PavSWEET1 gene for regulating and controlling sugar accumulation of sweet cherries and application of PavSWEET1 gene

Abstract

The invention discloses a PavSWEET1 gene for regulating and controlling sugar accumulation of sweet cherries and application of the PavSWEET1 gene, and belongs to the technical field of gene engineering. The nucleotide sequence of the PavSWEET1 gene for regulating and controlling sugar accumulation of the sweet cherries is shown as SEQ ID NO.1. The research finds that the soluble sugar content of the sweet cherry fruits is correspondingly reduced or increased after the PavSWEET1 gene is silenced and overexpressed, and the PavSWEET1 protein participates in sugar accumulation in the fruits by regulating and controlling the transmembrane transportation process of carbohydrates; according to the invention, a theoretical basis is provided for cultivating a sweet cherry variety with high sugar content through a gene expression regulation means; by directionally adjusting the expression level of the PavSWEET1 gene, accurate improvement of the sugar content in germplasm resource innovation of sweet cherries is expected to be realized, and the requirements of consumers on high-quality fruits are better met.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the PavSWEET1 gene that regulates the accumulation of sweet cherry sugar and its applications. Background Technology

[0002] Sweet cherry (Prunus avium L.), also known as big cherry or Western cherry, belongs to the genus Prunus of the Rosaceae family. It is known as the "first fruit of spring" and is currently cultivated in many regions of my country, mainly distributed in the Bohai Bay area. Its flesh is tender and juicy, with a balanced sweet and sour taste. It is rich in vitamins, minerals and other nutrients, as well as bioactive substances such as phenols, flavonoids, anthocyanins and melatonin. The fruit has high nutritional value and is known as the "diamond of fruits," making it very popular among consumers.

[0003] Sugar content is one of the important quality traits of sweet cherries. Currently, most sweet cherries on the market are rather sour, which greatly reduces the quality of the fruit and indirectly affects its economic benefits in the market. The sugar content of sweet cherries mainly depends on the accumulation of soluble sugars in the fruit. Sugars are the main product of photosynthesis and play an important role in signal transduction, osmotic regulation, molecular transport, and stress resistance during plant growth and development. The transport and distribution of sugars in plants is particularly important, and carrier proteins are usually required to carry various sugar substances across biological membranes.

[0004] To date, a variety of sugar transporters have been identified in plants, which are mainly divided into three families: monosaccharide transporters (MSTs), sucrose transporters / sucrose carriers (SUTs / SUCs), and sugars transporters (sWEETs).

[0005] SWEET proteins are a newly discovered type of protein that transports sugars across the cell membrane concentration gradient without relying on environmental pH, but only utilizing the concentration difference between the inside and outside of the cell. As an important class of sugar transport proteins in plants, SWEET proteins participate in multiple physiological processes in plant growth and development, such as sugar transport, reproductive growth, vegetative growth, and stress resistance, and play an important role in the distribution of sugars from source organ cells to sink organ cells.

[0006] To date, researchers have studied the SWEET family genes in different plants, such as tomatoes, grapes, and watermelons, but there are few reports on the research and application of the SWEET gene family in sweet cherry fruits. Summary of the Invention

[0007] Therefore, the purpose of this invention is to provide a PavSWEET1 gene that regulates sugar accumulation in sweet cherries and its application. This invention studies the PavSWEET1 gene and its application in regulating sugar content in sweet cherry fruits, which helps to reveal the molecular mechanism of sugar accumulation in sweet cherry fruits and improve the understanding of the function of plant sugar transport proteins. By targeting and regulating this gene, the sweetness of sweet cherry fruits can be effectively improved, fruit quality can be enhanced, market competitiveness can be strengthened, key technical support can be provided for the high-quality development of the sweet cherry industry, and farmers' income can be increased and the industry can be upgraded.

[0008] In order to achieve the above object, the present invention provides the following technical solutions:

[0009] In a first aspect, the present invention provides a PavSWEET1 gene for regulating the accumulation of sweet cherry sugar, wherein the nucleotide sequence of the PavSWEET1 gene is shown in SEQ ID NO.1.

[0010] Secondly, the present invention provides a protein encoded by the PavSWEET1 gene that regulates the accumulation of sweet cherry sugar.

