Application of bacillus amyloliquefaciens Rt3a in prevention and treatment of tomato bacterial wilt

Abstract

The invention discloses an application of bacillus amyloliquefaciens Rt3a in prevention and treatment of tomato bacterial wilt, and a 16sRNA (Ribonucleic Acid) sequence of the bacillus amyloliquefaciens Rt3a is as shown in SEQ ID NO: 1 (Sequence Identity Number 1). The invention further discloses an application of the bacillus amyloliquefaciens Rt3a in prevention and treatment of tomato bacterial wilt. According to the invention, the bacillus amyloliquefaciens Rt3a, which can be used as a strain source for preventing and treating the tomato bacterial wilt disease, is screened from endophytes which are separately cultured from roots and leaves of sugarcanes, so that the disease time of the tomato bacterial wilt disease is delayed, the tomato bacterial wilt disease can be efficiently prevented and treated, and the bacillus amyloliquefaciens Rt3a has a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of plant disease and pest control technology. More specifically, this invention relates to the application of a strain of Bacillus amyloliquefaciens Rt3a in the control of bacterial wilt in tomatoes. Background Technology

[0002] Tomatoes are one of the most widely cultivated fruits and vegetables globally, and are also grown in large areas in my country. However, continuous tomato cultivation over a long period can lead to crop rotation problems and the spread of soil-borne diseases. Bacterial wilt, caused by R. solanacearum, is one of the major soil-borne infectious diseases that seriously damage to tomato-growing regions. When bacterial wilt breaks out, plants wilt and even die on a large scale, resulting in loss of yield or even crop failure, causing a significant decline in agricultural economic benefits.

[0003] Currently, strategies for controlling bacterial wilt in tomatoes can be mainly divided into agricultural control, chemical control, and biological control. A single strategy cannot effectively control the disease; therefore, a combination of strategies is generally employed in production for integrated control. Endophytic bacteria have a high affinity for plants and do not cause obvious external infection symptoms in the host plant. They can directly or indirectly play a beneficial role in plant development. As biological control strains, they can compete with pathogens within the plant, occupying living space and competing for nutrients, thus limiting the reproduction of pathogens and better controlling the disease. They also have less impact on the rhizosphere microecological balance of the plant soil, offering greater advantages compared to traditional soil bacteria and serving as a source of inoculum for plant disease control.

[0004] However, there is currently a lack of highly effective (with a control effect of over 50%) bacterial wilt antagonistic growth-promoting bacteria resources. Summary of the Invention

[0005] Based on this, the purpose of this invention is to provide the application of a strain of Bacillus amyloliquefaciens Rt3a in the prevention and control of bacterial wilt in tomatoes.

[0006] The technical solutions for achieving the above-mentioned objectives include the following.

[0007] In a first aspect, the present invention provides the application of Bacillus amyloliquefaciens Rt3a in the control of bacterial wilt of tomato, wherein the 16S RNA sequence of Bacillus amyloliquefaciens Rt3a is shown in SEQ ID NO:1.

[0008] In a second aspect, the present invention provides a biological agent for controlling bacterial wilt of tomatoes, wherein the active ingredient of the biological agent is Bacillus amyloliquefaciens Rt3a.

[0009] A third aspect of the present invention provides a method for preventing and controlling bacterial wilt of tomatoes, comprising the following steps: after transplanting tomato seedlings, inoculating them with a suspension of Bacillus amyloliquefaciens Rt3a.

[0010] The present invention has the following beneficial effects:

[0011] The inventors of this invention isolated and cultured dozens of endophytic bacteria from sugarcane roots and leaves. Using *Ralstonia solanaceae* as a biocontrol indicator, they initially screened eight strains with inhibitory activity against *Ralstonia solanaceae* using the plate confrontation method. Further comparison of plate antagonistic activity revealed five strains with high antagonistic activity. Then, through experiments on the control of tomato bacterial wilt, it was found that among these five strains, *Bacillus amyloliquefaciens* Rt3a delayed the onset of tomato bacterial wilt and could effectively control the disease (control efficacy of 56.06%). Therefore, *Bacillus amyloliquefaciens* Rt3a can be used as a strain source for the control of tomato bacterial wilt and can be widely applied in the prevention and control of this disease. Attached Figure Description

[0012] Figure 1 This is a diagram showing the alignment results of strain Rt3a in Genbank in Example 2 of this invention. Detailed Implementation

[0013] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0014] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0015] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in the fourth edition of *Molecular Cloning: A Laboratory Manual*, edited by Green and Sambrook, published in 2013, or under conditions recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.

