Aspergillus japonicus and uses thereof

By using the metabolites of Aspergillus japonicus to contact rare earth elements, the problems of environmental pollution and high cost in rare earth extraction have been solved, achieving highly selective leaching and low-cost rare earth recovery. This method is suitable for the efficient recovery of ion-adsorption rare earth ores, rare earth tailings, and rare earth waste.

CN120843302BActive Publication Date: 2025-12-05TSINGHUA UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511349060.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-22
Publication Date
2025-12-05
Estimated Expiration
2045-09-22

AI Technical Summary

Technical Problem

Existing rare earth extraction technologies suffer from serious environmental pollution, high costs, and poor selectivity. They are particularly disadvantageous in processing low-grade rare earth waste, and traditional chemical leaching methods damage the ecological environment of mining areas and surrounding areas.

Method used

Using Aspergillus japonicus as the microorganism for leaching rare earth elements, the rare earth elements are leached by contacting their metabolic products with the rare earth elements. By controlling conditions such as pH value and solid-liquid ratio, highly selective leaching of rare earth elements is achieved, avoiding the use of strong acids and alkalis and other chemicals. Starch, dextrin and other carbon sources are used, and corn steep liquor and other nitrogen sources are used to reduce production costs.

Benefits of technology

It achieves efficient recovery of rare earth elements, with a leaching rate of 85%-95% and a selectivity coefficient of more than 15:1 for impurity elements, reducing production costs, avoiding ammonia nitrogen pollution, and is suitable for industrial applications on a ton-scale basis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application provides an aspergillus japonicus Aspergillus japonicus ) and application thereof. The strain of the application is suitable for recycling and utilizing various rare earth resources such as ion type rare earth ore, rare earth tailings and rare earth waste, and has the advantages of green environmental protection, low cost and simple operation. The strain of the application can use starch, dextrin, sucrose and the like as carbon sources, and corn syrup, soybean meal and the like as nitrogen sources, so as to not only ensure the growth demand of the strain, but also reduce the production cost, thereby meeting the industrial application demand of leaching of rare earth elements.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of bio-metallurgy, and particularly relates to a Japanese Aspergillus and uses thereof. BACKGROUND

[0002] Rare earth elements (REEs) are indispensable strategic resources for modern industrial development, and their unique physical and chemical properties make them irreplaceable in many high-tech fields. This special material, which contains 15 lanthanide elements and 2 elements of scandium and yttrium, has become a key material for strategic industries such as optoelectronics, aerospace, and green energy due to its excellent magnetic properties, high melting point, and excellent catalytic performance. However, the development and utilization of rare earth resources face severe challenges: on the one hand, rare earth elements are widely distributed in the earth's crust but generally have low grades, making it difficult to achieve efficient extraction through traditional mining methods; on the other hand, global demand for rare earth resources continues to grow rapidly, and the supply-demand contradiction is becoming increasingly prominent.

[0003] China, as a major country in rare earth resources, has the world's most important rare earth deposits. Among them, the weathering crust eluvial type rare earth ore in the southern region is the main source of heavy rare earth resources in China, and this type of deposit has extremely high strategic value. At the same time, the tailings dam in the Baiyunebo area in the north is piled up with hundreds of millions of tons of light rare earth-containing waste slag. These underutilized secondary resources not only cause serious land occupation problems, but also pose a continuous pollution threat to the surrounding environment due to their long-term storage. Under this background, it is particularly important and urgent to develop efficient and low-cost rare earth extraction technologies, especially green leaching processes for ionic rare earth ores and tailings resources.

[0004] The chemical leaching method commonly used in industry, although the process is relatively mature and can achieve the dissolution and extraction of rare earth elements in a relatively short time, its inherent technical defects cannot be ignored. This method usually relies on strong acids, strong bases and other corrosive chemicals, and inevitably produces a large amount of wastewater and waste gas containing toxic and harmful substances during production, causing serious damage to the mine and surrounding ecological environment. More notably, traditional chemical leaching methods have obvious economic disadvantages when dealing with low-grade rare earth waste, and the high processing cost seriously restricts their application prospects in the utilization of tailings resources.