[0011] Thirdly, the present invention provides an expression vector comprising the above-mentioned PavSWEET1 gene that regulates the accumulation of sweet cherry sugar.

[0012] Based on the above technical solution, the expression vector further includes pMD-19T vector, pCAMBIA-3HA vector, pTRV2 vector and PEKZ(K)-LC vector.

[0013] Fourthly, the present invention provides recombinant engineered bacteria carrying the above-described expression vector.

[0014] Based on the above technical solution, the recombinant engineered bacteria are Escherichia coli or Agrobacterium.

[0015] Fifthly, the present invention provides the application of the above-mentioned PavSWEET1 gene, protein, expression vector or recombinant engineered bacteria that regulate the accumulation of sweet cherry sugar in increasing the sugar content of plant fruits.

[0016] Based on the above technical solution, the plants further include cherry and tobacco.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] This invention utilizes gene editing technology to significantly reduce the sugar content of sweet cherry fruit after silencing the PavSWEET1 gene; and significantly increase the sugar content when overexpressed. Furthermore, this invention effectively increases the sugar content in sweet cherry fruit, greatly enhancing the sweetness of the fruit and thus improving fruit quality. It provides gene resources and strategies for the innovation of sweet cherry germplasm resources, better meeting consumer demand. Attached Figure Description

[0019] To more clearly illustrate the embodiments of the present invention, the accompanying drawings involved in the embodiments will be briefly described below.

[0020] Figure 1 Images of sweet cherry fruits at different stages of the 'Red Lantern' and 'Pearl' varieties.

[0021] Figure 2 The results show the soluble solids, soluble sugar, total acid content, and sugar-acid ratio in sweet cherry fruits; where a: soluble solids content during the development of 'Hongdeng' and 'Mingzhu' varieties; b: changes in soluble sugar content during the development of 'Hongdeng' and 'Mingzhu' varieties; c: changes in total acid content during the development of 'Hongdeng' and 'Mingzhu' varieties; and d: sugar-acid ratio during the development of 'Hongdeng' and 'Mingzhu' varieties.

[0022] Figure 3 This is an expression profile of the PavSWEET gene family based on RNA-Seq.

[0023] Figure 4 The results are for qRT-PCR gene expression level validation of relevant candidate genes; where a: PavSWEET1 gene qRT-PCR gene expression level validation; b: PavSWEET2a gene qRT-PCR gene expression level validation; c: PavSWEET4 gene qRT-PCR gene expression level validation; d: PavSWEET7 gene qRT-PCR gene expression level validation; e: PavSWEET9 gene qRT-PCR gene expression level validation; f: PavSWEET9a gene qRT-PCR gene expression level validation.

[0024] g: qRT-PCR validation of PavSWEET9b gene expression level; h: qRT-PCR validation of PavSWEET10 gene expression level.

[0025] Figure 5 The expression vectors used in the examples are: a: pCMABIA-3HA vector; b: pTRV2 vector;

[0026] c:PEKZ(K)-LC carrier.

[0027] Figure 6Subcellular localization results for PavSWEET1: where a: DAPI channel; b: GFP channel; c: bright field; d: Merge.

[0028] Figure 7 The results show the soluble sugar content and quantification of PavSWEET1 after silent and overexpression in *Nicotiana benthamiana*. Specifically: a) soluble sugar content after silence; b) relative expression level of soluble sugar after silence; c) soluble sugar content after overexpression; d) relative expression level of soluble sugar after overexpression.

[0029] Figure 8 This study investigated the soluble sugar content and quantification of sweet cherry fruit after silencing PavSWEET1 expression. The results are as follows: a) soluble sugar content determination after 'Hongdeng' silencing; b) relative expression analysis of soluble sugars after 'Hongdeng' silencing; c) soluble sugar content determination after 'Mingzhu' silencing; d) relative expression analysis of soluble sugars after 'Mingzhu' silencing.

[0030] Figure 9 The results show the soluble sugar content and quantification of sweet cherry fruit after overexpression of PavSWEET1. A: soluble sugar content determination after 'Hongdeng' overexpression; B: relative expression level analysis of soluble sugar after 'Hongdeng' overexpression; C: soluble sugar content determination after 'Mingzhu' overexpression; D: relative expression level analysis of soluble sugar after 'Mingzhu' overexpression. Detailed Implementation

[0031] The present invention will be described in detail below with reference to the embodiments. However, the implementation of the present invention is not limited thereto. Obviously, the embodiments described below are only some embodiments of the present invention. For those skilled in the art, other similar embodiments can be obtained without creative effort and all fall within the protection scope of the present invention.

