Capsid armed adenovirus carrying antigen in pIX region, construction method and application

By introducing exogenous antigen genes into the pIX region of adenovirus type 5, a capsid-armed adenovirus was constructed, solving the problem of pIX region modification, achieving efficient and stable exogenous antigen presentation and strong immune response, and providing an innovative platform for multifunctional vaccines and gene therapy.

CN120843601AActive Publication Date: 2025-10-28TONGJI HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI TECH
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511377276.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-25
Publication Date
2025-10-28
Estimated Expiration
2045-09-25

AI Technical Summary

Technical Problem

The high difficulty in modifying the pIX region of adenovirus vectors in existing technologies limits their application in carrying and expressing exogenous antigens, thus affecting the potential of adenovirus vectors.

Method used

A foreign antigen gene was introduced into the pIX region of the minor capsid protein of adenovirus type 5, and a capsid-armed adenovirus was constructed using homologous recombination technology. The pIX region was used as a display platform to present the foreign antigen at high density. BJ5183 competent cells were used for the operation to ensure efficient and accurate recombination.

Benefits of technology

It achieves efficient and stable high-density presentation of exogenous antigens on the surface of adenovirus, significantly increases the effective concentration of antigens, can induce stronger and more lasting specific immune responses, and has dual-function gene delivery and surface antigen presentation capabilities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843601A_ABST
    Figure CN120843601A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of bioengineering, in particular to a capsid armed adenovirus carrying an antigen in a pIX region, a construction method and application. Introducing an exogenous antigen gene into a secondary capsid protein pIX region of the type 5 adenovirus to form a capsid armed adenovirus; the type-5 adenovirus specifically has E1 region and E3 region deletion. According to the construction method, pIX is used as a display platform, an exogenous antigen can be presented on the surface of a virus in a high-density and high-repeatability manner, the effective concentration of the antigen is greatly improved, and stronger and more lasting specific immune response is expected to be induced; the modified pIX protein has smaller influence on packaging, assembling and structural stability of viruses and infection ability on target cells; the adenovirus can realize dual functions of gene delivery and surface antigen presentation, and provides an innovative technical platform for developing multifunctional and high-titer vaccines or gene therapy drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and more specifically, to capsid-armed adenoviruses carrying antigens in the pIX region, their construction methods, and applications. Background Technology

[0002] Gene therapy, as an emerging treatment method, has received considerable attention in the medical field in recent years. Its basic principle is to introduce exogenous genes into a patient's body to correct or compensate for diseases caused by gene defects, or to combat specific diseases by endowing cells with new functions. Adenovirus vectors, due to their high infectivity, strong gene carrying capacity, and mature production technology, have become one of the most commonly used vectors in gene therapy research and application. The applications of adenovirus vectors are wide-ranging, not limited to gene therapy, but also including vaccine development and oncolytic virus research, demonstrating their enormous potential in cancer immunotherapy and related fields.

[0003] Currently, the modification of adenovirus vectors mainly focuses on modifying gene regions such as E1 and E3 to achieve efficient expression of foreign genes. For example, by inserting antigen-coding sequences into the E1 region, adenovirus vectors for vaccination can be constructed; while in the development of oncolytic viruses, researchers often enhance the virus's specific killing ability against tumor cells by inserting target genes into the E3 region. However, there is relatively little research on the modification of pIX (protein IX), an important component of the adenovirus capsid protein. pIX plays an important role in the structural stability and assembly of adenoviruses, but due to the high technical difficulty of modifying the adenovirus genome, especially since modifications to the pIX region may lead to the virus failing to assemble normally or losing its biological activity, the development and utilization of the pIX region has been limited.

[0004] Nevertheless, pIX is expressed at high levels in adenoviruses, and its potential functions have not yet been fully explored and utilized. Currently, the application potential of adenovirus vectors is somewhat limited due to the lack of effective techniques for carrying and expressing exogenous antigens in the pIX region. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a capsid-armed adenovirus carrying antigens in the pIX region, its construction method and application.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: This invention provides a method for constructing a capsid-armed adenovirus carrying an antigen in the pIX region. A foreign antigen gene is introduced into the pIX region of a type 5 adenovirus to form a capsid-armed adenovirus; wherein the type 5 adenovirus specifically has deletions in the E1 and E3 regions.

[0007] Based on the above technical solution, the present invention can be further improved as follows.

