Method for improving drought resistance of rice through gene editing and application thereof

Abstract

The invention discloses a method for cultivating a drought-resistant rice variety, which is characterized in that the function of an OsAP25 gene in a rice plant is inactivated through a gene engineering method so as to obtain a rice material with improved drought stress resistance. By utilizing the method disclosed by the invention, the drought resistance of the rice can be subjected to genetic improvement without influencing the normal growth and development of the rice.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a method for improving the drought resistance of rice through gene editing and its application. Background Technology

[0002] Rice, as an important food crop, is the foundation of my country's food security. However, the growth of rice is highly dependent on the supply of water resources, and more than half of my country's arable land is dry land. This makes the contradiction between water scarcity and the high water requirement of rice increasingly prominent, which greatly restricts the planting area and yield of rice. According to statistics, drought can cause rice yield loss of more than 45% (Chang et al., 2024, Nat Commun, 15(1):5877). Rice drought resistance is a complex quantitative trait, and a large number of genes involved in drought stress response have been discovered. According to the differences in the functions of drought resistance-related genes, they are mainly divided into three categories: (1) signal transduction-related genes, such as protein kinase encoding genes; (2) transcription factor genes, such as DREB, NAC, bZIP, MYB, WRKY, TIFY, etc.; (3) functional protein encoding genes, such as encoding genes related to the synthesis of osmotic regulatory substances and redox systems (LEA, AHA2, SLAC1). These genes complete drought adaptation responses by participating in drought signal response, signal transduction, and gene expression regulation. In rice, regulating the expression of drought stress response genes can not only enhance its drought resistance but also effectively improve rice yield and quality in response to increasingly severe environmental stresses, while reducing the need for manual labor. Therefore, exploring rice drought-resistant gene resources and using molecular breeding techniques to cultivate drought-resistant varieties has significant application value in ensuring high and stable rice yields.

[0003] CRISPR-Cas9 technology involves designing an sgRNA to mediate the specific recognition and targeted cleavage of a target site by the Cas9 nuclease, and then introducing mutations using intracellular error-prone repair mechanisms. This technology is simple to operate, highly efficient in mutation, has a short cycle time, and is inexpensive. It can obtain germplasm resources without marker genes, which is of great significance for germplasm innovation and gene function research. Currently, this technology has been successfully applied to improve specific gene expression, metabolic regulation, stress response, yield, and quality traits in crops, providing new ideas for crop variety improvement.

[0004] Aspartic proteases (APs) are a class of proteolytic enzymes that use aspartic acid residues as their catalytic active sites. APs are widely found in plants such as Arabidopsis thaliana, rice (Oryza sativa), wheat (Triticum aestivum), common bean (Phaseolus vulgaris L.), cowpea (Vigna unguiculata.), and pineapple (Ananas comosus) (Tamura et al., 2007, Plant Physiol, 164(4):470-477; Cruz de et al., 2001, FEBS Lett, 442(1-2):108-118; Raimbault et al., 2013, Plant Physiol, 170(17):1536-1540). Studies have found that APs genes are expressed in plant tissues such as seeds, stems, leaves, and flowers, and participate in regulating plant growth and development, as well as responses to biotic and abiotic stresses. et al., 2010, J Plant Physiol, 167(1):61-8; Rocha et al., 2015, Protein Pept Lett, 22(4):379-90). For example, rice OsAP37 is associated with the activation of caspase-like proteases (cysteine-containing aspartic proteases), which are involved in programmed cell death during plant development (Niu et al., 2013, Natcommun, 4:1445). Overexpression of OsCDR1 can enhance the resistance of rice to rice blast fungus and bacterial blight fungus (Xia et al., 2004, EMBO J, 23(4):980-988). Arabidopsis ASPG1 can mediate the plant response to drought stress through the abscisic acid (ABA) signaling pathway (Yao et al., 2012, Exp Bot, 63(7):2579-2593). Currently, there are no reports on the regulatory role of rice aspartic protease under drought stress. Summary of the Invention

[0005] The purpose of this invention is to provide a method for improving the drought resistance of rice through gene editing and its application, so as to solve the problems mentioned in the background art.