[0005] In contrast, microbial leaching technology exhibits unique technical advantages and environmental friendly characteristics. This method of using microbial metabolic activities such as bacteria or fungi to extract rare earth elements achieves selective dissolution of rare earth elements through the secretion of various active substances such as organic acids and iron carriers by microorganisms. The microbial leaching process has the remarkable characteristics of low energy consumption, good selectivity, and environmental friendliness, completely avoiding the use of dangerous chemicals such as strong acids and strong bases, and greatly reducing the risk of environmental pollution. In particular, it is worth noting that certain specific microbial strains can achieve high selectivity leaching of rare earth elements through their unique metabolic pathways, which can improve the recovery rate of target metals while effectively inhibiting the dissolution of impurity elements. Therefore, screening and cultivating high-performance leaching microbial strains and optimizing their culture and leaching process parameters have important practical significance for promoting the green and sustainable development of rare earth resources. SUMMARY

[0006] In order to overcome the technical defects of serious environmental pollution, high cost, and poor selectivity in existing rare earth extraction technologies, the present application provides a Japanese Aspergillus and its use.

[0007] Specifically, the present application relates to the following aspects:

[0008] An Aspergillus japonicus, which is deposited with the China General Microbiological Culture Collection Center and has a deposit number of CGMCC No. 41734.

[0009] Use of the above-mentioned Aspergillus japonicus in leaching rare earth elements.

[0010] Further, the rare earth elements are selected from one or more of La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu, Sc, and Y.

[0011] Further, the rare earth elements are from ionic rare earth ores or rare earth secondary resources.

[0012] A leaching method of rare earth elements, comprising using the above-mentioned Aspergillus japonicus to treat rare earth elements.

[0013] Further, the leaching method comprises contacting the culture or metabolites of the above-mentioned Aspergillus japonicus with raw materials containing rare earth elements to achieve leaching of rare earth elements.

[0014] Further, the rare earth elements are selected from one or more of La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu, Sc, and Y.

[0015] Further, the raw material containing rare earth elements is ion-type rare earth ore or rare earth secondary resources.

[0016] Further, when the culture or metabolite of the Aspergillus japonicus is contacted with the raw material containing rare earth elements, the pH of the reaction system is 4.0-6.0, the solid-liquid ratio is 1:1-1:50, and the contact time is 7-30 days.

[0017] Further, the preparation of the culture or metabolite of the Aspergillus japonicus comprises the following steps:

[0018] The spore suspension of the Aspergillus japonicus is inoculated into modified Czapek liquid medium, and cultured at 30°C and 220 rpm for 3-6 days to obtain a fermentation broth;

[0019] and the fermentation broth is optionally centrifuged to obtain a supernatant.

[0020] Advantages of the present application

[0021] The strain of the present application is suitable for efficient recovery of ion-type rare earth ore, rare earth tailings, rare earth waste and other rare earth resources. Experimental verification shows that the method has excellent leaching effect on ion-type rare earth ore (REE 0.03%-0.12%) in Jiangxi, Guangdong and Guangxi, and rare earth tailings and waste (REE 2.5%-25%) in Inner Mongolia and Jiangxi, with a leaching rate of 85%-95%, and a selectivity coefficient of impurity elements such as iron exceeding 15:1.

[0022] The strain of the present application can use starch, dextrin, sucrose and the like as carbon source, and corn syrup, soybean meal and the like as nitrogen source, completely avoiding ammonia nitrogen pollution, solving the environmental hazards of ion-type rare earth ore, ensuring the growth needs of the bacterial body, and reducing production cost, so as to meet the industrial application needs of rare earth element leaching.

