQ ID NO. 275 to SEQ ID NO. 290, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding PDGFRA protein as shown in SEQ ID NO. 291 to SEQ ID NO. 306, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding PDGFRB protein as shown in SEQ ID NO. 307 to SEQ ID NO. 322, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding POSTN protein as shown in SEQ ID NO. 323 to SEQ ID NO. 338, 7 pairs of double connection probes targeting the nucleotide sequence of the gene encoding VEGFC protein as shown in SEQ ID NO. 339 to SEQ ID NO. 352, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding VEGFA protein as shown in SEQ ID NO. 353 to SEQ ID NO. 368, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding AXL protein as shown in SEQ ID NO. 369 to SEQ ID NO. 386, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NTRK1 protein as shown in SEQ ID NO. 387 to SEQ ID NO. 404, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NTRK3 protein as shown in SEQ ID NO. 405 to SEQ ID NO. 422, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NTRK2 protein as shown in SEQ ID NO. 423 to SEQ ID NO. 440, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG1 protein as shown in SEQ ID NO. 441 to SEQ ID NO. 458, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG2 protein as shown in SEQ ID NO. 459 to SEQ ID NO. 476, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG3 protein as shown in SEQ ID NO. 477 to SEQ ID NO. 494, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG4 protein as shown in SEQ ID NO. 495 to SEQ ID NO. 512, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG1 protein as shown in SEQ ID NO. 513 to SEQ ID NO. 530, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG2 protein as shown in SEQ ID NO. 531 to SEQ ID NO. 548, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG3 protein as shown in SEQ ID NO. 549 to SEQ ID NO. 566, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG4 protein as shown in SEQ ID NO. 567 to SEQ ID NO. 584, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG1 protein as shown in SEQ ID NO. 585 to SEQ ID NO. 602, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG2 protein as shown in SEQ ID NO. 603 to SEQ ID NO. 620, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG3 protein as shown in SEQ ID NO. 621 to SEQ ID NO. 638, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG4 protein as shown in SEQ ID NO. 639 to SEQ ID NO. 656, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG1 protein as shown in SEQ ID NO. 657 to SEQ ID NO. 674, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG2 protein as shown in SEQ ID NO. 675 to SEQ ID NO. 692, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG3 protein as shown in SEQ ID NO. 693 to SEQ ID NO. 710, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG4 protein as shown in SEQ ID NO. 711 to SEQ ID NO. 728, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG1 protein as shown in SEQ ID NO. 729 to SEQ ID NO. 746, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG2 protein as shown in SEQ ID NO. 747 to SEQ ID NO. 764, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG3 protein as shown in SEQ ID NO. 765 to SEQ ID NO. 782, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG4 protein as shown in SEQ ID NO. 783 to SEQ ID NO. 800, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG1 protein as shown in SEQ ID NO. 801 to SEQ ID NO. 818, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG2 protein as shown in SEQ ID NO. 819 to SEQ ID NO. 836, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG3 protein as shown in SEQ ID NO. 837 to SEQ ID NO. 854, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG4 protein as shown in SEQ ID NO. 855 to SEQ ID NO. 872, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG1 protein as shown in SEQ ID NO. 873 to SEQ ID NO. 890, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG2 protein as shown in SEQ ID NO. 891 to SEQ ID NO. 908, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG3 protein as shown in SEQ ID NO. 909 to SEQ ID NO. 926, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG4 protein as shown in SEQ ID NO. 927 to SEQ ID NO. 944, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG1 protein as shown in SEQ ID NO. 945 to SEQ ID NO. 962, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG2 protein as shown in SEQ ID NO. 963 to SEQ ID NO. 980, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG3 protein as