NA-based autophagy targeting chimera as well as preparation method and application thereof

Abstract

The invention discloses an autophagy targeting chimera based on NA as well as a preparation method and application of the autophagy targeting chimera. The autophagy targeting chimera is prepared from the following raw materials: FBnG, N-acetylneuraminic acid, benzotriazole-1-yl-oxytripyrrolidyl phosphorus hexafluorophosphate, triethylamine and N, N-dimethylformamide, the mass ratio of FBnG to N-acetylneuraminic acid to benzotriazole-1-yl-oxytripyrrolidyl phosphorus hexafluorophosphate to triethylamine is (8-12): (4-6): (10-15): (4-6), the mass ratio of FBnG to N, N-dimethylformamide is (8-12): (4-6): (10-15): (4-6), and the mass ratio of FBnG to N, N-dimethylformamide is (8-12): (4-6): (10-15): (4-6). The mass-to-volume ratio of the N, N-dimethylformamide is (23.1-26.05): (0.5-1) mg / mL. The autophagy targeting chimera provided by the invention has high affinity binding force to NA protein, and can be degraded through a cell autophagy system.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to an autophagy-targeting chimera based on NA, its preparation method, and its application. Background Technology

[0002] Neuraminidase (NA) is a key virulence factor in *Glaesserella parasuis* (GPS), mediating its adhesion, invasion, and immune evasion. Traditional antibiotic therapies are often ineffective due to increasing drug resistance, necessitating innovative treatment strategies. Targeted protein degradation technologies (such as PROTAC and AUTAC) have become a hot topic in novel drug design in recent years. Autophagy-targeted chimeras (AUTAC) achieve selective degradation by delivering target proteins to the autophagosome-lysosome system.

[0003] Existing technologies face challenges in treating drug-resistant bacterial infections, including strong drug resistance, poor target selectivity, and significant toxic side effects. In particular, there is a lack of degradation technologies specifically targeting bacterial virulence factors. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a NA-based autophagy-targeting chimera, its preparation method, and its applications. This invention designs a NA-targeting AUTAC molecule by using Neu5Ac as the targeting head and combining it with an autophagy-inducing domain. This molecule can specifically bind to and degrade the virulence factor NA of GPS, and target intracellular GPS, promoting host cell recognition and degradation. This multi-dimensional synergistic approach combats drug-resistant bacteria and compensates for the deficiencies of traditional antibacterial strategies.

[0005] To achieve the above objectives, the technical solution designed by the present invention is as follows: This invention provides an autophagy-targeting chimera based on NA, wherein the raw materials of the autophagy-targeting chimera include FBnG, N-acetylneuraminic acid, benzotriazol-1-yl-oxytripyrrolidine phosphorus hexafluorophosphate, triethylamine, and N,N-dimethylformamide, wherein the mass ratio of FBnG, N-acetylneuraminic acid, benzotriazol-1-yl-oxytripyrrolidine phosphorus hexafluorophosphate, and triethylamine is 8~12∶4~6∶10~15∶4~6, and the mass-to-volume ratio of FBnG and N,N-dimethylformamide is 23.1~26.05∶0.5~1 mg / mL.

[0006] Furthermore, the mass ratio of FBnG, N-acetylneuraminic acid, benzotriazol-1-yl-oxytripyrrolidinephosphine hexafluorophosphate and triethylamine is 10.06:5:12.62:4.9, and the mass-to-volume ratio of FBnG and N,N-dimethylformamide is 25.15:1 mg / mL.

[0007] Furthermore, the target gene of the autophagy-targeting chimera is NA, and its nucleotide sequence is shown in SEQ ID NO: 1.

[0008] The present invention also provides a method for preparing the autophagy-targeting chimera, comprising the following steps: (1) Weigh FBnG, N-acetylneuraminic acid, benzotriazol-1-yl-oxytripyrrolidinylphosphine and triethylamine according to the mass ratio, and measure N,N-dimethylformamide according to the mass-volume ratio; (2) Dissolve the weighed FBnG and N-acetylneuraminic acid in the measured N,N-dimethylformamide, add benzotriazol-1-yl-oxytripyrrolidinephosphine hexafluorophosphate and triethylamine, and stir; (3) Add water to the stirred solution and extract with ethyl acetate; (4) The extracted organic phase is washed with brine, dried with sodium sulfate, filtered to obtain an organic solution, and concentrated under reduced pressure to obtain the residue; (5) The residue was purified by HPLC and then freeze-dried to obtain the pure product, namely the NA-based autophagy-targeting chimera.