[0006] To achieve the above objectives, the present invention provides the following technical solution: Plants possess complex gene regulatory networks. When the function of a specific gene is lost, other related genes or signaling pathways may be activated, leading to changes in the plant's resistance to certain stress factors. For example, the loss of function of the OsWRKY70 gene significantly reduces rice's tolerance to low-temperature stress. Simultaneously, the inactivation of this gene significantly enhances rice's resistance to rice blast fungus by affecting the expression level of the OsbHLH6 gene (Li et al., 2024). OsWRKY53 exhibits a negative regulatory effect on rice's salt tolerance (Yu et al., 2023), but plays a positive regulatory role in rice blast fungus resistance (Chujo et al., 2007). OsBIERF3 actively promotes the immune response of rice to rice blast fungus and bacterial blight fungus; however, it has a negative regulatory effect on rice's cold tolerance (Hong et al., 2022). In other words, the inactivation of certain functional genes does not necessarily lead to a comprehensive reduction in plant stress resistance; on the contrary, it may enable plants to develop higher resistance to other types of stress. It has been reported that OsAP25 plays an important role in regulating plant growth and development (Niu et al., 2013). The inventors found that the inactivation of the OsAP25 gene enhanced the expression of drought-related genes (OsbZIP23, OsbZIP66, OsbZIP72, OsDREB2A, OsDREB2B, OsDREB1E, OsLEA3, RAB21), thus speculating that this may be one of the reasons for the increased drought tolerance in rice.

[0007] The first principle of this invention is to successfully create loss-of-function mutants (CRS2, CRS6, and CRS10) by editing the rice aspartic protease gene OsAP25 using CRISPR-Cas9 technology. After rehydration (35°C, 3 days), the survival rates of CRS6 and CRS10 were significantly higher than those of the wild type, and the determination of relevant parameters further confirmed the physiological basis of the drought resistance of the mutants.

[0008] The second principle of this invention is a method for cultivating drought-resistant rice varieties using this mutant. By using genetic engineering methods to inactivate the OsAP25 gene in rice plants, rice materials with improved resistance to drought stress can be obtained.

[0009] Therefore, the first objective of this invention is to provide mutants CRS2, CRS6 and CRS10 from the rice aspartic protease gene OsAP25, wherein the mutants have gene sequences as shown in SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6, respectively.

[0010] In one embodiment, CRS2, CRS6 and CRS10 are Osap25-2 mutant, Osap25-6 mutant and Osap25-10 mutant, respectively, and their cDNA sequences are the gene sequences shown in SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9, respectively.

[0011] A second objective of this invention is to provide mutant proteins encoded as described in any of the above schemes.

[0012] In one embodiment, the mutant amino acid sequence has the gene sequence shown in sequences SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, respectively.

[0013] In any of the above embodiments, the DNA sequence, cDNA sequence, and amino acid sequence of the wild-type rice aspartic protease gene OsAP25 are the sequences shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively.

[0014] The third objective of this invention is to utilize the mutant gene sequence or protein sequence of any of the above schemes to inactivate the OsAP25 gene in rice plants through genetic engineering methods, so as to obtain rice materials or varieties with improved resistance to drought stress.

[0015] In one embodiment, the mutant gene sequence is obtained based on the mutant protein sequence, and the OsAP25 gene in rice plants is inactivated by genetic engineering methods to obtain rice materials or varieties with improved resistance to drought stress.

[0016] In another embodiment, an sgRNA is designed based on the specific target DNA sequence of OsAP25 to mediate the specific recognition and targeted cleavage of the target site by the Cas9 nuclease, and a mutation is introduced by utilizing the intracellular error-prone repair mechanism to cause the OsAP25 gene mutation in gene-edited rice, thereby improving the resistance of gene-edited rice to drought stress.

[0017] In any of the above-described embodiments, the method includes:

[0018] (1) Based on the specific DNA sequence of the coding region of the OsAP25 nucleotide sequence shown in SEQ ID NO:1, a sgRNA (i.e., PAM sequence, CCAGGGCCAGGCGTGCCCGGCGC) was designed, and then cloned and constructed using specific primers;

[0019] (2) Obtaining rice OsAP25 gene mutants through Agrobacterium-mediated genetic transformation;

[0020] (3) Analyze rice mutants, identify and screen homozygous mutants with frameshift mutations in the OsAP25 protein;

[0021] (4) The seedling drought stress phenotype and related physiological indicators of the screened homozygous mutant rice and wild-type rice were identified to obtain rice materials or varieties with improved resistance to drought stress.

