Molecular marker GmChr055102889 related to soybean crude oil content and application of molecular marker GmChr055102889

By developing the molecular marker Gm_Chr05_5102889 related to soybean crude oil content, and combining it with KASP technology and quantitative real-time PCR, the problem of rapid identification of soybean oil content in traditional breeding methods has been solved, achieving efficient and low-cost breeding screening.

CN120843733AActive Publication Date: 2025-10-28SHANDONG AGRICULTURAL UNIVERSITY

Patent Information

Application Number
CN202511373641.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-25
Publication Date
2025-10-28
Estimated Expiration
2045-09-25

AI Technical Summary

Technical Problem

Traditional breeding methods are unlikely to significantly increase the crude oil content of soybeans in the short term, and field phenotyping requires a lot of manpower and resources, making it impossible to identify the target genotype in the early stages.

Method used

A molecular marker Gm_Chr05_5102889 associated with crude oil content in soybeans was developed. Genotyping was performed using KASP technology combined with quantitative real-time PCR, and a specific primer set was designed for rapid screening.

Benefits of technology

This technology enables early and rapid identification of the crude oil content in soybeans, improving breeding efficiency, simplifying the material identification process, and reducing costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843733A_ABST
    Figure CN120843733A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and discloses a molecular marker GmChr055102889 related to the content of soybean crude oil and an application of the molecular marker GmChr055102889. The molecular marker GmChr055102889, which is closely linked with the crude oil content and is stable and reliable, is obtained through QTL positioning analysis when the crude oil content of soybean seeds is measured, the molecular marker GmChr055102889 is located at the 5102889 site on the fifth chromosome of a soybean reference genome Glycine max Wm82. A4. V1, a marker for KASP detection is developed on the basis of the site, and a primer group for amplifying the KASP marker is designed. The invention further provides a method for rapidly identifying the content of the soybean crude oil by utilizing the primer group of the molecular marker, and the method is simple, convenient and rapid, accurate in identification result and good in popularization and application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker Gm_Chr05_5102889 related to the crude oil content of soybeans and its applications. Background Technology

[0002] Soybean (Glycine max (L.) Merr.), a high-protein and high-oil economic crop, has been an important source of food and oil globally since ancient times. Soybean oil is one of the most consumed vegetable oils in the world, and soybean protein plays an irreplaceable role in the food industry and feed production. With population growth and changes in dietary structure, the demand for vegetable oil continues to increase. Therefore, improving the crude oil content of soybeans through genetic modification has become one of the core tasks in soybean breeding research.

[0003] Soybean oil content is a quantitative trait, often regulated by multiple gene loci and exhibiting significant differences in different ecological environments. This complex genetic background makes it difficult to achieve significant breakthroughs in the short term using traditional breeding methods alone. Traditional methods rely on field phenotyping, which is not only resource-intensive but also unable to effectively identify target genotypes in the early generations. Therefore, modern breeding techniques combining molecular markers and quantitative trait mapping have become a key approach to overcoming the genetic bottleneck of oil content.

[0004] KASP (Kompetitive Allele Specific PCR) markers, a rapidly developing molecular marker technology in recent years, have shown great potential in soybean genetic breeding due to their high sensitivity, high throughput, and low cost. KASP technology uses allele-specific primers and fluorescence signal detection to achieve genotyping, enabling accurate typing of a large number of samples in a short time. In soybean oil improvement research, KASP markers developed around key genes or quantitative trait loci (QTL) regions have become important tools for assisted selection and material identification, allowing breeders to quickly distinguish between high-oil and low-oil genotypes at an early stage, accelerating the screening of superior germplasm.

[0005] On the other hand, QTL mapping studies have played an irreplaceable role in revealing the genetic mechanisms of soybean oil content. By constructing mapping populations with different genetic backgrounds and conducting systematic phenotypic assessments of their oil content, combined with genotypic information from molecular markers, researchers can identify key genetic regions related to oil content across the entire genome. These regions often contain major or minor genes regulating oil synthesis and accumulation, and their mapping results provide a solid foundation for subsequent molecular marker development and gene function validation. By combining QTL mapping results with KASP marker development, a close link between markers and target traits can be achieved, thereby improving the efficiency of molecularly assisted selection.