shown in SEQ ID NO. 981 to SEQ ID NO. 998, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG4 protein as shown in SEQ ID NO. 999 to SEQ ID NO. 1016, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG1 protein as shown in SEQ ID NO. 1017 to SEQ ID NO. 1034, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG2 protein as shown in SEQ ID NO. 1035 to SEQ ID NO. 1052, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding NRG3 protein as shown in SEQ ID NO. 1053 to SEQ ID NO. 1070, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding N369~SEQ ID NO. 374, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding VWF protein as shown in SEQ ID NO. 391~SEQ ID NO. 406, 5 pairs of double connection probes targeting the nucleotide sequence of the gene encoding ESM1 protein as shown in SEQ ID NO. 407~SEQ ID NO. 416, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CD86 protein as shown in SEQ ID NO. 417~SEQ ID NO. 432, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CX3CR1 protein as shown in SEQ ID NO. 433~SEQ ID NO. 438, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding MMP12 protein as shown in SEQ ID NO. 439~SEQ ID NO. 454, 6 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CD68 protein as shown in SEQ ID NO. 455~SEQ ID NO. 466, 6 pairs of double connection probes targeting the nucleotide sequence of the gene encoding IL10 protein as shown in SEQ ID NO. 467~SEQ ID NO. 478, 7 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CD80 protein as shown in SEQ ID NO. 479~SEQ ID NO. 492, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL2 protein as shown in SEQ ID NO. 493~SEQ ID NO. 498, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL7 protein as shown in SEQ ID NO. 499~SEQ ID NO. 504, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL8 protein as shown in SEQ ID NO. 505~SEQ ID NO. 510, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding MRC1 protein as shown in SEQ ID NO. 511~SEQ ID NO. 516, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding FGL2 protein as shown in SEQ ID NO. 517~SEQ ID NO. 532, 8 pairs of double connection probes targeting the nucleotide sequence of the gene encoding LYZ protein as shown in SEQ ID NO. 533~SEQ ID NO. 548, 6 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CD14 protein as shown in SEQ ID NO. 549~SEQ ID NO. 562, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL3 protein as shown in SEQ ID NO. 563~SEQ ID NO. 568, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL4 protein as shown in SEQ ID NO. 569~SEQ ID NO. 574, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL5 protein as shown in SEQ ID NO. 575~SEQ ID NO. 580, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL6 protein as shown in SEQ ID NO. 581~SEQ ID NO. 586, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL8 protein as shown in SEQ ID NO. 587~SEQ ID NO. 592, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL19 protein as shown in SEQ ID NO. 593~SEQ ID NO. 598, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL20 protein as shown in SEQ ID NO. 599~SEQ ID NO. 604, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL22 protein as shown in SEQ ID NO. 605~SEQ ID NO. 610, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL24 protein as shown in SEQ ID NO. 611~SEQ ID NO. 616, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL26 protein as shown in SEQ ID NO. 617~SEQ ID NO. 622, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL27 protein as shown in SEQ ID NO. 623~SEQ ID NO. 628, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCL28 protein as shown in SEQ ID NO. 629~SEQ ID NO. 634, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR1 protein as shown in SEQ ID NO. 635~SEQ ID NO. 640, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR2A protein as shown in SEQ ID NO. 641~SEQ ID NO. 646, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR2B protein as shown in SEQ ID NO. 647~SEQ ID NO. 652, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR3 protein as shown in SEQ ID NO. 653~SEQ ID NO. 658, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR4 protein as shown in SEQ ID NO. 659~SEQ ID NO. 664, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR5 protein as shown in SEQ ID NO. 665~SEQ ID NO. 670, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR6 protein as shown in SEQ ID NO. 671~SEQ ID NO. 676, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR7 protein as shown in SEQ ID NO. 