[0022] In one implementation, the method further includes step (5), analyzing the expression of genes related to drought stress response in the seedling stage of the obtained mutants to obtain rice materials or varieties with improved resistance to drought stress that are stably inherited over a long period of time.

[0023] Technical effect

[0024] 1. This invention is the first to discover the successful creation of loss-of-function mutants (CRS2, CRS6, and CRS10) by editing the rice aspartic protease gene OsAP25 using CRISPR-Cas9 technology. DNA sequencing analysis revealed that 6, 14, and 10 bases were deleted after positions 425, 426, and 427 of the coding region of this gene (as shown in ID NO2), respectively, resulting in a frameshift in OsAP25 translation. Drought treatment (35℃, 5 days) showed that most leaves of the wild type curled due to water loss, while the leaves of all mutant lines unfurled. After rehydration (35℃, 3 days), the survival rates of CRS6 and CRS10 were significantly higher than those of the wild type, at 20% and 65%, respectively. Measurements of chlorophyll, MDA, and ion permeability further confirmed the physiological basis of the mutants' drought tolerance.

[0025] 2. This invention found that inactivation of the OsAP25 gene enhanced the expression of drought-related genes (OsbZIP23, OsbZIP66, OsbZIP72, OsDREB2A, OsDREB2B, OsDREB1E, OsLEA3, RAB21). These results indicate that OsAP25 gene editing can improve the resistance of rice to drought stress.

[0026] 3. The experimental results of this invention show that the OsAP25 gene can be used to genetically improve the drought resistance of rice through gene editing technology, opening up research and application directions for improving the stress resistance and yield of rice. Attached Figure Description

[0027] Figure 1 Schematic diagram of the gene editing vector pHUN4c12.

[0028] Figure 2The DNA sequencing and mutation identification comparison results of gene-edited rice osap25 show that the gene-edited lines CRS-2, 6, and 10 have base deletions at positions 425, 426, and 427 in their coding region, respectively, resulting in frameshift mutations in the gene. Thus, gene-edited rice materials with this gene mutation were successfully obtained.

[0029] Figure 3 The DNA sequencing and mutation identification comparison results of gene-edited rice osap25 show the sequencing and comparison results of OsAP25 in mutant and wild-type. CRS-2, 6, and 10 represent different gene-edited lines. NIP represents the DNA sequence of OsAP25 (Os03g08790) in the database. The underlined part represents the PAM sequence of OsAP25 gene editing.

[0030] Figure 4 OsAP25 protein sequence analysis in gene-edited rice. NIP represents the protein sequence of OsAP25 (Os03g08790) in the database, and CRS-2, 6, and 10 represent the protein sequences of different gene-edited lines.

[0031] Figure 5 Phenotypic results of the osap25 mutant under drought stress. (A) Growth status of transgenic plants before drought stress treatment, 5 days after drought treatment, and 3 days after rehydration; (B) Survival statistics (n=3, 24 plants per replicate); (C) Chlorophyll content determination; (D) Relative ion permeability; (E) Malondialdehyde (MDA) content; (F) Superoxide dismutase (SOD) activity; (G) Catalase (CAT) activity. Note: Standard error is based on three biological replicates; T-test uses a two-tailed test; **p≤0.01 or *p≤0.05.

[0032] Figure 6 Expression analysis of drought stress response-related genes. (A) Expression levels of OsbZIP23, OsbZIP66, OsbZIP72, OsDREB2A, OsDREB2B, OsDREB1E, OsLEA3, and RAB21 in osap25. OsActin was used as an internal control; standard error was based on three biological replicates; two-tailed T-test was used; **p≤0.01 or *p≤0.05. Detailed Implementation

[0033] The present invention will now be further described with reference to embodiments, but it is not limited to any one of these embodiments or similar examples.

[0034] Example 1: Construction of the OsAP25 gene editing vector:

[0035] A sgRNA (i.e., PAM sequence, CCAGGGCCAGGCGTGCCCGGCGC) was designed using a DNA sequence specific to the coding region of the OsAP25 nucleotide sequence (as shown in SEQ ID NO:1). Two oligo DNA sequences were then synthesized and cloned into pHUN4c12. Figure 1 The gene-editing vector PHUN4c12-PAM was constructed (PHUN4c12 vector was developed by the research team of Zhejiang University. It is a gene-editing vector based on the CRISPR / Cas9 system and is often used for gene function research and genetic improvement in plants such as rice (Xu et al., 2014, Rice(NY), 7(1):5)). Then, PHUN4c12-PAM was transformed into rice Nipponbare using transgenic technology. The sgRNA-mediated Cas9 nuclease was used to specifically recognize and target the target site, and the mutation was introduced using the intracellular error-prone repair mechanism. Finally, gene-edited rice material with OsAP25 gene mutation was obtained.