[0009] Furthermore, in step (2), the stirring time is 2 to 2.5 hours.

[0010] Furthermore, in step (3), the volume ratio of N,N-dimethylformamide, water and ethyl acetate is 1:5~5.5:5~5.5, and the extraction is performed 3 times.

[0011] Furthermore, the purification conditions were as follows: the chromatographic column used was a WePure Biotech XP tC18 150×40×10μm; mobile phase A was 10 mM NH4HCO3 solution, and mobile phase B was acetonitrile; the mobile phase B was increased from 5.0% to 35.0% within 8.00 minutes at a flow rate of 60.0 mL / min; and the detection wavelengths were 220 nm and 254 nm.

[0012] The present invention also provides the use of the autophagy-targeting chimera described above in the preparation of a medicament for treating diseases caused by Glasgow Coccidia suis.

[0013] The present invention also provides a medicament for treating diseases caused by *Glassonella suis*, the medicament comprising the autophagy-targeting chimera described above.

[0014] The present invention also provides the use of the aforementioned drug in treating diseases caused by *Glassella suis*.

[0015] The beneficial effects of this invention are: Compared with the prior art, the present invention has the following advantages: (1) The AUTAC strategy was introduced for the first time in the targeted degradation of bacterial virulence factors, providing a new approach to anti-infection; (2) NA-AUTAC has a high affinity for NA proteins and can degrade them through the autophagy system; (3) It significantly reduces the selection pressure on bacteria as a whole, which is expected to reduce the risk of drug-resistant mutations; (4) This invention provides a molecular design and evaluation platform with well-defined structure and clear functional verification, opening up a new path for the development of anti-infective drugs. Attached Figure Description

[0016] Figure 1 A schematic diagram of the synthetic route for NA-AUTAC; Figure 2 The 1H NMR structural characterization spectrum of NA-AUTAC; Figure 3 The 19F NMR structure characterization spectrum of NA-AUTAC; Figure 4 MS spectrum of NA-AUTAC; Figure 5 The HPLC purity spectrum of NA-AUTAC; Figure 6 This is a diagram showing the docking of Neu5Ac with NA molecules. Figure 7 Diagram of the pEGFP-NA cloning vector; Figure 8 Figure showing the optimized pEGFP-NA transfection ratio; In the figure, the control plasmid is the pEGFP vector without the NA gene, and the recombinant plasmid is pEGFP-NA; Figure 9 This is a diagram showing the expression and transfection verification of pEGFP-NA; Figure 10 Fluorescence image showing changes in NA protein expression after NA-AUTAC treatment of cells. Detailed Implementation

[0017] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0018] Example 1 Preparation of NA-based autophagy-targeting chimeras 1. Weigh 50.3 mg FBnG (a component of nonribosomal peptide synthase / polyketide synthase (NRPS / PKS), 80.8 μmol, 1 eq), 25 mg N-acetylneuraminic acid (Neu5Ac, 80.8 μmol, 1 eq), 63.1 mg benzotriazol-1-yl-oxytripyrrolidinephosphine hexafluorophosphate (PyBOP, 121 μmol, 1.5 eq), and 24.5 mg triethylamine (TEA, 243 μmol, 33.8 μL, 3 eq), and measure 2 mL of N,N-dimethylformamide (DMF).

[0019] 2. Dissolve the weighed FBnG and Neu5Ac in the measured DMF, add the weighed PyBOP and triethylamine, and stir the reaction at room temperature for 2 hours. LC-MS analysis showed that FBnG was completely consumed and a major peak was observed, consistent with the target m / z.

[0020] 3. Add 10 mL of pure water to the above reaction solution, and then extract with 10 mL of ethyl acetate. Extract for a total of 3 times, with 10 mL of ethyl acetate used each time.

[0021] 4. After extraction, combine the organic phases, wash the organic phases with 5 mL of brine, dry the organic phases with 100 mg of Na2SO4, filter to remove the water-absorbed Na2SO4, obtain an organic solution, and concentrate under reduced pressure to obtain the residue.

[0022] 5. The residue was purified by HPLC (neutral conditions). A WePure Biotech XP tC18 column (150×40×10μm) was used; mobile phase A was water (containing 10 mM NH4HCO3), and mobile phase B was acetonitrile; the concentration of mobile phase B increased from 5.0% to 35.0% in 8.00 min at a flow rate of 60.0 mL / min; detection wavelengths were 220 and 254 nm. The purified compound was then freeze-dried to obtain the pure target compound, namely the NA-based autophagy-targeting chimeric compound (NA-AUTAC).