[0032] Example 1

[0033] 1. Source of experimental materials and growth conditions

[0034] In this embodiment, fruits of two varieties, 'Hongdeng' and 'Mingzhu', bred by the Dalian Academy of Agricultural Sciences and grown under the same field conditions at the Dalian Academy of Agricultural Sciences, were selected. The fruits were grown under identical climatic and cultivation management conditions at the Academy. The degree of coloring differed between 'Hongdeng' and 'Mingzhu' during ripening. The three coloring stages for both varieties were 4 weeks after full bloom (Stage 1), 5 weeks after full bloom (Stage 2), and 6 weeks after full bloom (Stage 3). The fruit morphology at different developmental stages of the two sweet cherry varieties is shown below. Figure 1 As shown.

[0035] 2. Determination of soluble sugar and total acid content in sweet cherries

[0036] To determine the soluble sugars and total acids in sweet cherry fruit, the sample was first dissolved and concentrated, then diluted to volume with 0.1% H3PO4 solution and sonicated. After sonication, the sample was filtered and centrifuged to obtain the supernatant. The specific steps are as follows:

[0037] 0.5 g of sample was used for soluble sugar extraction. First, extraction was performed using 4 mL of 80% ethanol (v / v) in an 80℃ water bath for 30 min. Then, extraction was performed using 2 mL of 80% ethanol (v / v). After centrifugation at 10000 rpm for 15 min, the supernatant was collected. The two supernatants were mixed and dried using an MTN-2800D (Tianjin) concentrator. After drying, 10 mL of ddH2O was added, and 1 mL of the test solution was placed in a sample vial for later use. 1.0 mL of sample was taken and diluted to 20 mL with 0.1% H3PO4 solution. The solution was sonicated for 30 min, filtered, and the filtrate was centrifuged. The supernatant was filtered, and 1 mL of the test solution was placed in a sample vial for later use. Subsequently, the sample was analyzed. Soluble sugar was determined by Agilent HPLC (Agilent Technologies 1260 Infinity II); total acid was determined by LC 20AR (SHIMADZU) high-performance liquid chromatography.

[0038] The results are as follows Figure 2 As shown, as the fruit gradually ripens, the soluble solids content of 'Hongdeng' and 'Mingzhu' fruits gradually increases, while the total acid content remains basically unchanged. The soluble sugar content and sugar-acid ratio of 'Hongdeng' fruit gradually increase, while the soluble sugar content and sugar-acid ratio of 'Mingzhu' fruit first decrease and then increase.

[0039] 3. Sample collection and transcriptome sequencing

[0040] The following steps were taken to collect and perform transcriptome sequencing on sweet cherry varieties 'Hongdeng' and 'Mingzhu':

[0041] For each variety and each developmental stage, three stable cherry trees were selected for collection. Three fruits were collected from each tree and mixed together to form a biological replicate (each replicate contained nine fruits). Three biological replicates were collected for each developmental stage and immediately placed in liquid nitrogen before being sent to a sequencing service company for mRNA sequencing.

[0042] 4. Analysis of PavSWEET gene family expression patterns

[0043] Based on transcriptome sequencing results, the specificity of the PavSWEET gene at different developmental stages of sweet cherry fruit was extracted.

[0044] FPKM expression data were used to create expression heatmaps and perform analysis using TBtools.

[0045] The results are as follows Figure 3 As shown, compared with other PavSWEET gene families, the PavSWEET1 gene (nucleotide sequence shown in SEQ ID NO.1) is expressed in both 'Hongdeng' and 'Mingzhu' fruits, especially with a significant increase in expression levels in all three developmental stages of the 'Mingzhu' fruit.

[0046] 5. RNA was extracted and reverse transcribed into cDNA, and gene expression was verified by qRT-PCR.

[0047] First, RNA was extracted from the fruit using a kit, then reverse transcribed into cDNA. Finally, the cDNA was subjected to qRT-PCR to verify its expression level. The specific steps are as follows:

[0048] (1) RNA was extracted from the fruits of two varieties of sweet cherry, 'Hongdeng' and 'Mingzhu', at three different stages using the EASY spin Plus plant RNA rapid extraction kit.