[0036] Gene editing vector construction method: First, a PAM sequence (CCAGGGCCAGGCGTGCCCGGCGC) was designed targeting the OsAP25 gene using CRISPR Primer Designer v1.1.2. Two oligo DNA primers were then synthesized (LP: TGGCGCCAGGGCCAGGCGTGCCCGGCGC, RP: ...).

[0037] The two synthesized primers (AAACGCGCCGGGCACGCCTGGCCCTGG) were annealed and ligated into the pHUN4c12 vector digested with BsaI to obtain the OsAP25 gene editing vector PHUN4c12-PAM, which was then introduced into Agrobacterium tumefaciens EHA105.

[0038] Example 2: Creation of OsAP25 gene-edited rice materials

[0039] The method for creating OsAP25 gene-edited rice using Agrobacterium-mediated infection is as follows:

[0040] 1) Induction and subculture of rice embryo callus: Rice seeds were dehulled (using Japanese yogurt), soaked in 75% ethanol for 1 min, then soaked in sodium hypochlorite solution for 30 min, rinsed with sterile water, and repeatedly soaked in sodium hypochlorite for 15 min, then rinsed with sterile water. The sterilized rice seeds were air-dried on sterile filter paper and planted in induction medium. Incubation was carried out in the dark at 28℃ for 2 weeks. Callus tissue was isolated and transferred to induction medium, subcultured 3 times at 28℃. Pale yellow, loosely textured callus particles were selected and incubated in the dark at 28℃ for 3 days.

[0041] 2) Activation and propagation of strains: Agrobacterium containing the gene editing vector pHUN4c12-PAM was streaked on YEB solid medium for 2 days at 28℃.

[0042] 3) Co-culture of Agrobacterium and callus: Take an appropriate amount of bacterial cells and suspend them in 100 μM AS+AA liquid medium. When the OD value of the bacterial solution reaches 0.3, immerse the callus in the bacterial solution and gently shake for 20 minutes. Discard the bacterial solution, remove the callus, filter out the excess bacterial solution, and transfer it to NB solid medium for dark incubation at 22℃ for 3 days.

[0043] 4) Screening for resistant callus: Select co-cultured callus tissue, rinse with sterile water, filter dry, and spread on screening medium. Incubate in the dark at 28°C for 2 weeks, and then subculture once.

[0044] 5) Predifferentiation and differentiation: Select vigorous, milky-white callus tissue and transfer it to predifferentiation medium. Culture in the dark at 28°C for 1 week, then culture in the light at 28°C for 2 weeks. Subculture once more, and after 4 weeks, it will differentiate into seedlings.

[0045] 6) Rooting and seedling strengthening: Transfer the seedlings with better growth to the rooting medium and transplant them after 2 weeks of cultivation.

[0046] 7) Transplant normally growing transgenic seedlings to a greenhouse for cultivation until seed harvest.

[0047] 8) Seedlings of the obtained transgenic positive plants were used to obtain T1 and higher generation seeds through multiple generations.

[0048] Example 3: DNA sequence mutation analysis of OsAP25 in gene-edited materials:

[0049] (I) Extraction of DNA from OsAP25 gene-edited rice materials using the CTAB method

[0050] 1. Preparation of CTAB solution: Weigh 16.7g of CTAB and 68.4g of NaCl and dissolve them in ddH2O. Then add 83.5mL of 1M Tris-HCl (pH 8.0) and 33.4mL of 0.5M EDTA, and bring the volume to 1L. Autoclave at 121℃ for 15min and store at room temperature for later use.

[0051] 2. Take 0.1g of fresh rice leaves and put them into a 2mL EP tube containing steel balls. After freezing in liquid nitrogen for 20min, crush them into powder using a Geno / Grinder mill.

[0052] 3. Add 800 μL of CTAB extraction solution to each centrifuge tube, shake well, and place in a 65°C water bath for 45 min, gently mixing 1-2 times every 10 min.