[0008] Furthermore, the following steps are included: Linearize the first adenovirus backbone plasmid; synthesize the pIX-del adenovirus backbone recombinant fragment with pIX gene deletion in vitro; The linearized first adenovirus backbone plasmid and pIX-del were co-transformed into competent cells to obtain the second adenovirus backbone plasmid. Linearize the second adenovirus backbone plasmid; prepare a pIX-target gene fusion expression fragment containing the pIX sequence and the antigen gene sequence; The linearized second adenovirus backbone plasmid and the fusion expression fragment were ligated in vitro to obtain a recombinant plasmid, which was then packaged and purified to obtain the capsid-armed adenovirus.

[0009] Furthermore, the gene sequence of the pIX-del is shown in SEQ ID No. 1.

[0010] Furthermore, the pIX-target gene fusion expression fragment includes, from the N-terminus to the C-terminus, the complete coding region of the pIX gene, a flexible linker sequence, and the target gene sequence.

[0011] Furthermore, the flexible linker sequence is shown in SEQ ID No. 3.

[0012] Furthermore, the antigen gene sequence is an HPV antigen gene sequence or an OVA antigen gene sequence.

[0013] Furthermore, the first adenovirus backbone plasmid is adenovirus type 5, with deletions of 1-3523nt in region E1 and 28130-30820nt in region E3, and a CMV-MCS-polyA expression cassette inserted in region E1.

[0014] Furthermore, the first adenovirus backbone plasmid is BJ5183-pADeasy plasmid, and the competent cells are BJ5183 competent cells.

[0015] The present invention also provides a capsid-armed adenovirus carrying an antigen in the pIX region, which is constructed using the method described above.

[0016] The present invention also provides the application of the capsid-armed adenovirus as described above, which can be used to prepare vaccines or gene therapy drugs.

[0017] The beneficial effects of this invention are as follows: (1) The method for constructing capsid-armed adenovirus with antigens carried in the pIX region of the present invention can introduce exogenous antigen genes into a mature type 5 adenovirus vector backbone to construct a pIX modified adenovirus. (2) The method for constructing capsid-armed adenovirus with antigens carried in the pIX region of the present invention adopts homologous recombination technology based on BJ5183 competent cells. The steps are clear and the operation is reliable. It can accurately and efficiently delete and insert large fragments at specific sites of the adenovirus backbone, which significantly improves the success rate and efficiency of constructing complex recombinant adenovirus plasmids.

[0018] (3) The capsid-armed adenovirus carrying antigens in the pIX region of the present invention utilizes pIX as a display platform to present exogenous antigens on the surface of the virus with high density and high repeatability, which greatly improves the effective concentration of antigens and is expected to induce stronger and more durable specific immune responses. (4) The capsid-armed adenovirus carrying antigens in the pIX region of the present invention has less impact on viral packaging, assembly, structural stability and infection ability of target cells by modifying the pIX protein; (5) The capsid-armed adenovirus carrying antigens in the pIX region of the present invention can not only express conventional therapeutic or preventive genes (such as genes inserted in the traditional E1 deletion region) in the host cell through its genome, but also directly stimulate the immune system through the pIX fusion antigen on the capsid surface, realizing the dual functions of "gene delivery" and "surface antigen presentation", providing an innovative technical platform for the development of multifunctional and high-potency vaccines or gene therapy drugs. Attached Figure Description

[0019] Figure 1 This is a flowchart illustrating the preparation process of Example 1 of the present invention; Figure 2 This is a schematic diagram of the construction of PAd-pIX-HPV16-E6 in Embodiment 1 of the present invention; Figure 3 The genome map of PAd-pIX-HPV16-E6 virus in Embodiment 1 of the present invention; Figure 4 This is a Western Blot electrophoresis image of the PAd-pIX-HPV16-E6 expressed antigen in Example 2 of the present invention. Figure 5 This is a graph showing the detection results of specific antibodies against HPV E6 in an SD rat model in Example 3 of the present invention. Figure 6 This is a graph showing the detection results of IFN-γ in an SD rat model in Example 4 of the present invention; Figure 7 This is a schematic diagram of the gene structure of PAd-pIX-OVA in Example 5 of the present invention; Figure 8 This is an electron micrograph of the viral particles of PAd-pIX-OVA in Example 5 of the present invention. Detailed Implementation

[0020] The principles and features of the present invention are described below. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0021] The present invention discloses a method for constructing a capsid-armed adenovirus carrying antigens in the pIX region, wherein a foreign antigen gene is introduced into the pIX region of the minor capsid protein of adenovirus type 5 to form a capsid-armed adenovirus; wherein the adenovirus type 5 specifically has deletions in the E1 and E3 regions.