[0049] (2) After extraction, the RNA concentration was measured and stored in a -80℃ refrigerator for later use.

[0050] (3) The sequenced RNA samples were reverse transcribed into cDNA using RT reaction solution. The RT reaction solution was prepared as shown in Table 1, and the reaction conditions were shown in Table 2. After the reaction was completed, the samples were stored in a -20℃ freezer.

[0051] Table 1. Preparation of RT reaction solution

[0052]

[0053] Note: A 20μl reaction system can be used to produce a maximum of 1000ng of total RNA. The amount of RNA used at each stage should be adjusted accordingly.

[0054] It depends on the RNA concentration.

[0055] Table 2 Reverse transcription reaction conditions

[0056]

[0057] (4) Based on the gene sequence information, qRT-PCR primers were designed using Oligo7, and some genes were quantitatively verified. The qRT-PCR reaction system is shown in Table 3, and the qRT-PCR reaction conditions are shown in Table 4. The verification results are as follows: Figure 4 As shown.

[0058] qRT-PCR primer sequences for PavSWEET1:

[0059] Primer-F: CAGAGCAGTTCTCAGGCATTCCGTA;

[0060] Primer-R:TTGCTTCAATGGCTCACCAGT;

[0061] Table 3 qRT-PCR reaction system

[0062]

[0063] Table 4 qRT-PCR reaction conditions

[0064]

[0065] Depend on Figure 4 It was found that the expression level of PavSWEET1 increased significantly during the development of 'Mingzhu' fruit, but the change in PavSWEET1 expression was not high in 'Hongdeng'. This is consistent with the transcriptome sequencing results, therefore the PavSWEET1 gene was selected for study.

[0066] 6. PavSWEET1 Cloning

[0067] Primers were designed based on the CDS sequence of the PavSWEET1 gene. PCR amplification was performed using reverse-transcribed cDNA as a template, followed by agarose gel electrophoresis and gel recovery. The recovered product was ligated into the pMD-19T plasmid vector using the T4 ligation method and transformed into competent E. coli DH5α cells. Colony PCR was then performed for verification. The specific steps are as follows:

[0068] Primers were designed based on the CDS sequence of the PavSWEET1 gene, and PCR amplification was performed using reverse transcribed cDNA as a template. The PCR amplification system is shown in Table 5, and the PCR amplification program is shown in Table 6.

[0069] pMD-19T-PavSWEET1-Primer-F:ATGCATATTCTCAAGGTCTGCTTTGG;

[0070] pMD-19T-PavSWEET1-Primer-R:TTACCGTGCAGAGCAAAGACTG;

[0071] Table 5 PCR amplification system

[0072]

[0073] Table 6 PCR Amplification Procedure

[0074]

[0075] After 1% agarose gel electrophoresis, the target fragment was recovered using an agarose gel recovery kit (Sangon Biotech) and ligated to the pMD-19T vector using the T4 ligation method. The vector was then transformed into competent DH5α cells of *E. coli* using a heat shock method. Positive clones detected by colony-linked PCR were selected and sent to the company for sequencing. Sequencing confirmed the correct construction of pMD-19T-PavSWEET1. pMD-19T-PavSWEET1 was extracted using a plasmid miniprep kit (Beyotime) for subsequent experiments.

[0076] 7. Construction of PavSWEET1 expression vector

[0077] Primers were designed based on the CDS sequence of the PavSWEET1 gene. PCR amplification was performed using pMD19-T-PavSWEET1 as a template. Agarose gel electrophoresis and gel recovery were then performed. The plasmid vector was digested with specific restriction enzymes. Homologous recombination technology was used to ligate the recovered products into pCAMBIA-3HA (overexpression), pTRV2 (silencing), and PEKZ(K)-LC (subcellular localization) plasmid vectors, which were then transformed into competent E. coli DH5α cells. Colony PCR was performed for verification. The specific steps are as follows:

[0078] Primers were designed based on the CDS sequence of the target gene, and PCR amplification was performed using pMD19-T-PavSWEET1 as a template. The PCR amplification system is shown in Table 5, and the PCR amplification program is shown in Table 6.