[0016] In some embodiments of the present invention, the application of Bacillus amyloliquefaciens Rt3a in the control of bacterial wilt of tomato is disclosed, wherein the 16SRNA sequence of Bacillus amyloliquefaciens Rt3a is shown in SEQ ID NO:1.

[0017] In some other embodiments of the present invention, a biological agent for controlling bacterial wilt of tomatoes is disclosed, wherein the active ingredient of the biological agent is Bacillus amyloliquefaciens Rt3a.

[0018] In some embodiments, the working concentration of Bacillus amyloliquefaciens Rt3a is 0.8 × 10⁻⁶. 8 cfu / ml ~1.2×10 8 cfu / ml.

[0019] In some embodiments, the working concentration of Bacillus amyloliquefaciens Rt3a is 0.9 × 10⁻⁶. 8 cfu / ml ~1.1×10 8 cfu / ml.

[0020] In some embodiments, the working concentration of Bacillus amyloliquefaciens Rt3a is 0.95 × 10⁻⁶. 8 cfu / ml ~1.05×10 8 cfu / ml.

[0021] In some other embodiments of the present invention, a method for preventing and controlling bacterial wilt of tomatoes is disclosed, comprising the following steps: after transplanting tomato seedlings, inoculating them with a suspension of Bacillus amyloliquefaciens Rt3a.

[0022] In some of these embodiments, the tomato seedlings were inoculated with a suspension of Bacillus amyloliquefaciens Rt3a on the 3rd and 7th day after transplanting.

[0023] In some embodiments, the concentration of the Bacillus amyloliquefaciens Rt3a suspension is 0.8 × 10⁻⁶. 8 cfu / ml ~1.2×10 8 cfu / ml.

[0024] In some embodiments, the concentration of the Bacillus amyloliquefaciens Rt3a suspension is 0.9 × 10⁻⁶. 8 cfu / ml ~1.1×10 8 cfu / ml.

[0025] In some embodiments, the concentration of the Bacillus amyloliquefaciens Rt3a suspension is 0.95 × 10⁻⁶. 8 cfu / ml ~1.05×10 8 cfu / ml.

[0026] The present invention will be further described in detail below with reference to specific embodiments.

[0027] Example 1: Isolation of bacterial wilt antagonistic bacteria

[0028] Includes the following steps:

[0029] I. Isolation and culture of endophytic bacteria

[0030] The applicant initially collected sugarcane samples from a sugarcane base in Zhanjiang. Endophytic bacteria were then isolated and cultured from the sugarcane roots and leaves. The isolation method is as follows:

[0031] Sugarcane roots and leaves were cut and rinsed with tap water to remove surface dirt. Then, they were rinsed repeatedly with sterile water. After rinsing, the samples were blotted dry with sterile filter paper and disinfected by soaking in 75% alcohol for 2 minutes and 3% sodium hypochlorite for 5 minutes, respectively. The disinfectant solutions were discarded, and the samples were rinsed several times with sterile water and blotted dry with sterile filter paper. 100 μL of the sterile water from the last rinse was spread onto LB medium (10 g tryptone, 5 g yeast extract, 10 g sodium chloride, 1000 mL deionized water, and 1.8% agar powder were added to make a solid medium. The medium was autoclaved at 121℃ for 20 minutes) as a control to verify the disinfection effect. The sugarcane samples were ground in a sterile mortar and pestle, and the ground solution was serially diluted (10 μL / L phosphate buffered saline) with 0.01 mol / L PBS.-1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 After dilution, 100 μL of each culture was spread onto LB medium and incubated at 30°C for 2–3 days. Further streak purification was then performed, repeating the purification process 2–3 times. The isolated endophytic bacteria were then identified using 16S rRNA molecular biology techniques and stored at -80°C with 25% glycerol for future use.