[0022] The present invention provides a method for constructing a capsid-armed adenovirus with an antigen carried in the pIX region. Based on a mature type 5 adenovirus vector backbone, the coding gene for the minor capsid protein pIX located between the E1 and E2 regions is knocked out at specific points using homologous recombination technology. This results in the construction of a novel universal backbone plasmid that can be used for subsequent insertion of a "pIX-target gene" fusion expression cassette. Then, exogenous antigen genes are introduced through this plasmid to efficiently construct a pIX-modified adenovirus.

[0023] Specifically, pIX is a minor capsid protein of adenovirus, but there are up to 240 copies on the surface of each mature viral particle. This invention utilizes pIX as a display platform to present exogenous antigens on the viral surface with high density and high reproducibility, greatly increasing the effective concentration of antigens and potentially inducing stronger and more durable specific immune responses.

[0024] Furthermore, compared to modifying the major capsid proteins of adenovirus (such as Hexon and Fiber), modifying the pIX protein has less impact on viral packaging, assembly, structural stability, and ability to infect target cells.

[0025] Preferably, the method of the present invention includes the following steps: The first adenovirus backbone plasmid was linearized; the pIX gene-deleted adenovirus backbone recombinant fragment pIX-del was synthesized in vitro; the first adenovirus backbone plasmid was BJ5183-pADeasy plasmid.

[0026] Preferably, the product used in the BJ5183-pADeasy plasmid is pAdEasy-1, which has a deletion of 1-3523nt in the E1 region and a deletion of 28130-30820nt in the E3 region, with a CMV-MCS-polyA expression cassette inserted in the E1 region.

[0027] The linearized first adenovirus backbone plasmid and pIX-del were co-transformed into competent cells to obtain the second adenovirus backbone plasmid; preferably, the gene sequence of pIX-del is shown in SEQ ID No. 1; the competent cells were BJ5183 competent cells.

[0028] The homologous recombination technology based on BJ5183 competent cells employed has clear steps and reliable operation, enabling precise and efficient deletion and insertion of large fragments at specific sites in the adenovirus backbone, significantly improving the success rate and efficiency of constructing complex recombinant adenovirus plasmids.

[0029] Linearize the second adenovirus backbone plasmid; prepare a pIX-target gene fusion expression fragment containing the pIX sequence and antigen gene sequence.

[0030] Preferably, the pIX-target gene fusion expression fragment includes, from the N-terminus to the C-terminus, the complete coding region of the pIX gene, a flexible linker sequence, and the target gene sequence; the exogenous gene is fused to the C-terminus of the pIX protein, and this region is exposed on the capsid surface and has good flexibility, thereby ensuring the biological activity and preparation titer of the recombinant virus.

[0031] Preferably, the flexible linker sequence is shown in SEQ ID No. 3; this flexible linker does not affect the expression of the fusion protein, and can generate antibody immunity and specific cellular immunity in vivo.

[0032] Preferably, the antigen gene sequence is the HPV antigen gene sequence or the OVA antigen gene sequence.

[0033] The linearized second adenovirus backbone plasmid and the fusion expression fragment were ligated in vitro to obtain a recombinant plasmid, which was then packaged and purified to obtain the capsid-armed adenovirus.

[0034] The capsid-armed adenovirus of the present invention is constructed using the method described above. This adenovirus can induce a stronger and more durable specific immune response; simultaneously, this adenovirus can not only express conventional therapeutic or prophylactic genes (such as genes inserted into the traditional E1 deletion region) in host cells through its genome, but also directly stimulate the immune system through the pIX fusion antigen on the capsid surface, achieving the dual functions of "gene delivery" and "surface antigen presentation," providing an innovative technical platform for the development of multifunctional, high-potency vaccines or gene therapy drugs.

[0035] The capsid-armed adenovirus of this invention can be used to prepare vaccines or gene therapy drugs, providing new technical pathways and tools for cancer immunotherapy and gene therapy, and has important research value and application prospects.

[0036] The present invention will be illustrated by specific embodiments below.