[0079] pCAMBIA-3HA-PavSWEET1-Primer-F:

[0080] ACATGTCGACACGTGGATCCATGCATATTCTCAAGGTCTGCTTTGG;

[0081] pCAMBIA-3HA-PavSWEET1-Primer-R:

[0082] CCTGCGGCCGCGCCGGATCCCCGTGCAGAGCAAAGACTG;

[0083] pTRV2-PavSWEET1-Primer-F:

[0084] AAGGTTACCGAATTCATGCATATTCTCAAGGTCTGCTTTGG;

[0085] pTRV2-PavSWEET1-Primer-R:

[0086] CTCGGTACCGGATCCCCGTGCAGAGCAAAGACTG;

[0087] PEKZ(K)-LC-PavSWEET1-Primer-F:

[0088] GCAGCGGCCGAATTCATGCATATTCTCAAGGTCTGCTTTGG;

[0089] PEKZ(K)-LC-PavSWEET1-Primer-R:

[0090] GGCCCCGGTGGATCCTTACCGTGCAGAGCAAAGACTG;

[0091] After detection by 1% agarose gel electrophoresis, the target fragment was recovered using an agarose gel recovery kit (Sangon Biotech). The pCAMBIA-3HA, pTRV2, and PEKZ(K)-LC vectors were digested with BamHI and EcoRI, and the digestion system is shown in Table 7.

[0092] Table 7 Enzyme digestion system

[0093]

[0094] Note: pCAMBIA-3HA is a single enzyme digestion system, using only BamHI and its corresponding rCutSmart Buffer.

[0095] The fragments from the gel recovery product were homologously recombinated and inserted into the pCAMBIA-3HA, pTRV2, and PEKZ(K)-LC vectors. Ligation yielded recombinant plasmids, which were then transformed into *E. coli* competent cells DH5α and sequenced. The correct recombinant plasmid vectors were verified using a plasmid miniprep kit (Beyotime) for extraction and sequencing, facilitating subsequent experiments. The required expression vectors are as follows: Figure 5 As shown.

[0096] 8. Agrobacterium-mediated transformation of PavSWEET1 expression vector

[0097] The recombinant plasmid vector obtained earlier was transformed into Agrobacterium competent cells GV3101 and cultured. The specific steps are as follows:

[0098] The extracted vector was transformed into Agrobacterium competent cells GV3101 and cultured on solid agar plates (containing 50 mg·L⁻¹). -1 Rif, 50 mg·L -1Screening was performed on Kans (a type of aerobic bacteria), and single clones were selected for colony PCR verification. Successfully transformed Agrobacterium colonies were then picked and plated on solid antibiotic-resistant agar plates (containing 50 mg / L of aerobic culture medium). -1 Rif, 50 mg·L -1 (Kan) Streak culture; cultured in a 28℃ constant temperature incubator for 3 days.

[0099] 9. Subcellular localization of PavSWEET1

[0100] After successfully transformed Agrobacterium PEKZ(K)-LC-PavSWEET1 was used to prepare an infection solution, it was infected into tobacco leaves, cultured, and the results were observed using a fluorescence confocal microscope. The specific steps are as follows:

[0101] (1) Take a single colony of Agrobacterium PEKZ(K)-LC-PavSWEET1 that has been successfully transformed on a plate and inoculate it into LB liquid medium containing the corresponding antibiotic selection medium. Incubate at 28℃ and 220 rpm for 18-24 h with shaking. Transfer the turbid bacterial solution to a 50 mL centrifuge tube and continue to incubate at 28℃ and 220 rpm with shaking for 18-24 h. Detect the OD of the bacterial solution with a spectrophotometer. 600 value.

[0102] (2) OD 600 Once the concentration reaches between 0.6 and 0.8, centrifuge at 5000 rpm for 10-15 minutes. Prepare a resuspension using MES, MgCl2, and AS solutions. Resuspend the bacterial cells in 5 mL of the resuspension and adjust the concentration of the infection solution to OD200. 600 =0.4-0.6, and incubate the inoculum in a dark environment at room temperature for no less than 3 hours.

[0103] (3) After the resuspension is prepared, the tobacco leaves are infected and cultured in the dark for 12 hours, then cultured normally for 48 hours. Then, the subcellular localization of the PavSWEET1 gene in sweet cherry is observed using a laser confocal microscope.