[0023] Example 2 Structural characterization of NA-based autophagy-targeting chimeras The NA-AUTAC prepared in Example 1 was characterized by 1H NMR, 19F NMR, MS, and HPLC to ensure that its purity and molecular structure conformed to the design. The analytical conditions were as follows: 1H NMR (400MHz, DMSO-d6) δ 8.13 (d, J = 7.6 Hz, 1H), 7.73 - 7.70 (m,3H), 7.26 - 7.23 (m, 2H), 7.15 - 7.11 (m, 2H), 6.32 (br s, 2H), 5.11 (s, 2H),4.50 - 3.88 (m, 6H), 3.66 (m, 2H), 3.53 - 3.25 (m, 19H), 3.20 - 3.05 (m, 5H),2.10 - 2.00 (m, 1H), 1.88 (s, 3H), 1.86 (s, 3H), 1.71 - 1.65 (m, 4H), 1.47 -1.37 (m, 1H); 19F NMR (400 MHz, DMSO-d6) δ-114.922 (s, 1H); MS (ESI) m / z = 914.3 [M+H] +; HPLC retention time: RT = 2.324 min.

[0024] The results are as follows Figures 2-5 As shown, the structure was characterized by 1H NMR, 19F NMR and HPLC-MS analysis to ensure that the purity and molecular structure of NA-AUTAC conform to the design.

[0025] Example 3 Functional verification of NA-based autophagy-targeting chimeras 1. The binding energy of NA and Neu5Ac was simulated using molecular docking (ΔG = -6.783 kcal / mol), and the results are as follows: Figure 6 As shown, NA and Neu5Ac can bind stably.

[0026] 2. The construction method of the pEGFP-NA fusion expression vector is as follows (pEGFP-NA cloning vector is as follows). Figure 7 (as shown) (1) The NA gene fragment was amplified by PCR using the genome of *Glassella suis* SH0165 (GenBank: CP001321.1) as a template and primers NA-F / R (containing EcoRI / XbaRI restriction sites): 50 μL system: 25 μL 2×Phanta MaxMaster Mix, 1 μL genomic DNA, 2 μL primers each; program: 95℃ pre-denaturation for 5 min followed by 25 cycles (95℃ 10 s, 55℃ 15 s, 72℃ 90 s). The amplified product was verified by 0.8% agarose gel electrophoresis and then purified. The nucleotide sequence of the amplified NA gene is shown in SEQ ID NO: 1, and the nucleotide sequence of primers NA-F / R is as follows: NA-F: TCGAGCTCAAGCTTCGAATTCGATGAAAAGAAGATTATCTAAAAAATGTTAAATG; NA-R: GATTATGATCAGTTATCTAGATTACCAAGTATAACTGATATCTACACCTAAATT.

[0027] (2) The eukaryotic expression vector pEGFP was linearized and purified by double digestion with EcoRI / XbaRI (37℃ for 2 h), and ligated with the target fragment using the ClonExpress II cloning kit (20 μL system: 4 μL vector, 2 μL NA gene fragment, 4 μL 5×CE II Buffer and 2 μL Exnase II), and reacted at 37℃ for 30 min. The ligation product was transformed into E. coli DH5α competent cells and incubated on ice for 30 min, followed by heat shock at 42℃ for 45 s. After recovery in SOC medium for 1 h, the cells were plated on LB agar plates containing 50 μg / mL kanamycin and cultured at 37℃ for 12–16 h. Positive clones were screened by bacterial PCR and then sequenced for verification. The sequencing confirmed the correct clones, and cells containing the correct pEGFP-NA fusion expression vector were obtained. Plasmid DNA was extracted from the cells.

[0028] Lipo3000 and the extracted plasmid DNA were mixed in different ratios, and the mixtures were incubated with 293T cells. The amount of DNA transfected varied depending on the ratio. The amount of DNA transfected at different ratios was measured, and the results are as follows: Figure 8 and Figure 9 As shown, when the ratio is 2:100 (Lipo3000:DNA), the DNA transfection ratio is the highest, which is the optimal transfection ratio, and the maximum protein expression is obtained during the 24-hour observation period.