[0023] The fermentation cost of the strain of the present application is low, and the fermentation process can be stably scaled up to ton-level scale. Therefore, the strain and method of the present application have significant industrial application value in the field of green rare earth mining and secondary resource recovery. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 The growth of the bacterial colonies on the screening plate is shown in Figure 1;

[0025] Figure 2 The phosphorus solubilization of the mycelium on the phosphorus solubilization medium is shown in Figure 2;

[0026] Figure 3 The phylogenetic tree of the strain is shown in Figure 3;

[0027] Figure 4 The leaching of rare earth elements and main impurities by the sterile fermentation supernatant and magnesium sulfate is shown in Figure 4;

[0028] Figure 5 Comparison of rare earth and main impurities leaching from bacteria-containing fermentation supernatant and magnesium sulfate;

[0029] Figure 6 Comparison of rare earth leaching from bacteria-containing fermentation supernatant and magnesium sulfate;

[0030] Figure 7 Comparison of rare earth leaching ability of bacteria-containing fermentation supernatant and industrial magnesium sulfate under different pH conditions;

[0031] Figure 8 Comparison of aluminum leaching ability of bacteria-containing fermentation supernatant and industrial magnesium sulfate under different pH conditions;

[0032] Figure 9 Comparison of calcium leaching ability of bacteria-containing fermentation supernatant and industrial magnesium sulfate under different pH conditions;

[0033] Figure 10 Relationship between rare earth leaching ability of bacteria-containing fermentation supernatant and time;

[0034] Figure 11 Comparison of rare earth and iron leaching ability of bacteria-containing fermentation supernatant and industrial magnesium sulfate;

[0035] Figure 12 Relationship between rare earth leaching ability of bacteria-containing fermentation supernatant and time; DETAILED DESCRIPTION

[0036] The application will be further described below in conjunction with examples. It should be understood that the examples are only used to further illustrate and explain the application, and are not used to limit the application.

[0037] Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the application, the preferred methods and materials are described below. However, in case of conflict, the patent specification, including that of definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. The application will be further described below in conjunction with specific examples, which are not intended to limit the scope of the application.

[0038] Based on the problems existing in the prior art, the present application provides a Japanese Aspergillus, which is classified and named as Aspergillus japonicus, and is preserved in the China General Microbiological Culture Collection Center (CGMCC) on December 24, 2024, with a preservation number of CGMCC No. 41734 and a preservation address of No. 3, Institute of Microbiology, Chinese Academy of Sciences, Beijing City, Chaoyang District, Beichen West Road 1st Courtyard, with a postal code of 100101.

[0039] The ITS DNA sequence of the Aspergillus japonicus is shown as SEQ ID NO. 1:

[0040] CCTGCGGAAGGATCATTACCGAGTGCTGGGTCCTTCGGGGCCCAACCTCCCACCCGTGCTTACCGTACCCTGTTGCTTCGGCGGGCCCGCCTTCGGGCGGCCCGGGGCCTGCCCCCGGGACCGCGCCCGCCGGAGACCCCAATGGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGATACCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTCCCCTCCAGCCCCGCTGGTTGTTGGGCCGCGCCCCCCCGGGGGCGGGCCTCGAGAGAAACGGCGGCGCCGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACCCGCTCTATGGGCCCGGCCGGGGCTTGCCTCGACCCCCAATCTTCTCAGATTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC

[0041] The strain of the present application can realize high selective leaching of various rare earth elements, and is suitable for efficient recovery of various rare earth resources such as ionic rare earth ore, rare earth tailings and rare earth waste.

[0042] The strain of the present application can use starch, dextrin, sucrose, etc. as carbon source, corn syrup, soybean meal, etc. as nitrogen source, completely avoiding ammonia nitrogen pollution, solving the environmental hazards of ionic rare earth ore, ensuring the growth needs of the bacterial body, and reducing the production cost, so as to meet the industrial application needs of leaching of rare earth elements.

[0043] The fermentation cost of the strain of the present application is low, and the fermentation process can be stably scaled up to ton-level scale. Therefore, the strain and method of the present application have significant industrial application value in the field of green rare earth mining and secondary resource recycling.

[0044] The present application also provides the use of the above-mentioned Aspergillus japonicus in leaching of rare earth elements.

[0045] Specifically, the culture or metabolic product of Aspergillus japonicus can be used to leach rare earth elements. For example, the fermentation broth of Aspergillus japonicus can be contacted with raw materials containing rare earth elements to leach rare earth elements, or the fermentation broth can be treated and then contacted with raw materials containing rare earth elements to leach rare earth elements. The treatment of the fermentation broth can include one or more of filtration, centrifugation, sterilization, etc.