[0032] II. Initial and secondary screening of bacterial strains

[0033] The plate confrontation method was used to initially screen strains with antagonistic ability from the tested strains. The method is as follows:

[0034] Using *Raulella solanaceae* as a biocontrol indicator bacterium, it was activated and inoculated into 250 mL of modified NA liquid medium (10 g glucose, 5 g bacteriological peptone, 3 g beef extract, 0.5 g yeast powder, 1000 mL deionized water, autoclaved at 121℃ for 20 min). The medium was then cultured on a shaker at 30℃ and 180 rpm for 48 h, and the bacterial concentration (OD) was adjusted. 600 To prepare pathogenic bacteria, a plate containing 1% of the modified NA solid medium (10g glucose, 5g bacteriological peptone, 3g beef extract, 0.5g yeast powder, 1000mL deionized water, and 1.8% agar powder, autoclaved at 121℃ for 20min) was added at a concentration of 1.0. After solidification, a hole was punched in the center of each plate containing pathogenic bacteria using a 9mm diameter punch. 100μL of the tested biocontrol solution, incubated overnight, was added to each well. Each treatment was repeated three times, and the plates were incubated at 30℃ for 2 days. The presence or absence of inhibition zones was observed.

[0035] The results are shown in Table 1. Eight strains with inhibitory ability against Ralstonia solanacearum were initially screened from the tested strains, namely LfJ1, RtJ5, LfJ2, D3, Rt3a, WB4a, RtJ2, and L3c.

[0036] Table 1. Determination of antagonistic ability of tested strains

[0037]

[0038]

[0039] Note: In the table, "+" indicates antagonistic ability, and "-" indicates no antagonistic ability.

[0040] The plate antagonistic activities of the 8 selected strains were compared, and the results are shown in Table 2. Five strains with high antagonistic activities were selected: D3, RtJ5, LfJ2, Rt3a, and L3c, with inhibition zone diameters of 24.30 mm, 23.30 mm, 23.00 mm, 21.70 mm, and 22.00 mm, respectively.

[0041] Table 2. Statistical analysis of antagonistic activity of antagonistic bacteria on plates.

[0042] serial number strain Diameter of the inhibition zone (mm) LfJ1 Bacillus subtilis 15.00±1.00b D3 Bacillus velezensis 24.33±1.15a RtJ2 Aeromonascaviae 16.00±1.73b RtJ5 Enterobacterhormaechei 23.33±1.53a LfJ2 Curtobacteriumcitreum 23.00±1.00a WB4a Bacillus saltitudinis 15.00±2.65b Rt3a Bacillusammyloliquefaciens 21.70±1.53a L3c Bacillus velezensis 24.33±0.58a

[0043] Note: Data in the table represent mean ± standard error (n=3). Different letters after the numbers in the same column indicate the significance of differences between treatments (Duncan's method, P=0.05).

[0044] III. Analysis of the metabolic capacity of disease-resistant and growth-promoting substances

[0045] The results are shown in Table 3. As can be seen from Table 3, all five strains have the ability to produce auxin and form biofilms, but none of them have the ability to fix nitrogen, solubilize phosphorus, or produce cellulase. Strains D3, Rt3a, and L3c have the ability to produce proteases, while strains Rt3a and RtJ5 have the ability to produce siderophores.

[0046] Table 3. Analysis of the metabolic capacity of disease-resistant and growth-promoting substances.

[0047]

[0048]

[0049] Note: In the table, "+" indicates the ability to metabolize this substance, and "-" indicates the inability to metabolize this substance.

[0050] Example 2: Control effect of antagonistic bacteria on bacterial wilt of tomato

[0051] 1. Preparation of antagonistic bacterial culture

[0052] The five antagonistic bacteria selected in Example 1 were activated on LB medium for 24 hours, then transferred to LB liquid medium and cultured at 180 rpm and 30°C for 48 hours. After centrifugation at 8000 rpm, the supernatant was removed, and the bacterial cells were eluted from the centrifuge tube wall with sterile water. The OD was adjusted. 600 The value is 1.0, 10 8 cfu / mL, for later use.