677~SEQ ID NO. 682, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR8 protein as shown in SEQ ID NO. 683~SEQ ID NO. 688, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR9 protein as shown in SEQ ID NO. 689~SEQ ID NO. 694, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR10 protein as shown in SEQ ID NO. 695~SEQ ID NO. 700, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR11 protein as shown in SEQ ID NO. 701~SEQ ID NO. 706, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR12 protein as shown in SEQ ID NO. 707~SEQ ID NO. 712, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR2A protein as shown in SEQ ID NO. 713~SEQ ID NO. 718, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR2B protein as shown in SEQ ID NO. 719~SEQ ID NO. 724, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR3 protein as shown in SEQ ID NO. 725~SEQ ID NO. 730, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR4 protein as shown in SEQ ID NO. 731~SEQ ID NO. 736, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR5 protein as shown in SEQ ID NO. 737~SEQ ID NO. 742, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR6 protein as shown in SEQ ID NO. 743~SEQ ID NO. 748, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR7 protein as shown in SEQ ID NO. 749~SEQ ID NO. 754, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR8 protein as shown in SEQ ID NO. 755~SEQ ID NO. 760, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR9 protein as shown in SEQ ID NO. 761~SEQ ID NO. 766, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR10 protein as shown in SEQ ID NO. 767~SEQ ID NO. 772, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR11 protein as shown in SEQ ID NO. 773~SEQ ID NO. 778, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR12 protein as shown in SEQ ID NO. 779~SEQ ID NO. 784, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR2A protein as shown in SEQ ID NO. 785~SEQ ID NO. 790, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR2B protein as shown in SEQ ID NO. 791~SEQ ID NO. 796, 3 pairs of double connection probes targeting the nucleotide sequence of the gene encoding CCR3 protein as shown in SEQ ID NO. 797~SEQ ID NO. 802, 3 pairs of double554, the nucleotide sequences of the 3 pairs of double connection probes targeting the gene encoding the CEACAM8 protein are as shown in SEQ ID NO. 555 to SEQ ID NO. 560, the nucleotide sequences of the 8 pairs of double connection probes targeting the gene encoding the FCGR3B protein are as shown in SEQ ID NO. 561 to SEQ ID NO. 576, the nucleotide sequences of the 3 pairs of double connection probes targeting the gene encoding the STK11 protein are as shown in SEQ ID NO. 577 to SEQ ID NO. 582, the nucleotide sequences of the 3 pairs of double connection probes targeting the gene encoding the MYBL2 protein are as shown in SEQ ID NO. 583 to SEQ ID NO. 588, the nucleotide sequences of the 3 pairs of double connection probes targeting the gene encoding the ZNF423 protein are as shown in SEQ ID NO. 589 to SEQ ID NO. 594, the nucleotide sequences of the 3 pairs of double connection probes targeting the gene encoding the TJP3 protein are as shown in SEQ ID NO. 595 to SEQ ID NO. 600, the nucleotide sequences of the 3 pairs of double connection probes targeting the gene encoding the APC protein are as shown in SEQ ID NO. 601 to SEQ ID NO. 606, the nucleotide sequences of the 3 pairs of double connection probes targeting the gene encoding the KEAP1 protein are as shown in SEQ ID NO. 607 to SEQ ID NO. 612, the nucleotide sequences of the 3 pairs of double connection probes targeting the gene encoding the CD47 protein are as shown in SEQ ID NO. 613 to SEQ ID NO. 618, the nucleotide sequences of the 8 pairs of double connection probes targeting the gene encoding the CD274 protein are as shown in SEQ ID NO. 619 to SEQ ID NO. 634, the nucleotide sequences of the 8 pairs of double connection probes targeting the gene encoding the PDCD1LG2 protein are as shown in SEQ ID NO. 635 to SEQ ID NO. 650, the nucleotide sequences of the 8 pairs of double connection probes targeting the gene encoding the LAG3 protein are as shown in SEQ ID NO. 651 to SEQ ID NO. 666, the nucleotide sequences of the 8 pairs of double connection probes targeting the gene encoding the HAVCR2 protein are as shown in SEQ ID NO. 667 to SEQ ID NO. 682, the nucleotide sequences of the 8 pairs of double connection probes targeting the gene encoding