[0104] Observation results as follows Figure 6 As shown, Figure 6 The images show PEKZ(K) under different conditions in a fluorescence confocal microscope.

[0105] -LC-PavSWEET1 gene localization in tobacco leaf cells, clear GFP fluorescence signal shows that PavSWEET1 protein is localized on the cell membrane.

[0106] 10. PavSWEET1 Instantaneous Tobacco Conversion

[0107] Tobacco leaves were infected with a solution prepared from successfully transformed Agrobacterium tumefaciens pCAMBIA-3HA-PavSWEET1 and pTRV2-PavSWEET1. The tobacco leaves were then cultured and dried, and the soluble sugar content was determined. The specific steps are as follows:

[0108] (1) Take single colonies of Agrobacterium tumefaciens that have been successfully transformed on plates (pCAMBIA-3HA-PavSWEET1 and pTRV2-PavSWEET1), inoculate them into LB liquid medium containing the corresponding antibiotics for selection, and incubate at 28℃ and 220 rpm for 18-24 h with shaking. Transfer the turbid bacterial solution to 50 mL centrifuge tubes and continue to incubate at 28℃ and 220 rpm with shaking for 18-24 h. Detect the OD of the bacterial solution with a spectrophotometer. 600 value.

[0109] (2) When OD 600 Once the bacterial concentration reaches between 0.6 and 0.8, centrifuge at 5000 rpm for 10-15 min. Prepare a resuspension using MES, MgCl2, and AS solutions. Resuspend the bacterial cells in 5 mL of the resuspension and adjust the concentration of the infection solution to OD using the resuspension. 600 =0.4-0.6, and incubate the resuspended solution in the dark at room temperature for no less than 3 hours.

[0110] (3) Using a 1mL sterile syringe, draw an appropriate amount of bacterial solution and slowly inject the infection solution into the tobacco leaf opening until the inside of the tobacco leaf is soaked with bacterial solution. After injection, the leaves are first cultured in the dark for 24 hours, and then cultured normally for 3 days. The negative control (empty expression vector) is injected and cultured in the same way. The cultured tobacco leaves are blanched in an oven at 120℃ for 30 minutes, and then dried at 60-80℃ for 7 days. Then the soluble sugar content is determined.

[0111] 11. PavSWEET1 Sweet Cherry Fruit Instant Transformation

[0112] Sweet cherry fruits were infected with an inoculum solution prepared using successfully transformed Agrobacterium tumefaciens pCAMBIA-3HA-PavSWEET1 and pTRV2-PavSWEET1. After culturing and drying, the soluble sugar content was determined. The specific steps are as follows:

[0113] (1) Take single colonies of Agrobacterium tumefaciens that have been successfully transformed on plates (pCAMBIA-3HA-PavSWEET1 and pTRV2-PavSWEET1), inoculate them into LB liquid medium containing the corresponding antibiotics for selection, and incubate at 28℃ and 220 rpm for 18-24 h with shaking. Transfer the turbid bacterial solution to 50 mL centrifuge tubes and continue to incubate at 28℃ and 220 rpm with shaking for 18-24 h. Detect the OD of the bacterial solution with a spectrophotometer. 600 value.

[0114] (2) When OD 600 Once the bacterial concentration reaches between 0.6 and 0.8, centrifuge at 5000 rpm for 10-15 minutes. Prepare a resuspension using MES, MgCl2, and AS solutions. Resuspend the bacterial cells in 5 mL of the resuspension and adjust the concentration of the infection solution to OD using the resuspension. 600 =0.4-0.6, and incubate the resuspended solution in a dark environment at room temperature for no less than 3 hours.

[0115] (3) Use a 1mL sterile syringe to draw an appropriate amount of bacterial solution and inject it into the fruit with a needle. Be careful not to puncture the fruit as much as possible until the inside of the fruit is soaked with bacterial solution. Incubate the injected sweet cherries in the dark for 24 hours, and then culture them normally for 7 days. Inject and culture the negative control (empty expression vector) in the same way. Place the fruit in an oven at 120℃ for 30 minutes to kill the green, and then dry it at 60-80℃ for 14 days before determining the sugar content.