[0053] 4. After the sample has been cooled to room temperature, remove it from the water bath and add 400 μL of chloroform / isoamyl alcohol (v / v = 24:1) extraction buffer to each centrifuge tube. Gently invert to mix and let it stand at room temperature for 30 min for extraction.

[0054] 5. Centrifuge at 12000 rpm at room temperature for 10 min, aspirate the supernatant and transfer it to a new 1.5 mL EP tube, add 700 μL of pre-cooled isopropanol, gently invert and mix, and precipitate at -20 °C for at least 20 min.

[0055] 6. After DNA precipitation, centrifuge at 12000 rpm at 4℃ for 10 min, discard the supernatant, and wash with 700 μL of 75% ethanol;

[0056] 7. Centrifuge at 12000 rpm for 5 min at 4℃, discard the supernatant, and dry in a clean bench;

[0057] 8. Add 100 μL of sterile RNase water to dissolve the precipitate, and place it in a 37℃ oven for digestion for 1-2 hours;

[0058] 9. DNA quality was determined by agarose gel electrophoresis and stored at -20℃ for later use.

[0059] (II) PCR amplification and sequence analysis of gene-edited rice genomic DNA

[0060] OsAP25 primers (OsAP25-F: GTGACACTCTCTTAGCAAGCA; OsAP25-R: CACGCACCCGAACGTGTA) were synthesized. PCR amplification was performed using DNA from different gene-edited strains as templates. The 648 bp PCR product was sequenced, and the sequenced DNA was compared with the OsAP25 DNA sequence in the NCBI Genome Database. Analysis revealed that the gene-edited strains CRS-2, 6, and 10 had base deletions at positions 425, 426, and 427 in their coding regions, respectively. Figure 2 This process resulted in a frameshift mutation in the gene, leading to the successful acquisition of gene-edited rice materials with this gene mutation. NIP represents the OsAP25 gene sequence from the NCBI database, and CRS-2, 6, and 10 represent the gene sequences of the gene-edited lines. The underlined portion represents the PAM sequence of the OsAP25 gene editing (…). Figure 3 ).

[0061] Example 4: Protein sequence analysis of OsAP25 in gene-edited materials

[0062] Based on the alignment analysis of the mutated DNA sequence with the corresponding protein sequence, it was found that osap25 exhibited frameshift mutations due to the deletion of 6, 14, and 10 bases after positions 425, 426, and 427, respectively. Specifically, CRS2 and CRS6 experienced frameshifts after amino acid 143; CRS10 experienced a frameshift after amino acid 142, and premature translation termination occurred at amino acid 181 due to the frameshift. NIP represents the OsAP25 protein sequence from the NCBI database, and CRS-2, 6, and 10 represent the protein sequences of the gene-edited strains. Figure 4 This indicates that gene editing leads to the loss of protein function of this gene in rice.

[0063] Example 5: Phenotypic identification of osap25 mutant seedlings under drought stress

[0064] Seeds of the identified homozygous mutants osap25 (CRS2, CRS6, CRS10) and the wild-type rice variety Nipponbare were germinated in a 35℃ incubator. Seeds with consistent germination were selected for sowing. After growing for one month under 14h light / 10h dark conditions, the plants were subjected to a 5-day drought stress treatment (35℃). Three days after rehydration, the homozygous mutant plants showed a significantly enhanced drought resistance phenotype compared to the wild type. Figure 5 Survival rate statistics show that the survival rates of CRS6 and CRS10 reached 20% and 65% respectively, while the survival rate of wild-type plants was only 2%. Figure 5 These results indicate that OsAP25 inactivation enhances rice seedling tolerance to drought stress.

[0065] The survival rate is calculated as: (Number of surviving individuals / Total number of individuals) × 100%

[0066] Implementation Case 6: Measurement of Relevant Physiological Indicators of Mutants under Drought Stress

[0067] Drought treatment was applied to osap25 mutants (CRS6 and CRS10) and wild-type rice seedlings, and a series of key physiological indicators were measured to reveal the physiological basis of their drought tolerance. Five days after drought treatment, osap25 exhibited a significantly enhanced drought tolerance phenotype. Specifically, after drought stress treatment, the chlorophyll content in the mutants (CRS6 and CRS10) was 35% and 40% higher than that in the wild type, respectively. Figure 5 The ion permeability was 69.5% and 61% of the wild type. Figure 5 Malondialdehyde (MDA) was only 66% and 25% of that in the wild type. Figure 5 Furthermore, enzyme activity assays showed that the activities of SOD and POD in the mutant were significantly higher than those in the wild type, by 19% and 20%, respectively. Figure 5In summary, the OsAP25 loss-of-function mutant can maintain chlorophyll content, reduce membrane lipid peroxidation damage, and enhance antioxidant enzyme activity, thereby improving rice's tolerance to drought stress.