[0046] The rare earth elements can cover various rare earth elements known in the art, such as La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu, Sc, YLa, Nd, Gd, Yb, Pr, Tb, Dy, etc.

[0047] These rare earth elements can come from various raw materials containing rare earth elements, for example, can be ionic rare earth ore or rare earth secondary resources. Among them, the ionic rare earth ore can be rare earth ore deposit from Jiangxi, Fujian, Guangdong or Guangxi. The rare earth secondary resources can be rare earth tailings or various waste containing rare earth, such as Baiyunebo rare earth tailings, iron smelting waste slag, residual waste slag after high-temperature roasting of rare earth ore, etc.

[0048] The present application also provides a leaching method of rare earth elements, comprising treating rare earth elements with the above-mentioned Aspergillus japonicus.

[0049] In some embodiments, the leaching method comprises contacting the culture or metabolic product of the above-mentioned Aspergillus japonicus with raw materials containing rare earth elements to achieve leaching of rare earth elements. For example, the fermentation broth of Aspergillus japonicus can be contacted with raw materials containing rare earth elements to leach rare earth elements, or the fermentation broth can be treated and then contacted with raw materials containing rare earth elements to leach rare earth elements. The treatment of the fermentation broth can include one or more of filtration, centrifugation, sterilization, etc.

[0050] The culture of Aspergillus japonicus can include mycelia of Aspergillus japonicus and metabolites. The metabolites include one or more than two of the following organic acids: citric acid, tartaric acid, malic acid, acetic acid, formic acid, fumaric acid, lactic acid, malic acid, oxalic acid. In some embodiments, the total organic acid concentration in the metabolites is 5-20 g / L.

[0051] The contact can be achieved by directly mixing the culture of Aspergillus japonicus or the metabolites with the raw material containing rare earth elements, or by loading the raw material containing rare earth elements into a column and spraying the culture or the metabolites to achieve the contact.

[0052] In some embodiments, when the culture of Aspergillus japonicus or the metabolites is contacted with the raw material containing rare earth elements, the pH of the reaction system is 4.0-6.0, the solid-liquid ratio is 1:1-1:50, and the contact time is 7-30 days.

[0053] In some embodiments, when the culture of Aspergillus japonicus or the metabolites is contacted with the raw material containing rare earth elements, the temperature of the reaction system is 20-30°C.

[0054] It is understood by those skilled in the art that the conditions for contacting the culture of Aspergillus japonicus or the metabolites with the raw material containing rare earth elements, i.e. the leaching conditions, can be adjusted according to different raw materials used.

[0055] In some embodiments, when the culture of Aspergillus japonicus or the metabolites is contacted with the ion-type rare earth ore, the pH of the reaction system is 5.0-5.5, the solid-liquid ratio is 1:1, and the contact time is 30 days.

[0056] In some embodiments, when the culture of Aspergillus japonicus or the metabolites is contacted with the rare earth tailings, the pH of the reaction system is 5.0, the solid-liquid ratio is 1:50, and the contact time is 7 days.

[0057] In some embodiments, the culture method of Aspergillus japonicus or the preparation of the culture or the metabolites of Aspergillus japonicus comprises the following steps:

[0058] The spore suspension of Aspergillus japonicus is inoculated into modified Czapek liquid medium, and cultured at 30°C and 220 rpm for 3-6 days to obtain a fermentation broth.

[0059] The obtained fermentation broth can be directly used for leaching of rare earth elements, or the fermentation broth can be centrifuged to obtain a supernatant, and the supernatant can be used for leaching of rare earth elements.

[0060] In some embodiments, the carbon source of the modified Czapek-Dox liquid medium is at least one of starch, dextrin, sucrose, glucose, fructose or maltose, and the nitrogen source is at least one of corn steep liquor, soybean meal, urea, nitrate or ammonium salt.

[0061] In some embodiments, the modified Czapek-Dox liquid medium comprises: sucrose 60 g / L, ammonium sulfate 1 g / L, magnesium sulfate 0.05 g / L, ferrous sulfate 0.0025 g / L, potassium dihydrogen phosphate 1 g / L, yeast extract 1 g / L, pH 6.0-6.5.

[0062] In some embodiments, the preparation of the metabolite of the Aspergillus japonicus comprises the following steps:

[0063] The spore suspension of the Aspergillus japonicus is inoculated into the modified Czapek-Dox liquid medium, and cultured at 30°C, 220 rpm for 3-6 days to obtain a fermentation broth;

[0064] The fermentation broth is filtered through non-woven cloth, and the supernatant is collected;

[0065] The supernatant is sterilized at high temperature or centrifuged at high speed (8000-10000 rpm, 10-15 min) to obtain a sterile metabolite.

[0066] In some embodiments, the preparation of the metabolite of the Aspergillus japonicus comprises the following steps:

[0067] The spore suspension of the Aspergillus japonicus is inoculated into the modified Czapek-Dox liquid medium, and cultured at 30°C, 220 rpm for 3-6 days to obtain a fermentation broth;

[0068] The fermentation broth is filtered through non-woven cloth, and the supernatant is collected to obtain a metabolite.

[0069] In some embodiments, the culture of the Aspergillus japonicus is ton-scale fermentation, and the control parameters during the fermentation process are as follows: dissolved oxygen 28%-32%, pH 4.0±0.1 (adjusted by automatic flow addition of sodium hydroxide), temperature 30°C, pressure 0.05 MPa, and fermentation time 3-4 days.

[0070] In some embodiments, the culture of the Aspergillus japonicus is ton-scale fermentation, and the consumption of sodium hydroxide is monitored in real time during the fermentation process. When the addition rate of sodium hydroxide tends to be flat, the carbon source is added to maintain the concentration of sucrose at 5-10 g / L. The feeding is stopped 6 hours before the end of the fermentation to induce the accumulation of secondary metabolites.

[0071] The rare earth elements in the leaching method and the types of raw materials containing rare earth elements are as described above for the use of Aspergillus japonicus in leaching rare earth elements.

[0072] Example

[0073] The materials used in the experiments and the experimental methods are generally and / or specifically described in this application. In the following examples, if not otherwise specified, wt% means weight percent. The reagents or instruments used are all commercially available conventional reagent products.

[0074] The formula of Czapek liquid medium used in the following examples is: sucrose 60 g / L, ammonium sulfate 3 g / L, magnesium sulfate 0.05 g / L, ferrous sulfate 0.0025 g / L, potassium dihydrogen phosphate 1 g / L, yeast extract 1 g / L, and the pH value is adjusted to 6.0-6.5 with sodium hydroxide.

[0075] Example 1 Strain source, screening and identification

[0076] The strain was isolated from the leaching solution of an ionic rare earth mine in Ganzhou. 200 microliters of the liquid was coated on PDA (potato dextrose broth medium), and then placed in a constant temperature and humidity (30 degrees, RT 50%) incubator for 2 days. Figure 1 Then using a sterile loop, a four-zone streaking method was used to select each different color of Aspergillus or bacteria monoclonal to new PDA medium, repeated at least three times. We isolated a total of 4 strains of bacteria and 2 strains of Aspergillus from the leaching solution, and used 16S or ITS sequences to identify the species of the 6 strains. The 6 strains were dropped on PVK phosphorus solubilizing medium and incubated at constant temperature for 3 days.

[0077] The strains were screened using phosphorus solubilizing medium solid plates. The strains that can produce obvious transparent rings on the phosphorus solubilizing solid medium plates were selected. Only one strain of Aspergillus among the 6 strains produced a huge transparent ring on the PVK medium, indicating that the strain has strong phosphorus solubilizing ability. Figure 2

[0078] The screened Aspergillus strain was identified by ITS species identification and phylogenetic tree analysis, and was determined to be Aspergillus, Aspergillus japonicus, named Aj-1. Figure 3

[0079] The ITS DNA sequence of the screened Aspergillus japonicus Aj-1 is shown in SEQ ID NO. 1:

[0080] ​​CCTGCGGAAGGATCATTACCGAGTGCTGGGTCCTTCGGGGCCCAACCTCCCACCCGTGCTTACCGTACCCTGTTGCTTCGGCGGGCCCGCCTTCGGGCGGCCCGGGGCCTGCCCCCGGGACCGCGCCCGCCGGAGACCCCAATGGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGATACCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTCCCCTCCAGCCCCGCTGGTTGTTGGGCCGCGCCCCCCCGGGGGCGGGCCTCGAGAGAAACGGCGGCGCCGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACCCGCTCTATGGGCCCGGCCGGGGCTTGCCTCGACCCCCAATCTTCTCAGATTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC

[0081] The strain obtained by the above screening was preserved in the China General Microbiological Culture Collection Center (CGMCC) on December 24, 2024, and was named Aspergillus japonicus, with the preservation number of CGMCC No. 41734. The preserved Aspergillus japonicus was used in the following examples.

[0082] Example 2

[0083] Pretreatment of weathered crust eluvial type rare earth ore (ion type rare earth ore): The soil 4-5 m deep in the mine was crushed, dried, and sieved to obtain soil below 2 mm. The sieved soil was packed into a column and compacted with a tool. The selected weathered crust eluvial type rare earth ore had a grade of 0.08%. The positive control selected 60 g / L magnesium sulfate aqueous solution, pH 4.8.

[0084] The 10 mL suspension was poured onto a solid plate covered with Aspergillus japonicus, and spores were gently scraped off with a disposable coating rod to obtain a spore suspension. 10 microliters of the spore suspension were added to 100 mL of modified Czapek Dox Broth Medium and cultured at 30°C, 220 rpm for 4 days. After non-woven fabric filtration, the bacterial-containing fermentation supernatant obtained was sterilized at 115°C for 20 min. Column leaching experiments were performed with the sterile fermentation supernatant, with a column inner diameter of 40 mm and 100 g of soil. During the leaching process, spraying can be recycled, and the leaching solution was collected after the leaching was completed. Subsequently, ICP-OES testing was performed, and the leaching rates of rare earth elements and impurities Al, Fe, and Ca in the ionic rare earth ore compared with the positive control are shown in Table 2. Figure 4

[0085] Among them, for ionic rare earth ore, the amount of rare earth elements leached by magnesium sulfate is usually taken as the total amount of rare earth ions that can be leached, and other impurity elements are the same. Specifically, the leaching rate refers to the leaching amount of the fermentation broth divided by the leaching amount of the magnesium sulfate aqueous solution.

[0086] Figure 4 The results show that the use of the strain of the present application can make the REE leaching rate exceed 95%, while still maintaining a low impurity leaching rate.

[0087] Example 3

[0088] The pretreatment of the weathered crust eluvial type rare earth ore is the same as that of Example 2.

[0089] The 10 mL suspension was poured onto a solid plate covered with Aspergillus japonicus, and spores were gently scraped off with a disposable coating rod to obtain a spore suspension. 10 microliters of the spore suspension were added to 100 mL of modified Czapek Dox Broth Medium and cultured at 30°C, 220 rpm for 4 days. After non-woven fabric filtration, the bacterial-containing fermentation supernatant obtained was sterilized at 115°C for 20 min. Column leaching experiments were performed with the sterile fermentation supernatant, with a column inner diameter of 40 mm and 100 g of soil. During the leaching process, spraying can be recycled, and the leaching solution was collected after the leaching was completed. Subsequently, ICP-OES testing was performed, and the leaching rates of rare earth elements and impurities Al, Fe, and Ca in the ionic rare earth ore compared with the positive control are shown in Table 2. Figure 5

[0090] The results show that compared with Example 2, Example 3 uses a simple filtered fermentation broth, even containing bacterial bodies, but still does not affect the leaching effect. The bacterial-containing fermentation broth of Example 3 does not need to be centrifuged, which is an economical way and suitable for engineering applications.

[0091] Example 4​​

[0092] The pretreatment of weathered crust elution-deposited rare earth ore and the preparation of spore suspension were the same as in Example 2.