[0037] Example 1: Construction of apovirus armed with capsid protein pIX The construction strategy of this embodiment is based on the AdEasy™ adenovirus vector system. The BJ5183-pADeasy plasmid used is itself a genetically engineered type 5 adenovirus (Ad5) genome, which comes from the Gynecologic Oncology Laboratory of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology.

[0038] The structural features of the BJ5183-pADeasy plasmid are: E1 region deletion: The deletion of most of the E1 region sequence (such as nucleotides 343-3523 of the Ad5 genome), which is crucial for viral replication, makes the virus a replication defective type in normal cells. It can only proliferate in packaging cell lines that supplement the expression of E1 protein (such as HEK293 cells), thus ensuring its safety.

[0039] Partial deletion in the E3 region: To accommodate larger exogenous genes and reduce the host's immune response, a partial sequence deletion exists in the E3 region.

[0040] Shuttle expression frame: At the E1 deletion site, an expression frame for expressing the foreign gene is pre-inserted. This frame typically contains a strong promoter, such as the enhancer and promoter of cytomegalovirus (CMV), downstream of which are one or more unique restriction endonuclease sites (e.g., the BstBI cleavage site in this example), and ends with a polyadenylation signal (polyA).

[0041] like Figure 1 and Figure 2 As shown, the specific preparation steps are as follows: (1) Linearization of BJ5183-pADeasy plasmid: BJ5183-pADeasy plasmid was linearized by digestion with restriction endonuclease BstBI.

[0042] The enzyme digestion reaction system consisted of: BJ5183-pADeasy plasmid (50 μg), BstBI restriction endonuclease, 10× buffer, and deionized water to make up the difference, for a total volume of 50 μL. The digestion conditions were 37℃ for 1 hour. After digestion, agarose gel electrophoresis was used to check for complete digestion, and the linearized plasmid product was recovered using a gel extraction kit. Its concentration and OD value were then measured.

[0043] (2) Preparation of adenovirus backbone recombinant fragment with pIX gene deletion: A DNA fragment for homologous recombination was obtained by in vitro gene synthesis and named "pIX-del".

[0044] The design features of pIX-del are that its two ends form homologous arms with the sequences upstream of the BstBI restriction site and downstream of pIX on the BJ5183-pADeasy plasmid, respectively, but the fragment itself does not contain the coding region of the pIX gene.

[0045] With this design, when the fragment is co-transformed with the linearized BJ5183-pADeasy plasmid into homologous recombination competent cells (BJ5183), the original pIX gene region of the BJ5183-pADeasy plasmid can be replaced through homologous exchange reaction, thereby achieving precise deletion of the pIX gene.

[0046] The optimized pIX-del sequence, as shown in SEQ ID No. 1, was synthesized by a professional company. The following primers were used for PCR amplification of pIX-del to obtain sufficient DNA for subsequent experiments.

[0047] pIX-del-F (SEQ ID No. 4): TGAAGCCAATATGATAATGAGG pIX-del-R (SEQ ID No. 5): CAGGGACATGCTTAACGAAG The PCR products were analyzed using 1% agarose gel electrophoresis to confirm that the bands were single and of the correct size. Subsequently, the target fragment was recovered and purified using a PCR product recovery kit. After determining its concentration and OD260 / 280 ratio, it was stored at -20℃ for later use.

[0048] (3) Constructing the adenovirus backbone plasmid pIX-basic with pIX gene deletion via homologous recombination: The linearized BJ5183-pADeasy plasmid recovered in step (1) and the “pIX-del” recovered in step (2) were co-transformed into BJ5183 competent cells. Using the intracellular homologous recombination system, an adenovirus backbone plasmid with the pIX gene further deleted on the basis of the original E1 and E3 deletion was obtained and named pADeasy-basic.

[0049] The specific operating steps are as follows: Take BJ5183 competent cells stored at -80℃ and thaw them on ice. After the bacterial block thaws, add 100 ng of the linearized BJ5183-pADeasy plasmid recovered in step 1 and 500 ng of "pIX-del" recovered in step 2, mix gently with a pipette, and incubate on ice for 10 min.

[0050] Centrifuge tubes were placed in a 42°C water bath for 90 seconds to undergo heat shock treatment, and then quickly transferred to ice to cool for 10 minutes.