[0116] 12. Determination of soluble sugars

[0117] The soluble sugar content of dried tobacco leaves and fruit samples was determined. First, the weighed samples were added to 80% ethanol solution, centrifuged in a water bath, and the supernatant was collected. Phosphorus-free activated carbon was added and the mixture was then placed in a water bath. The solution was then diluted to volume with distilled water, filtered, and the soluble sugar content was determined using the anthrone colorimetric method. The specific steps are as follows:

[0118] (1) Grind the dried tobacco leaves and fruit samples and pass them through a 100-mesh sieve. Then pack them into numbered envelopes for later use.

[0119] (2) Weigh 0.05 g of the sample using a 0.001 g balance and place it in a 10 mL centrifuge tube;

[0120] (3) Add 4 mL of 80% ethanol aqueous solution to the centrifuge tube containing the sample, heat in an 80℃ water bath for 30 min, cool and centrifuge at 3000 rpm for 10 min.

[0121] (4) Place the supernatant after centrifugation into a graduated test tube;

[0122] (5) Add 2 mL of 80% ethanol aqueous solution to the residue, repeat the above steps twice, and combine the supernatants;

[0123] (6) Add phosphorus-free activated carbon to the top rinsing and place it in a constant temperature water bath at 80°C for 30 minutes.

[0124] (7) After cooling, dilute to 10 mL with distilled water, filter to obtain soluble sugar test solution, and then use anthrone colorimetric method for determination.

[0125] 13. qRT-PCR verification

[0126] Total RNA from tobacco leaves and sweet cherry fruits was reverse transcribed using the PrimeScript RT kit to obtain cDNA. The cDNA was diluted 10-fold with RNase-free water for qRT-PCR analysis. qRT-PCR was performed on R96 plates using a 96S W1.1 light circulator. Relative gene expression levels were calculated using 2-1 -ΔΔCT Law.

[0127] The results are as follows Figure 7 , 8 As shown in Figure 9, Figure 7 In the transient conversion experiment of PavSWEET1 in tobacco, it was observed that when the PavSWEET1 gene was silenced, both its soluble sugar content and relative gene expression level decreased; while when the PavSWEET1 gene was overexpressed, both indicators increased significantly. Figure 8 and Figure 9 Studies on the fruits of the sweet cherry varieties 'Hongdeng' and 'Mingzhu' show that gene silencing leads to a decrease in the soluble sugar content and the relative expression level of the PavSWEET1 gene in the fruit; while gene overexpression increases the soluble sugar content and the relative expression level of the PavSWEET1 gene in the fruit.

[0128] The above results indicate that the PavSWEET1 protein can participate in the accumulation of sugar in fruit by regulating the transmembrane transport of carbohydrates. This discovery provides a theoretical basis for breeding sweet cherry varieties with high sugar content through gene expression regulation. By directionally regulating the expression level of the PavSWEET1 gene, it is expected to achieve precise improvement of sugar content in the innovation of sweet cherry germplasm resources, and better meet consumers' demand for high-quality fruit.

[0129] It should be noted that the above embodiments are only for further elaboration and explanation of the technical solution of the present invention, and are not intended to further limit the technical solution of the present invention. The method of the present invention is only a preferred embodiment and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A gene for regulating the accumulation of sweet cherry sugar, namely the PavSWEET1 gene, characterized in that, The nucleotide sequence of the PavSWEET1 gene is shown in SEQ ID NO.

1.

2. The protein encoded by the PavSWEET1 gene that regulates the accumulation of sweet cherry sugar as described in claim 1.

3. An expression vector comprising the PavSWEET1 gene for regulating sweet cherry sugar accumulation as described in claim 1.

4. The expression vector according to claim 3, characterized in that, The expression vectors include pMD-19T vector, pCAMBIA-3HA vector, pTRV2 vector, and PEKZ(K)-LC vector.

5. Recombinant engineered bacteria carrying the expression vector described in claim 3 or 4.

6. The recombinant engineered bacteria according to claim 5, characterized in that, The recombinant engineered bacteria are Escherichia coli or Agrobacterium.

7. The application of the PavSWEET1 gene for regulating sweet cherry sugar accumulation as described in claim 1, the protein as described in claim 2, the expression vector as described in claim 3 or 4, or the recombinant engineered bacteria as described in claim 5 or 6 in increasing the sugar content of plant fruits.

8. The application according to claim 7, characterized in that, The plants mentioned include cherry and tobacco.

Images