[0053] 2. Preparation of bacterial suspension of Ralstonia solanacearum pathogen

[0054] After activating the bacterial wilt pathogen in NA medium, the cells were transferred to NA liquid medium and cultured at 180 rpm for 48 h at 30°C. The supernatant was discarded by high-speed centrifugation, and the bacterial cells were resuspended in sterile water and diluted to a concentration of 10⁻⁶. 8The cfu / mL concentration was used as a suspension of Ralstonia solanacearum pathogen for inoculation.

[0055] 3. Seed treatment and seedling raising methods

[0056] Select tomato seeds of uniform shape and size, treat them with 75% ethanol for 5 minutes, then rinse them with sterile water about 5 times to remove any residual chemicals. After disinfection, place the disinfected seeds in disposable petri dishes containing sterile filter paper moistened with sterile water, and place them in a constant temperature incubator to germinate until they show white sprouts. After sterilizing the soil, add water to moisten it and then divide it into 50-cell seedling trays, sowing 2-3 germinated seeds per cell. Once the seeds have grown to about 12cm, they are ready for use.

[0057] The prepared tomato seedlings were transplanted into 10cm diameter flowerpots. Three treatments were set up: one antagonistic bacterium plus Ralstonia solanacearum treatment, Ralstonia solanacearum treatment alone, and 3% kasugamycin plus Ralstonia solanacearum treatment (control).

[0058] Inoculation concentrations of 10 were applied 3 days and 7 days after transplanting. 8 A diluted antagonistic bacterial fermentation broth at CFU / ml was used. On day 10, the *Ralstonia solanacearum* suspension was inoculated to achieve a *Ralstonia solanacearum* concentration of 10⁻⁶ in the soil. 6 cfu / g. Ten seedlings per treatment, with three replicates.

[0059] The disease incidence was continuously observed, and the incidence was statistically analyzed on the 10th day after inoculation with Ralstonia solanacearum suspension. Based on the degree of leaf wilting in tomato plants, the disease severity was divided into 5 levels. The classification criteria for Ralstonia solanacearum disease are shown in Table 4 (Fang Zhongda, 1998).

[0060] Table 4. Criteria for Classification of Bacterial Wilt Disease Levels

[0061] Disease level Disease occurrence degree Level 0 The plant is normal and shows no signs of wilting. Level 1 The degree of wilting of the plant leaves should not exceed 25%. Level 2 The plant's leaves are wilted to a degree exceeding 25% but not exceeding 50%. Level 3 The plant's leaves are wilted to a degree exceeding 50% but not exceeding 75%. Level 4 More than 75% of the plant's leaves are wilted.

[0062]

[0063]

[0064]

[0065] 4. Evaluation of prevention and control effectiveness

[0066] On day 10, the disease index and prevention and control effects were statistically analyzed, and the results are shown in Table 5.

[0067] Table 5. Control effect of antagonistic bacteria treatment on bacterial wilt of tomato.

[0068]

[0069]

[0070] Note: Data in the table represent mean ± standard error (n=3). Different letters after the numbers in the same column indicate the significance of differences between treatments (Duncan's method, p=0.05).

[0071] Three days after inoculation with Ralstonia solanacearum, the Ralstonia solanacearum treatment group was the first to develop the disease. On day 4, the D3, RtJ5, L3c, and 3% streptomycin treatment groups began to develop the disease. On day 6, the LfJ2 and Rt3a treatment groups began to develop the disease. Subsequently, the disease index of each treatment group gradually increased. At the time of statistical analysis (day 10), the disease index of the Ralstonia solanacearum treatment group reached 83.33%, while the disease index of the Rt3a treatment group was only 35.67%, which was 47.66% lower than that of the Ralstonia solanacearum treatment group.

[0072] Compared with the Ralstonia solanacearum treatment, the treatments with the five antagonistic bacteria delayed the onset of bacterial wilt in tomatoes to varying degrees, and the disease progression was also delayed to some extent. The control efficacy of the five antagonistic bacteria ranged from 24% to 57%, with Rt3a showing the best control efficacy at 56.06%, significantly higher than the other treatments.