[0029] Using the above transfection ratio, plasmid DNA and Lipo3000 were mixed and incubated with 293T cells to obtain transfected cells with a cell density of 70%~90%.

[0030] 3. The NA-AUTAC prepared in Example 1 was used to prepare NA-AUTAC solutions of different concentrations. The NA-AUTAC solutions of different concentrations were incubated with the transfected cells obtained in step 2 at a volume ratio of 1:500. The results are as follows: Figure 10 As shown, when cells were treated with 40 μM NA-AUTAC, the expression level of NA protein decreased significantly, indicating that NA-AUTAC molecules have the ability to target and degrade NA.

[0031] Example 4 A drug for treating diseases caused by Gracilaria suis, wherein the drug of this embodiment comprises the NA-based autophagy-targeting chimera prepared in Example 1, wherein the concentration of the NA-based autophagy-targeting chimera is 5-40 μM.

[0032] Example 5 The drug from Example 4 and the transfected cells obtained in Example 3 were incubated at a volume ratio of 1:500. The NA product produced by the transfected cells after expression of the NA gene was fluorescent. After the transfected cells were incubated with the drug, the fluorescence weakened, indicating that the NA was degraded and the drug had a therapeutic effect.

[0033] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A NA-based autophagy-targeting chimera, characterized in that: The raw materials for the autophagy-targeting chimera include FBnG, N-acetylneuraminic acid, benzotriazol-1-yl-oxytripyrrolidine phosphorus hexafluorophosphate, triethylamine, and N,N-dimethylformamide. The mass ratio of FBnG, N-acetylneuraminic acid, benzotriazol-1-yl-oxytripyrrolidine phosphorus hexafluorophosphate, and triethylamine is 8~12∶4~6∶10~15∶4~6, and the mass-to-volume ratio of FBnG and N,N-dimethylformamide is 23.1~26.05∶0.5~1 mg / mL.

2. The autophagy-targeting chimera according to claim 1, characterized in that: The mass ratio of FBnG, N-acetylneuraminic acid, benzotriazol-1-yl-oxytripyrrolidinephosphine hexafluorophosphate and triethylamine is 10.06:5:12.62:4.9, and the mass-to-volume ratio of FBnG and N,N-dimethylformamide is 25.15:1 mg / mL.

3. The autophagy-targeting chimera according to claim 1, characterized in that: The target gene of the autophagy-targeting chimera is NA, and its nucleotide sequence is shown in SEQ ID NO:

1.

4. A method for preparing the autophagy-targeting chimera according to claim 1, characterized in that: The following steps are involved: (1) Weigh FBnG, N-acetylneuraminic acid, benzotriazol-1-yl-oxytripyrrolidinylphosphine and triethylamine according to the mass ratio, and measure N,N-dimethylformamide according to the mass-volume ratio; (2) Dissolve the weighed FBnG and N-acetylneuraminic acid in the measured N,N-dimethylformamide, add benzotriazol-1-yl-oxytripyrrolidinephosphine hexafluorophosphate and triethylamine, and stir; (3) Add water to the stirred solution and extract with ethyl acetate; (4) The extracted organic phase is washed with brine, dried with sodium sulfate, filtered to obtain an organic solution, and concentrated under reduced pressure to obtain the residue; (5) The residue was purified by HPLC and then freeze-dried to obtain the pure product, namely the NA-based autophagy-targeting chimera.

5. The preparation method according to claim 4, characterized in that: In step (2), the stirring time is 2 to 2.5 hours.

6. The preparation method according to claim 4, characterized in that: In step (3), the volume ratio of N,N-dimethylformamide, water and ethyl acetate is 1:5~5.5:5~5.5, and the extraction is performed 3 times.

7. The preparation method according to claim 4, characterized in that: The purification conditions were as follows: the chromatographic column used was a WePure Biotech XP tC18 150×40×10μm; mobile phase A was 10 mM NH4HCO3 solution, and mobile phase B was acetonitrile; the mobile phase B was increased from 5.0% to 35.0% in 8.00 minutes at a flow rate of 60.0 mL / min; and the detection wavelengths were 220 nm and 254 nm.

8. The use of the autophagy-targeting chimera of claim 1 in the preparation of a medicament for treating diseases caused by Glasgow Cocci.

9. A drug for treating diseases caused by *Glassonella suis*, characterized in that: The drug comprises the autophagy-targeting chimera as described in claim 1.

10. The use of the medicament of claim 9 in the treatment of diseases caused by Glasgow Coleus.

Images