[0051] Add 900 μL of antibiotic-free LB medium to a centrifuge tube and incubate at 37°C and 200 rpm for 60 min.

[0052] Centrifuge the bacterial culture at 4000 rpm for 5 min, discard most of the supernatant, resuspend the bacterial cells in the remaining approximately 100 μL of culture medium, and spread them evenly on LB solid medium plates containing kanamycin (final concentration 50 μg / mL).

[0053] Place the plate upside down in a 37°C incubator and incubate overnight for 12-16 hours.

[0054] The following day, well-grown single colonies were picked from the plates and subjected to colony PCR and Sanger sequencing for verification. The sequencing focused on comparing the pIX gene region, confirming that the pIX gene had been successfully knocked out and that the sequences of other regions of the backbone plasmid were correct, thus identifying the correctly identified recombinant strains.

[0055] The correctly sequenced strains were inoculated into LB liquid medium containing kanamycin for amplification culture, and then the target plasmid, pADeasy-basic, was extracted using a plasmid mini-extraction kit. This plasmid is the universal adenovirus backbone plasmid that deletes E1, E3 (partially), and pIX genes.

[0056] (4) Linearization of pADeasy-basic plasmid: To insert the subsequent "pIX-target gene" fusion fragment, the circular pADeasy-basic plasmid needs to be linearized. The pADeasy-basic plasmid extracted and verified in step (3) is digested with the restriction endonuclease BstBI. The BstBI restriction site is located downstream of the pre-placed CMV promoter in the E1 deletion region and is specifically designed for inserting exogenous target genes. The specific restriction reaction conditions, agarose gel electrophoresis detection, and product recovery methods are the same as those described in step (1).

[0057] (5) Preparation of pIX-target gene fusion expression fragment: In this embodiment, the exogenous gene is human papillomavirus type 16 E6 gene (HPV16-E6). A fusion gene fragment containing the complete coding region of the pIX gene, a flexible linker sequence, and the HPV16-E6 gene is obtained by in vitro gene synthesis.

[0058] The fragment is designed with sequences at both ends that match the ends of the pADeasy-basic plasmid linearized by BstBI in step (4) to facilitate efficient subsequent ligation. This fragment is named the pIX-HPV16-E6 fragment. The specific sequence of pIX-HPV16-E6 is shown in SEQ ID No. 2, and this fragment was synthesized by a professional company. The sequence of the linker used is shown in SEQ ID No. 3. The primers used are: pIX-HPV16-E6F (SEQ ID No. 6): CTCGAGCCTAAGCTTCGAAATAAGATATCCGATCCACCGG pIX-HPV16-E6R (SEQ ID No.7): TTTTTTATTTATGTTttaGCGTGTGCGGCTGCTGCGGC The synthesized pIX-HPV16-E6 fragment was amplified by PCR, and the bands were detected by agarose gel electrophoresis to ensure that the product bands were single and of the correct size. The pIX-HPV16-E6 fragment was recovered using a PCR product recovery kit, and its concentration and OD value were determined.

[0059] (6) Constructing the recombinant adenovirus plasmid PAd-pIX-HPV16-E6 carrying the pIX-target gene fusion sequence: The linearized pADeasy-basic backbone plasmid recovered in step (4) and the pIX-HPV16-E6 fragment recovered in step (5) were ligated in vitro. In this embodiment, a high-fidelity seamless ligation kit (such as HiFi Assembly Mix) was preferably used to precisely insert the pIX-HPV16-E6 fragment into the BstBI restriction site of the pADeasy-basic backbone plasmid. The ligation product was transformed into FasT1 competent cells for amplification. The transformed FasT1 strain was cultured and a high-purity final recombinant adenovirus plasmid was extracted using a plasmid extraction kit and named PAd-pIX-HPV16-E6. Sequencing verification confirmed the plasmid's sequence was correct.

[0060] (7) Packaging and purification yielded capsid-armed adenovirus PAd-pIX-HPV16-E6: First, the high-purity PAd-pIX-HPV16-E6 plasmid obtained in step (6) was linearized using the restriction endonuclease PacI to expose the terminal inverted repeat (ITR) sequence of the adenovirus genome. The PacI digestion conditions were: 37°C, reaction time 1-2 hours. The digestion product was purified for later use.

[0061] HEK293A cells were pre-seeded in cell culture plates. When the cell density reached 80%-90%, the linearized PAd-pIX-HPV16-E6 plasmid was transfected into the cells using liposome transfection reagent (Lipo3000).