[0068] The specific methods for measuring the relevant physiological indicators are as follows:

[0069] Method for determining chlorophyll content: Take 0.1g of plant material and extract it with extraction solution (acetone: anhydrous ethanol: distilled water = 4.5:4.5:1 (v / v)) until the plant tissue turns white. Centrifuge at 12000rpm for 10min at 4℃. Take the supernatant and measure the absorbance at 663nm and 645nm.

[0070] Calculation formula: Total chlorophyll content (mg / g fresh weight) = (20.21 × A) 645 +8.02×A 663 )×V×D÷M÷1000

[0071] V: Extract volume; D: Dilution factor; M: Fresh weight of sample, g

[0072] Ion permeability determination method: Flag leaves of wild-type and osap25 mutant plants were cut into equal-sized segments and placed in test tubes containing 20 mL of double-distilled water, then shaken for 12 h. The initial conductivity (G1) was measured using a conductivity meter. The test tubes with the leaflets were then placed in boiling water for 10 min, allowed to cool naturally to room temperature, and the final conductivity (G2) was measured. Ion permeability is the ratio of G1 to G2.

[0073] Method for determining malondialdehyde (MDA) content: Leaves before and after drought treatment were collected, ground with liquid nitrogen, and mixed with 5% (w / v) TCA buffer. The mixture was centrifuged at 12000 rpm, and the supernatant was mixed with TBA buffer (0.5 mL of 20% (w / v) trichloroacetic acid containing 0.5% (w / v) thiobarbituric acid). The mixture was reacted at 100℃ for 10 min, and then immediately cooled in an ice bath. After centrifugation at 12000 rpm for 10 min, the supernatant was collected, and the A content was determined by spectrophotometry. 450 、A 532 and A 600 The absorbance value.

[0074] The calculation formula is: MDA (mmol.g) -1 .FW)=[6.452×(A 532 -A 600 )-0.559×A 450 ×(Vt÷Vs÷W)

[0075] Vt: Total volume of extract (mL)

[0076] Vs: Volume of extract used for determination (mL)

[0077] W: Fresh weight of sample (g)

[0078] Antioxidant enzyme activity assay: Weigh 0.1 g of rice sample, grind with liquid nitrogen, add 1 mL of extraction buffer (0.1 M PBS, 1 mM EDTA, 1% (w / v) polyvinylpyrrolidone, pH 7.8), centrifuge at 12000 rpm for 20 min at 4 °C. Transfer the supernatant to a 1.5 mL EP tube as the test solution and store at 4 °C.

[0079] SOD activity was determined using the photoreduction method.

[0080] 1. Preparation of SOD reaction solution: Methionine (Met): Weigh 1.162g Met, dissolve in PBS (0.1M, pH 7.8) buffer, and bring the volume to 200mL; Nitrotetrazole Blue Chloride (NBT): Weigh 0.092g NBT, dissolve in PBS (0.1M, pH 7.8) buffer, and bring the volume to 100mL; Riboflavin (FD): Weigh 10mg FD, dissolve in PBS (0.1M, pH 7.8) buffer, and bring the volume to 500mL (prepare fresh before use). SOD reaction solution: Met (3mL) + FD (0.6mL) + NBT (0.6mL) + PBS (1.76mL)

[0081] 2. Take test tubes of the same type, pipette 0.04 mL of the test solution, add it to 5.96 mL of reaction solution and mix well to form the test tube; at the same time, take four test tubes, three as controls and one as a blank (without the test solution, use PBS instead, i.e., 0.04 mL PBS). Place the blank in the dark, and place the control (CK) tube and the test tube in an incubator under light for 6 minutes (try to keep the light conditions the same). Terminate the reaction by blocking out the light, zero the instrument with the blank, and measure the color at 560 nm.

[0082] The results were calculated as follows: Total SOD activity (absorbance / g, FW) = (A CK -A E )*V / (W*0.5*A CK )

[0083] Unit: NBT light reduction 50% is the unit; A CK Extinction value of the light-illuminated control tube; A E : Extinction value of the test tube; V: Total volume of sample added (mL); FW: Sample weight (g).