the PDCD1 protein are as shown in SEQ ID NO. 683 to SEQ ID NO. 698, the nucleotide sequences of the 8 pairs of double connection probes targeting the gene encoding the CDH1 protein are as shown in SEQ ID NO. 699 to SEQ ID NO. 704, the nucleotide sequences of the 3 pairs of double connection probes targeting the gene encoding the CSMD1 protein are as shown in SEQ ID NO. 705 to SEQ ID NO.710 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the GLTPD2 protein, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the L1TD1 protein as shown in SEQ ID NO. 717 to SEQ ID NO. 722, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the TDO2 protein as shown in SEQ ID NO. 723 to SEQ ID NO. 728, 8 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the LOXL2 protein as shown in SEQ ID NO. 729 to SEQ ID NO. 744, 10 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the MKI67 protein as shown in SEQ ID NO. 745 to SEQ ID NO. 764, 6 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the TWIST2 protein as shown in SEQ ID NO. 765 to SEQ ID NO. 776, 5 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the PPIB protein as shown in SEQ ID NO. 777 to SEQ ID NO. 786, 5 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the DAPB protein as shown in SEQ ID NO. 787 to SEQ ID NO. 796, 5 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the UBC protein as shown in SEQ ID NO. 797 to SEQ ID NO. 806, 6 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CCNE1 protein as shown in SEQ ID NO. 807 to SEQ ID NO. 818, 7 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CCNB1 protein as shown in SEQ ID NO. 819 to SEQ ID NO. 832, 8 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the MYBL2 protein as shown in SEQ ID NO. 833 to SEQ ID NO. 848, 7 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the STK15 protein as shown in SEQ ID NO. 849 to SEQ ID NO. 862, 8 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the BTLA protein as shown in SEQ ID NO. 863 to SEQ ID NO. 878, 8 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the VSIR protein as shown in SEQ ID NO. 879 to SEQ ID NO. 894, 6 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD160 protein as shown in SEQ ID NO. 895 to SEQ ID NO. 906, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD244 protein as shown in SEQ ID NO. 907 to SEQ ID NO. 918, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD2 protein as shown in SEQ ID NO. 919 to SEQ ID NO. 930, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD3D protein as shown in SEQ ID NO. 931 to SEQ ID NO. 942, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD3E protein as shown in SEQ ID NO. 943 to SEQ ID NO. 954, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD3G protein as shown in SEQ ID NO. 955 to SEQ ID NO. 966, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD4 protein as shown in SEQ ID NO. 967 to SEQ ID NO. 978, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD5 protein as shown in SEQ ID NO. 979 to SEQ ID NO. 990, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD8A protein as shown in SEQ ID NO. 991 to SEQ ID NO. 1002, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD8B protein as shown in SEQ ID NO. 1003 to SEQ ID NO. 1014, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD79A protein as shown in SEQ ID NO. 1015 to SEQ ID NO. 1026, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD79B protein as shown in SEQ ID NO. 1027 to SEQ ID NO. 1038, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD80 protein as shown in SEQ ID NO. 1039 to SEQ ID NO. 1050, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD86 protein as shown in SEQ ID NO. 1051 to SEQ ID NO. 1062, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD28 protein as shown in SEQ ID NO. 1063 to SEQ ID NO. 1074, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD40 protein as shown in SEQ ID NO. 1075 to SEQ ID NO. 1086, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD69 protein as shown in SEQ ID NO. 1087 to SEQ ID NO. 1098, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CD94 protein as shown in SEQ ID NO. 1099 to SEQ ID NO. 1110, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the CTLA4 protein as shown in SEQ ID NO. 1111 to SEQ ID NO. 1122, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the ICOS protein as shown in SEQ ID NO. 1123 to SEQ ID NO. 1134, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the NKG2A protein as shown in SEQ ID NO. 1135 to SEQ ID NO. 1146, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the NKG2B protein as shown in SEQ ID NO. 1147 to SEQ ID NO. 1158, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the NKG2C protein as shown in SEQ ID NO. 1159 to SEQ ID NO. 1170, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the NKG2D protein as shown in SEQ ID NO. 1171 to SEQ ID NO. 1182, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the NKG2E protein as shown in SEQ ID NO. 1183 to SEQ ID NO. 1194, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the NKG2F protein as shown in SEQ ID NO. 1195 to SEQ ID NO. 1206, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the NKG2H protein as shown in SEQ ID NO. 1207 to SEQ ID NO. 1218, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the PDCD1 protein as shown in SEQ ID NO. 1219 to SEQ ID NO. 1230, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the PTPRC protein as shown in SEQ ID NO. 1231 to SEQ ID NO. 1242, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the PTPRCPTPRA protein as shown in SEQ ID NO. 1243 to SEQ ID NO. 1254, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the PTPRCPTPRB protein as shown in SEQ ID NO. 1255 to SEQ ID NO. 1266, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the PTPRCPTPRC protein as shown in SEQ ID NO. 1267 to SEQ ID NO. 1278, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the PTPRCPTPRD protein as shown in SEQ ID NO. 1279 to SEQ ID NO. 1290, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the PTPRCPTPRES protein as shown in SEQ ID NO. 1291 to SEQ ID NO. 1302, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the PTPRCPTPRF protein as shown in SEQ ID NO. 1303 to SEQ ID NO. 1314, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the PTPRCPTPRG protein as shown in SEQ ID NO. 1315 to SEQ ID NO. 1326, 3 pairs of double connected probe pairs targeting nucleotide sequences of the gene encoding the PTPRCPTPRH protein as shown in SEQ ID NO. 1327 to SEQ ID NO. 1338, 3 pairs of double connected probe pairs targeting nuclenucleotide sequences of the genes encoding the IDO1 protein are shown as SEQ ID NO. 923 to SEQ ID NO. 936, the nucleotide sequences of the genes encoding the TGFB1 protein are shown as SEQ ID NO. 937 to SEQ ID NO. 952, the nucleotide sequences of the genes encoding the EPCAM protein are shown as SEQ ID NO. 953 to SEQ ID NO. 966, the nucleotide sequences of the genes encoding the TP63 protein are shown as SEQ ID NO. 967 to SEQ ID NO. 982, the nucleotide sequences of the genes encoding the PRF1 protein are shown as SEQ ID NO. 983 to SEQ ID NO. 998, the nucleotide sequences of the genes encoding the CTLA4 protein are shown as SEQ ID NO. 999 to SEQ ID NO. 1010, the nucleotide sequences of the genes encoding the MMP11 protein are shown as SEQ ID NO. 1011 to SEQ ID NO. 1026, the nucleotide sequences of the genes encoding the IFNG protein are shown as SEQ ID NO. 1027 to SEQ ID NO. 1036, the nucleotide sequences of the genes encoding the IL6 protein are shown as SEQ ID NO. 1037 to SEQ ID NO. 1046, the nucleotide sequences of the genes encoding the EOMES protein are shown as SEQ ID NO. 1047 to SEQ ID NO. 1062, the nucleotide sequences of the genes encoding the CD11c protein are shown as SEQ ID NO. 1063 to SEQ ID NO. 1076, the nucleotide sequences of the genes encoding the CD14 protein are shown as SEQ ID NO. 1077 to SEQ ID NO. 1090, the nucleotide sequences of the genes encoding the PTPRC protein are shown as SEQ ID NO. 1091 to SEQ ID NO. 1106, the nucleotide sequences of the genes encoding the SNAI2 protein are shown as SEQ ID NO. 1107 to SEQ ID NO. 1120, the nucleotide sequences of the genes encoding the SNAI1 protein are shown as SEQ ID NO. 1121 to SEQ ID NO. 1134, the nucleotide sequences of the genes encoding the ICOS protein are shown as SEQ ID NO. 1135 to SEQ ID NO.1150, 8 pairs of double ligation probe pairs targeting the nucleotide sequence of the gene encoding HLA-A protein as shown in SEQ ID NO. 1151 to SEQ ID NO. 1156, 3 pairs of double ligation probe pairs targeting the nucleotide sequence of the gene encoding HLA-C protein as shown in SEQ ID NO. 1157 to SEQ ID NO. 1166, 7 pairs of double ligation probe pairs targeting the nucleotide sequence of the gene encoding TTF1 protein as shown in SEQ ID NO. 1167 to SEQ ID NO. 1180, 8 pairs of double ligation probe pairs targeting the nucleotide sequence of the gene encoding CD28 protein as shown