[0093] A 900 L fermentation broth was prepared according to the formula of modified Czapek-Dox medium (the only difference from the modified Czapek-Dox medium is that it does not contain sucrose), wherein the seed tank was 100 L and the fermentation tank was 800 L. Sucrose was separately prepared into a 800 g / L mother liquor. All were sterilized by high-temperature steam at 120 °C for 30 min in situ online. After sterilization was completed, the fermentation broth was naturally cooled to room temperature to start inoculation. Inoculation was performed into the seed tank to a final spore concentration of 1 x 10 6 The pH of the fermentation broth was controlled at 4 by sodium hydroxide. After fermentation was completed, centrifugation was performed by a disc centrifuge to obtain tons of fermentation supernatant. Column leaching experiments were performed using the fermentation broth, the column inner diameter was 300 mm, and the soil was 50 kg. During the leaching process, spraying could be recycled, and the leaching solution was collected after the leaching was completed. Subsequently, ICP-OES testing was performed, and the leaching rates of rare earths and impurities Al, Fe, and Ca in the ionic rare earth ore were obtained, as shown in Table 1. Figure 6

[0094] Example 5

[0095] The pretreatment of weathered crust elution-deposited rare earth ore and the preparation of spore suspension were the same as in Example 2.

[0096] A 900 L fermentation broth was prepared according to the formula of modified Czapek-Dox medium (the only difference from the modified Czapek-Dox medium is that it does not contain sucrose), wherein the seed tank was 100 L and the fermentation tank was 800 L. Sucrose was separately prepared into a 800 g / L mother liquor. All were sterilized by high-temperature steam at 120 °C for 30 min in situ online. After sterilization was completed, the fermentation broth was naturally cooled to room temperature to start inoculation. Inoculation was performed into the seed tank to a final spore concentration of 1 x 10 6 The pH of the fermentation broth was controlled at 4 by sodium hydroxide. After fermentation was completed, centrifugation was performed by a disc centrifuge to obtain tons of fermentation supernatant. Column leaching experiments were performed using the fermentation broth, the column inner diameter was 300 mm, and the soil was 50 kg. During the leaching process, spraying could be recycled, and the leaching solution was collected after the leaching was completed. Subsequently, ICP-OES testing was performed, and the leaching rates of rare earths and impurities Al, Fe, and Ca in the ionic rare earth ore were obtained, as shown in Table 1. Figure 7 、 Figure 8 ,​Figure 9 As shown.

[0097] Example 6

[0098] The spore suspension was prepared in the same way as in Example 2.

[0099] A 900 L fermentation broth (without sucrose) was prepared according to the modified Czapek-Dox medium formula, wherein the seed tank was 100 L and the fermentation tank was 800 L. Sucrose was separately prepared into a 800 g / L mother liquor. All were sterilized by high-temperature steam at 120 °C for 30 min. After sterilization was completed, the fermentation broth was naturally cooled to room temperature to start inoculation. Inoculation was performed into the seed tank to a final spore concentration of 1 x 10 6 6 g / L. The dissolved oxygen was controlled at 28%-32% and the temperature was 30 °C. After 24 h of fermentation, the seed tank fermentation broth was all transferred to the fermentation tank for continuous fermentation for 4 days. The pH of the fermentation broth was controlled at 4 by sodium hydroxide, and after the fermentation was completed, ton-level fermentation supernatant was obtained by centrifugation by a disc centrifuge. 500 L of the fermentation broth and 10 kg of rare earth tailings (obtained from Baotou North Rare Earth Company in Inner Mongolia, and the rare earth content is shown in Table 1) were uniformly mixed, with a liquid-solid ratio of 50:1. Under the conditions of room temperature (25 degrees) and stirring paddle speed of 50 rpm, leaching was performed for 7 days, and the rare earth leaching concentration could reach 537.62 mg / L. The leaching rate could reach more than 96%, and the selectivity coefficient to impurity elements such as iron was more than 15:1 (Y / Fe). Figure 10 , Figure 11 ).

[0100] Table 1

[0101]

[0102] Example 7

[0103] The pretreatment of the weathered crust eluvial type rare earth ore and the preparation of the spore suspension were the same as in Example 2.