[0084] CAT activity was determined using the ammonium molybdate method.

[0085] Reagent preparation: (1) 65 μmol / L hydrogen peroxide solution: Take 0.738 mL of 30% H2O2 and add 0.1 mol / L phosphate buffer (pH 7.4) to 100 mL.

[0086] (2) 32.7 mmol / L ammonium molybdate solution: Weigh out (NH4)6Mo7O 24 . 4.04g of 4H2O was dissolved in 100mL of distilled water.

[0087] Enzyme extraction: Weigh 0.1g of fresh plant leaves, cut them into small pieces and put them into a pre-cooled mortar. Add 0.1mol / L phosphate buffer (pH 7.4), grind them into a homogenate in an ice bath, centrifuge at 12000rpm for 15min at 4℃, and take the supernatant to obtain catalase extract. Determination: (1) Place the reagents in Table 1 in a water bath at 37℃ for 5min (hydrogen peroxide is easily decomposed, so 5min at room temperature is sufficient). Then take 3 10mL test tubes, one of which is a standard tube and the other is a test tube.

[0088] (2) After adding phosphate buffer and enzyme solution to the control tube, and after adding phosphate buffer to the standard tube, hydrogen peroxide solution and ammonium molybdate solution were added simultaneously and shaken well. For the test tube: after adding phosphate buffer and enzyme solution, hydrogen peroxide solution was added first, and the tube was incubated at 37°C for 1 min (enzyme reaction time), and then ammonium molybdate solution was added immediately and shaken well.

[0089] (3) After standing for 30 minutes, zero the colorimetric reading at 405 nm with distilled water. Record the absorbance value of each tube (A405).

[0090] Table 1. Sample solution preparation table for H2O2 determination by ultraviolet absorption method.

[0091]

[0092]

[0093] Result calculation:

[0094] Calculate the catalase activity in the sample based on the measured absorbance (A405) using the following formula. One unit of enzyme activity is defined as the decomposition of 1 μmol / L H2O2 per gram of fresh sample per minute.

[0095] catalase activity

[0096] In the formula, A 对 、A 测 and A 标 The absorbance values ​​are for the control tube, the test tube, and the standard tube, respectively; W is the fresh weight of the material (g); 65 is the concentration of the hydrogen peroxide solution (μmol / L); and 0.5 is the volume of the hydrogen peroxide solution (mL).

[0097] Implementation Case 7: Expression analysis of genes related to drought stress response in osap25 mutant seedlings:

[0098] The expression of drought stress response genes in 2-week-old wild-type and osap25 mutant rice seedlings was detected using qPCR. The results showed that the expression levels of several drought stress response genes were significantly upregulated in the osap25 mutant compared to the wild-type. Figure 6 The results indicate that inactivation of the OsAP25 gene can enhance the expression of drought-resistant genes in rice and affect the drought stress response mechanism in rice. The drought stress response-related genes detected include OsbZIP23, OsbZIP66, OsbZIP72, OsDREB2A, OsDREB2B, OsDREB1E, OsLEA3, and RAB21.

[0099] Rice RNA extraction method: RNA was extracted using the Trizol universal total RNA extraction kit from Tiangen. The consumables used for RNA extraction were enzyme-free RNA pipette tips and EP tubes from Aisjin. The specific procedures are as follows:

[0100] (1) Take about 0.1g of rice material and place it in a 2.0mL EP tube containing clean steel balls, and quickly freeze it in liquid nitrogen. Then use a plant tissue disruptor to break the plant material into powder.

[0101] (2) Add 1 mL of Trizol reagent to the fume hood, mix by inversion, place on ice for 5 min, and centrifuge at 12000 rpm for 10 min at 4℃.

[0102] (3) After centrifugation, take the supernatant and add it to a new 1.5 mL centrifuge tube, then add 200 μL of pre-cooled chloroform, shake vigorously, and place on ice for 5 min;

[0103] (4) Centrifuge at 12000 rpm for 10 min at 4℃, and transfer the supernatant to a new RNase-Free centrifuge tube;

[0104] (5) Add 500 μL of pre-cooled isopropanol, mix by inverting the container, and place at -80°C for 20 min.