[0062] After transfection, continue culturing the cells and observe the cell state and the appearance of cytopathic effect (CPE) daily. Obvious CPE is usually observed 7-10 days after transfection.

[0063] When CPE reaches 80% or higher, cell culture supernatant and cell pellet are collected, and viral particles are released through repeated freeze-thaw cycles. The presence of the virus is preliminarily identified using PCR methods targeting specific sequences of the viral genome.

[0064] The initially obtained viral fluid was used to infect a larger number of HEK293A cells (e.g., using a cell factory) to achieve large-scale viral amplification.

[0065] The amplified virus culture was collected and purified by ultracentrifugation with cesium chloride (CsCl) density gradient. After collecting the virus bands, CsCl was removed by dialysis.

[0066] The purified virus was titered, then aliquoted and stored at -80°C for an extended period to obtain the capsid-armed adenovirus PAd-pIX-HPV16-E6, whose genome map is shown below. Figure 3 As shown.

[0067] In addition, to verify the universality of the technical solution of the present invention, the same method as steps 1-7 above was used, except that the target gene in step 5 was replaced with the ovalbumin gene (OVA), and the capsid armed adenovirus PAd-pIX-OVA carrying the pIX-OVA fusion protein was successfully constructed and obtained.

[0068] The amino acid sequence of OVA is referenced below: .

[0069] The nucleic acid sequence references the CDS region of Gallus gallus ovalbumin (SERPINB14) (OVAL), mRNA-Nucleotide-NCBI.

[0070] Example 2: Identification of expression of capsid-armed adenovirus PAd-pIX-HPV16-E6 in in vitro cells. To verify whether the capsid-armed adenovirus PAd-pIX-HPV16-E6 constructed in Example 1 can successfully express its target gene in cells, this example performed in vitro expression identification.

[0071] HEK-293A cells cultured to the logarithmic growth phase in 6-well plates were inoculated with capsid-armed adenovirus PAd-pIX-HPV16-E6 at an MOI of 5, with uninfected cells serving as a control group. Cells were cultured for another 72 hours. Subsequently, cells were collected, and total protein was extracted using RIPA lysis buffer. Quantification was performed using the BCA method, and equal amounts of protein were analyzed by Western blotting. An antibody specifically recognizing human papillomavirus type 16 E6 protein was used as the primary antibody for detection.

[0072] like Figure 4 As shown, the results indicate that a specific band corresponding to the expected molecular weight of the pIX-E6 fusion protein can be detected in the cell lysate infected with PAd-pIX-HPV16-E6 virus, while no such band is found in the control group cells. This suggests that the capsid-armed adenovirus constructed in this invention can successfully express its target gene in vitro.

[0073] Example 3: Detection of humoral immune response induced by capsid-armed adenovirus PAd-pIX-HPV16-E6 in rats To evaluate the immunogenicity of the capsid-armed adenovirus PAd-pIX-HPV16-E6 constructed in Example 1 in vivo, this example tested its ability to induce a specific humoral immune response.

[0074] Female SD rats aged 6-8 weeks were selected. The experimental group was immunized with 5×10⁵ oz. intramuscular injection. 8 The control group received PFU containing PAd-pIX-HPV16-E6 virus, while the control group received an equal volume of PBS. Serum was collected from rats on day 14 post-immunization via orbital blood sampling. The level of E6-specific antibodies in the serum was detected using an indirect ELISA plate pre-coated with recombinant HPV16 E6 protein.

[0075] like Figure 5 As shown, the results indicate that, compared with the PBS control group, significantly higher levels of E6-specific antibodies were detected in the serum of rats immunized with PAd-pIX-HPV16-E6, demonstrating that the armed adenovirus of the present invention can effectively induce a specific humoral immune response against the target antigen in vivo.

[0076] Example 4: Detection of cellular immune response induced by capsid-armed adenovirus PAd-pIX-HPV16-E6 in rats To further verify the type of immune response induced by the adenovirus in Example 1, this example tested its ability to activate specific cellular immunity.

[0077] Using the same animal grouping and immunization methods as in Example 3, rats were sacrificed on day 14 post-immunization, and their spleens were harvested under aseptic conditions to prepare single-splenic cell suspensions. The number of T cells capable of secreting interferon-γ (IFN-γ) in spleen cells was detected using the rat IFN-γ ELISpot kit and a library of HPV16 E6-specific peptides as a stimulant.