[0104] A 900 L fermentation broth (without sucrose) was prepared according to the modified Czapek-Dox medium formula, wherein the seed tank was 100 L and the fermentation tank was 800 L. Sucrose was separately prepared into a 800 g / L mother liquor. All were sterilized by high-temperature steam at 120 °C for 30 min. After sterilization was completed, the fermentation broth was naturally cooled to room temperature to start inoculation. Inoculation was performed into the seed tank to a final spore concentration of 1 x 10 6The seed tank fermentation liquid was transferred to the fermentation tank after 24 h of fermentation, and the fermentation was continued for another 4 days. The pH of the fermentation liquid was controlled at 4 using sodium hydroxide, and the ton-level fermentation supernatant was obtained by centrifugation using a disc centrifuge after the fermentation was completed. Similarly, 100 L of the fermentation liquid and 1 kg of oil sludge magnet waste with a rare earth content of 25% (obtained from Beijing Antai Technology, and the rare earth content is shown in Table 2) were mixed, and then ICP-OES was used for testing, to obtain the relationship between the rare earth ion concentration in the leaching liquid and the leaching time Figure 12

[0105] Table 2

[0106]

[0107] The results show that the rare earth leaching rate can reach 50% in 28 days, and the leaching efficiency is still rising without interruption as time goes on.

[0108] In summary, the present application effectively mines the microorganisms associated with rare earth ores, and a strain that can be used for efficient leaching of ionic rare earth ores, rare earth tailings and rare earth waste is screened. The culture medium required by the method is simple, the cost is low, the reaction conditions are mild, and most importantly, the problem of ammonia nitrogen pollution is solved. Meanwhile, the ton-level scale-up experiment shows that during the leaching process of ionic rare earth ores, the fermentation liquid of the strain can effectively reduce the impurity leaching rate without reducing the rare earth leaching rate. This provides great potential for biological leaching of ionic ores. In the leaching process of rare earth tailings, the use of biological fermentation liquid realizes the efficient recovery of low-grade rare earth tailings, effectively solving the problem of long-term open-air stacking of tailings that cannot be handled. In the leaching process of high-grade neodymium iron boron waste, the rare earth concentration shows a certain linear relationship with time, which is expected to realize the efficient recovery of high-grade rare earth waste. Whether it is low-grade rare earth ore or low-grade rare earth waste or high-grade industrial rare earth waste, the strain of the present application can realize the efficient extraction of rare earth using inexpensive culture medium. In the field of bio-metallurgy, it provides great potential for future industrial-scale expansion.​

Claims

1. A type of Aspergillus japonicus ( Aspergillus japonicus The Aspergillus japonicus described herein is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 41734.

2. Use of the Aspergillus japonicus of claim 1 in leaching rare earth elements, wherein the rare earth elements are from ion-type rare earth ore or rare earth secondary resources, the rare earth secondary resources being rare earth tailings or waste containing rare earth.

3. The use of claim 2, wherein the rare earth elements are selected from one or more of La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu, Sc, Y.

4. A method for leaching rare earth elements, comprising treating the rare earth elements with the Aspergillus japonicus of claim 1, wherein the rare earth elements are from ion-type rare earth ore or rare earth secondary resources, the rare earth secondary resources being rare earth tailings or waste containing rare earth.

5. The method for leaching of claim 4, wherein the method for leaching comprises contacting a culture or metabolite of the Aspergillus japonicus of claim 1 with a raw material comprising rare earth elements to achieve leaching of the rare earth elements.

6. The method for leaching of claim 4 or 5, wherein the rare earth elements are selected from one or more of La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu, Sc, Y.

7. The method for leaching of claim 5, wherein the culture or metabolite of the Aspergillus japonicus is contacted with the raw material comprising rare earth elements at a pH of 4.0-6.0, a solid-liquid ratio of 1:1-1:50, and a contact time of 7-30 days.

8. The method for leaching of claim 5, wherein the culture or metabolite of the Aspergillus japonicus is prepared by the steps of: inoculating a spore suspension of the Aspergillus japonicus into modified Czapek liquid medium and culturing at 30°C, 220 rpm for 3-6 days to obtain a fermentation broth; and optionally centrifuging the fermentation broth to obtain a supernatant.

Citation Information

Patent Citations

  • Rare earth extracting agent and application thereof

    CN119640034A