[0105] (6) Centrifuge at 12000 rpm for 10 min at 4℃ and discard the supernatant;

[0106] (7) Add 1 mL of 75% ethanol to wash, centrifuge for 5 min, and dry in a clean bench for 5 min;

[0107] (8) Add 40 μL of RNase-Free Water to obtain an RNA solution;

[0108] (9) Detection of total RNA quality, i.e., electrophoresis detection, to see if it has three clear bands of 28s, 18s and 5s;

[0109] Preparation of the first strand of cDNA: The extracted mRNA was reverse transcribed into cDNA using the abm 5×All-In-One RT MasterMix kit.

[0110] The reaction system is as follows:

[0111] Total RNA: 12μL, Mix: 8μL

[0112] RNase-free ddH2O: 12 μL

[0113] After gently mixing with a pipette, the reverse transcription product was amplified at 37℃ for 10 min, 55℃ for 30 min, and 95℃ for 5 min. The resulting reverse transcription product was then stored at -20℃ for later use.

[0114] qPCR detection of related gene expression: Real-time quantitative PCR was performed using ChamQ Universal SYBR qPCR Master Mix (Novizan).

[0115] qPCR reaction mixture (20 μL)

[0116] cDNA first-strand template: 1 μL

[0117] Forward primer: 1 μL

[0118] Reverse primer: 1 μL

[0119] ChamQ Universal SYBR qPCR Master Mix: 10μL

[0120] ddH2O: 7μL

[0121] The qPCR conditions were 95℃ for 10 min, 95℃ for 15 s, 60℃ for 30 s, 95℃, 60℃ for 1 min, for a total of 40 cycles. OsActin was used as an internal control, and 2... -ΔΔCt The relative expression level of the target gene was calculated using this method. Each RT-qPCR experiment was biologically replicated at least twice, with similar results, and each replicate consisted of three technical replicates.

[0122] Table 2: The primers used in the experiment are as follows:

Claims

1. Mutants CRS2, CRS6 and CRS10 from the rice aspartic protease gene OsAP25, wherein the mutants have gene sequences as shown in SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6, respectively.

2. The mutant according to claim 1, wherein CRS2, CRS6 and CRS10 are respectively Osap25-2 mutant, Osap25-6 mutant and Osap25-10 mutant, and their cDNA sequences are the gene sequences shown in SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9, respectively.

3. The mutant according to claim 1 or 2, wherein the DNA sequence, cDNA sequence and amino acid sequence of the wild-type rice aspartic protease gene OsAP25 are the sequences shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, respectively.

4. A mutant protein encoded by the gene of claim 1, 2 or 3.

5. The mutant according to claim 4, wherein the amino acid sequence of the mutant has the gene sequence shown in sequences SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, respectively.

6. The mutant according to claim 4 or 5, wherein the DNA sequence, cDNA sequence and amino acid sequence of the wild-type rice aspartic protease gene OsAP25 are the sequences shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, respectively.

7. A method for obtaining rice materials or varieties with enhanced resistance to drought stress by inactivating the OsAP25 gene in rice plants using the mutant gene described in claims 1-3 or the mutant protein described in claims 4-6.

8. The method according to claim 7, wherein by designing sgRNA to mediate Cas9 nuclease to specifically recognize and target the target site by the specific target DNA sequence of OsAP25, and by introducing mutations using intracellular error-prone repair mechanisms, resulting in mutations in the OsAP25 gene in gene-edited rice, thereby improving the resistance of gene-edited rice to drought stress.

9. The method according to claim 7 or 8, wherein the step comprises: (1) Design an sgRNA sequence based on the DNA sequence specific to the coding region of the OsAP25 nucleotide sequence shown in SEQ ID NO:1, and then clone and construct a gene editing vector using specific primers. The sgRNA sequence is a PAM sequence: CCAGGGCCAGGCGTGCCCGGCGC. (2) Obtaining rice OsAP25 gene mutants through Agrobacterium-mediated genetic transformation; (3) Analyze rice mutants, identify and screen homozygous mutants with frameshift mutations in the OsAP25 protein; (4) The seedling drought stress phenotype and related physiological indicators of the screened homozygous mutant rice and wild-type rice were identified to obtain rice materials or varieties with improved resistance to drought stress.

10. The method according to claim 9, including step (5), analyzing the expression of genes related to drought stress response in the seedling stage of the obtained mutant to obtain rice materials or varieties with improved long-term stable heritability to drought stress.

Images