[0078] like Figure 6 As shown in the results analysis, the spleen cells of rats in the PAd-pIX-HPV16-E6 immunization group produced a large number of IFN-γ secreting cellular spots after being stimulated by E6-specific peptides. The number of these spots was significantly higher than that of the PBS control group, which produced almost no spots. This indicates that the armed adenovirus of the present invention can effectively activate a specific cellular immune response against the target antigen in vivo.

[0079] Example 5: Successful construction and verification of PAd-pIX-OVA adenovirus like Figure 7 and Figure 8 As shown, the capsid-armed adenovirus PAd-pIX-OVA prepared in Example 1 was packaged, purified, and titered to obtain virus particles with infectious activity.

[0080] This result further demonstrates that the technical platform established in this invention, which fuses exogenous genes with pIX proteins and displays them on the surface of adenovirus capsids, is stable, reliable, and universally applicable. It can be used to carry a variety of different exogenous antigens to develop corresponding genetically engineered vaccines or immunotherapeutic drugs.

[0081] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A method for constructing a capsid-armed adenovirus with an antigen carried in the pIX region, characterized in that, An exogenous antigen gene is introduced into the pIX region of the minor capsid protein of adenovirus type 5 to form a capsid-armed adenovirus; wherein the adenovirus type 5 specifically has deletions in the E1 and E3 regions.

2. The method for constructing a capsid-armed adenovirus carrying antigens in the pIX region according to claim 1, characterized in that, Includes the following steps: Linearize the first adenovirus backbone plasmid; In vitro synthesis of the pIX-del adenovirus backbone recombinant fragment with pIX gene deletion; The linearized first adenovirus backbone plasmid and pIX-del were co-transformed into competent cells to obtain the second adenovirus backbone plasmid. Linearize the second adenovirus backbone plasmid; prepare a pIX-target gene fusion expression fragment containing the pIX sequence and the exogenous antigen gene sequence; The linearized second adenovirus backbone plasmid and the pIX-target gene fusion expression fragment were ligated in vitro to obtain a recombinant plasmid, which was then packaged and purified to obtain the capsid-armed adenovirus.

3. The method for constructing a capsid-armed adenovirus carrying antigens in the pIX region according to claim 2, characterized in that, The gene sequence of pIX-del is shown in SEQ ID No.

1.

4. The method for constructing a capsid-armed adenovirus carrying antigens in the pIX region according to claim 2, characterized in that, The pIX-target gene fusion expression fragment includes, from the N-terminus to the C-terminus, the complete coding region of the pIX gene, a flexible linker sequence, and the target gene sequence.

5. The method for constructing a capsid-armed adenovirus carrying antigens in the pIX region according to claim 4, characterized in that, The flexible linker sequence is shown in SEQ ID No.

3.

6. The method for constructing a capsid-armed adenovirus carrying antigens in the pIX region according to claim 2, characterized in that, The exogenous antigen gene sequence is an HPV antigen gene sequence or an OVA antigen gene sequence.

7. A method for constructing a capsid-armed adenovirus with an antigen carried in the pIX region according to any one of claims 2-6, characterized in that, The first adenovirus backbone plasmid is adenovirus type 5, with deletions of 1-3523nt in region E1 and 28130-30820nt in region E3, and a CMV-MCS-polyA expression cassette inserted in region E1.

8. A method for constructing a capsid-armed adenovirus with an antigen carried in the pIX region according to any one of claims 2-6, characterized in that, The first adenovirus backbone plasmid is BJ5183-pADeasy plasmid, and the competent cells are BJ5183 competent cells.

9. A capsid-armed adenovirus carrying an antigen in its pIX region, characterized in that, It is constructed using the method described in any one of claims 1-8.

10. The application of the capsid-armed adenovirus as described in claim 9, characterized in that, It can be used to prepare vaccines or gene therapy drugs.

Citation Information

Patent Citations

  • Recombinant adenovirus vector for expressing African swine fever virus p34 gene, recombinant adenovirus, method and application

    CN111549066A

  • Replication type mouse type 1 adenovirus MAdV-1 vector system and application thereof

    CN118272440A

  • Capsid-modified recombinant adenovirus and methods of use

    US20040081637A1