[0073] The 16SRNA sequence of strain Rt3a was determined by Genewiz Biotechnology Co., Ltd., and the 16SRNA sequence is shown in SEQ ID NO:1. The 16SRNA sequence was imported into GenBank (accession number OP946186.1) for alignment, and the alignment results are as follows. Figure 1 As shown, from Figure 1 It can be seen that strain Rt3a is Bacillus amyloliquefaciens.

[0074] SEQ ID NO:1

[0075] CTCCCTGATGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCT

[0076] GTAAGACTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATGGTTGTCT

[0077] GAACCGCATGGTTCAGACATAAAAGGTGGCTTCGGCTACCACTTACAGATG

[0078] GACCCGCGGCCATAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCGAC

[0079] GATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACAC

[0080] GGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACG

[0081] AAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTTTTCGGATCGTA

[0082] AAGCTCTGTTGTTAGGGAAGAACAAGTGCCGTTCAAATAGGGCGGCACCT

[0083] TGACGGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCG

[0084] GTAATACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTC

[0085] GCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAG

[0086] GGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTC

[0087] CACGTGTAGCGGTGAAATGCGTAGAGATGTGGAGGAACACCAGTGGCGAA

[0088] GGCGACTCTCTGGTCTGTAACTGACGCTGANGAGCGAAAGCGTNNGAGC

[0089] GAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTAAG

[0090] TGTTAGGGGGTTTCCGCCCCTTAGTGCTGCAGCTAACGCATTAAGCACTCC

[0091] GCCTGGGGAGTACGGTCGCAAGACTGAAACTCAAAGGAATTGACGGGGG

[0092] CCCGCACAAGCGGTGGAGCATGTGGTTT

[0093] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. The application of Bacillus amyloliquefaciens Rt3a in the control of bacterial wilt in tomato, characterized in that, The 16SRNA sequence of Bacillus amyloliquefaciens Rt3a is shown in SEQ ID NO:

1.

2. A biological agent for controlling bacterial wilt of tomatoes, characterized in that, The active ingredient of the biological agent is Bacillus amyloliquefaciens Rt3a.

3. The biological agent for controlling bacterial wilt of tomato according to claim 2, characterized in that, The working concentration of Bacillus amyloliquefaciens Rt3a was 0.8 × 10⁻⁶. 8 cfu / ml ~1.2×10 8 cfu / ml.

4. The biological agent for controlling bacterial wilt of tomato according to claim 3, characterized in that, The working concentration of Bacillus amyloliquefaciens Rt3a was 0.9 × 10⁻⁶. 8 cfu / ml ~1.1×10 8 cfu / ml.

5. The biological agent for controlling bacterial wilt of tomato according to claim 4, characterized in that, The working concentration of Bacillus amyloliquefaciens Rt3a was 0.95 × 10⁻⁶. 8 cfu / ml ~1.05×10 8 cfu / ml.

6. A method for controlling bacterial wilt in tomatoes, characterized in that, Includes the following steps: After transplanting tomato seedlings, inoculate them with a suspension of Bacillus amyloliquefaciens Rt3a.

7. The method for controlling bacterial wilt of tomato according to claim 6, characterized in that, On the 3rd and 7th day after transplanting the tomato seedlings, inoculate them once with a suspension of Bacillus amyloliquefaciens Rt3a.

8. The method for controlling bacterial wilt of tomato according to claim 6 or 7, characterized in that, The concentration of the Bacillus amyloliquefaciens Rt3a suspension was 0.8 × 10⁻⁶. 8 cfu / ml ~1.2×10 8 cfu / ml.

9. The method for controlling bacterial wilt of tomato according to claim 8, characterized in that, The concentration of the Bacillus amyloliquefaciens Rt3a suspension was 0.9 × 10⁻⁶. 8 cfu / ml ~1.1×10 8 cfu / ml.

10. The method for controlling bacterial wilt of tomato according to claim 9, characterized in that, The concentration of the Bacillus amyloliquefaciens Rt3a suspension was 0.95 × 10⁻⁶. 8 cfu / ml ~1.05×10 8 cfu / ml.

Images