in SEQ ID NO. 1181 to SEQ ID NO. 1196, 7 pairs of double ligation probe pairs targeting the nucleotide sequence of the gene encoding CD40 protein as shown in SEQ ID NO. 1197 to SEQ ID NO. 1210, and nucleotide sequences of the gene encoding TWIST1 protein as shown in SEQ ID NO. 1121 to SEQ ID NO. SEQ ID NO. 1222, 6 pairs of double ligation probe pairs targeting the nucleotide sequence of the gene encoding NKG7 protein as shown in SEQ ID NO. 1123 to SEQ ID NO. 1232, 5 pairs of double ligation probe pairs targeting the nucleotide sequence of the gene encoding NCR1 protein as shown in SEQ ID NO. 1233 to SEQ ID NO. 1242, 8 pairs of double ligation probe pairs targeting the nucleotide sequence of the gene encoding ITK protein as shown in SEQ ID NO. 1243 to SEQ ID NO. 1258, 8 pairs of double ligation probe pairs targeting the nucleotide sequence of the gene encoding IL1B protein as shown in SEQ ID NO. 1259 to SEQ ID NO. 1274, 8 pairs of double ligation probe pairs targeting the nucleotide sequence of the gene encoding CD40LG protein as shown in SEQ ID NO. 1275 to SEQ ID NO. 1290, 8 pairs of double ligation probe pairs targeting the nucleotide sequence of the gene encoding TNF protein as shown in SEQ ID NO. 1291 to SEQ ID NO. SEQ ID NO. 1306, 5 pairs of double ligation probe pairs targeting the nucleotide sequence of the gene encoding IFNB1 protein as shown in SEQ ID NO. 1307 to SEQ ID NO. 1316, 7 pairs of double ligation probe pairs targeting the nucleotide sequence of the gene encoding CCL22 protein as shown in SEQ ID NO. 1317 to SEQ ID NO. 1330, 7 pairs of double ligation probe pairs targeting the nucleotide sequence of the gene encoding CXCR1 protein as shown in SEQ ID NO. 1331 to SEQ ID NO. 1344, 7 pairs of double ligation probe pairs targeting the nucleotide sequence of the gene encoding PGLYRP1 protein as shown in SEQ ID NO. 1345 to SEQ ID NO.1352the nucleotide sequence of the gene encoding the CXCL8 protein is shown as SEQ ID NO. 1353-SEQ ID NO. 1364, the nucleotide sequence of the gene encoding the ARG1 protein is shown as SEQ ID NO. 1365-SEQ ID NO. 1376, the nucleotide sequence of the gene encoding the MSR1 protein is shown as SEQ ID NO. 1377-SEQ ID NO. 1392, the nucleotide sequence of the gene encoding the CDH5 protein is shown as SEQ ID NO. 1393-SEQ ID NO. 1408, the nucleotide sequence of the gene encoding the CLEC14A protein is shown as SEQ ID NO. 1409-SEQ ID NO. 1424, the nucleotide sequence of the gene encoding the MPO protein is shown as SEQ ID NO. 1425-SEQ ID NO. 1436, the nucleotide sequence of the gene encoding the CD94 protein is shown as SEQ ID NO. 1437-SEQ ID NO. 1452, the nucleotide sequence of the gene encoding the CD117 protein is shown as SEQ ID NO. 1453-SEQ ID NO. 1468, and / or the nucleotide sequence of the gene encoding the CD79A protein is shown as SEQ ID NO. 1469-SEQ ID NO. 1478.

6. The test kit according to any one of claims 3 to 5, characterized in that The dual-ligation probe ligation reagent comprises a DNA ligase; the DNA ligase can ligate the upstream tag sequence and the downstream tag sequence in the pair of dual-ligation probes to form a ligation product.

7. The test kit according to any one of claims 3 to 6, characterized in that The dual-ligation probe circularization reagent comprises a DNA ligase and a rolling circle amplification primer; the DNA ligase can ligate the gap formed by the free two ends of the ligation product approaching each other according to base complementary pairing under the action of the rolling circle amplification primer to form a circularization product.

8. The test kit according to any one of claims 3 to 7, characterized in that The rolling circle amplification reagent comprises dNTPs and a DNA polymerase; the dNTPs can perform rolling circle amplification on the circularization product under the action of the DNA polymerase to form a rolling circle amplification product.

9. A method of detecting a nucleic acid, characterized by, The method is not for the purpose of disease diagnosis and treatment, and the detection method uses the above-mentioned detection kit for nucleic acid detection on a sample to be tested.

10. Use of the molecular marker according to claim 1 or 2 or the detection kit according to claim or the nucleic acid detection method according to claim in nucleic acid detection, characterized in that, The application is not for the purpose of disease diagnosis and treatment.

Images