[0006] Therefore, against the backdrop of increasing global oilseed supply pressure, genetic improvement of soybean oil content not only has significant economic value but also plays a crucial role in ensuring food and energy security. With the continuous development and improvement of KASP technology and QTL mapping methods, soybean oilseed breeding is gradually shifting from empirical selection to precise molecular design, which will open up broader avenues for the breeding of high-oil soybean varieties. Summary of the Invention

[0007] One of the objectives of this invention is to provide a molecular marker Gm_Chr05_5102889 related to the crude oil content of soybeans.

[0008] The second objective of this invention is to provide the application of the aforementioned molecular markers related to the crude oil content of soybeans.

[0009] To achieve the above objectives, the present invention adopts the following technical solution: This invention discloses a molecular marker related to crude oil content in soybeans. The inventors measured the crude oil content of soybean seeds and, through QTL mapping analysis, located a linkage region in soybeans containing a SNP locus named Gm_Chr05_5102889. This locus is located at position 5102889 on chromosome 5 of the soybean reference genome Glycine max Wm82.a4.v1. This locus contains a G / A base mutation. The nucleotide sequence of this SNP locus is shown in SEQ ID NO.1. When the base at this locus is G (GG genotype, hereinafter referred to as 0 / 0 genotype), the crude oil content of the soybean material is low; when the base at this locus is A (AA genotype, hereinafter referred to as 1 / 1 genotype), the crude oil content of the soybean material is high. Population validation results show that the crude oil content of soybean material with genotype 1 / 1 is significantly higher than that of soybean material with genotype 0 / 0, with a highly significant difference between the two.

[0010] Specifically, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein a G / A base mutation exists at position 25 of the sequence shown in SEQ ID NO.1, and the sequence is: CAAAATTAAAGCTAACAAAACACC G / A AATGACAAAAAAGCCAAAAAAAAATGGATGATGATGTGATCAACAAAATGCAGGGAGGGAGAATTTTCCTCCCTAGCCAAATACACATAAGGTTTTTCGTTCTTTGAACGTTTTTATGTATGTTGCCAAAGGGCATAGAGCGTTTCATAT. (As shown in SEQ ID NO.1, the bold and underlined part represents the SNP site Chr05_5102889 (G / A)).

[0011] Based on this SNP site, a primer set for the KASP marker was designed, and a primer set for amplifying the molecular marker related to soybean crude oil content was developed. The primer sequence corresponding to the molecular marker Gm_Chr05_5102889 is as follows: Gm_Chr05_5102889-F1: GAAGGTGACCAAGTTCATGCTCAAAATTAAAGCTAACAAAACACCG (shown in SEQ ID NO.2); Gm_Chr05_5102889-F2: GAAGGTCGGAGTCAACGGATTCAAAATTAAAGCTAACAAAACACCA (shown in SEQ ID NO.3); Gm_Chr05_5102889-R: ATCATCATCCATTTTTTTTTGGCTTTTTT (shown in SEQ ID NO.4).

[0012] Two forward primers are used, each ligating a different fluorescent adapter sequence. The 5' end of forward primer Gm_Chr05_5102889-F1 is ligated to the FAM fluorescent adapter sequence, and the 5' end of forward primer Gm_Chr05_5102889-F2 is ligated to the VIC fluorescent adapter sequence. The FAM and VIC fluorescent adapter sequences are as follows: FAM: GAAGGTGACCAAGTTCATGCT (shown in SEQ ID NO.5); VIC: GAAGGTCGGAGTCAACGGATT (shown in SEQ ID NO.6).

[0013] This invention also discloses the application of the primer set of the aforementioned molecular markers in marker-assisted breeding of soybean crude oil content. In other words, the primer set of the molecular markers of this invention can be used in future marker-assisted breeding to identify the crude oil content of soybean materials by extracting DNA from seedling leaves and detecting the presence of the molecular markers of this invention. The detection can be performed using quantitative real-time PCR, specifically using the aforementioned molecular marker primer set.

[0014] This invention also discloses the application of the aforementioned molecular marker primer set in identifying the crude oil content of soybeans. Specifically, the specific steps for identifying the crude oil content of soybeans are as follows: Using the DNA of the tested soybean germplasm as a template for quantitative real-time PCR amplification, quantitative real-time PCR amplification was performed using the primer set of the molecular marker Gm_Chr05_5102889. The reaction system for quantitative real-time PCR amplification is shown in Table 1. Table 1. Reaction system for PCR amplification

[0015] Pre-read fluorescence at 30℃ for 1 min, initial denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, annealing and extension at 61℃ for 1 min, 10 cycles; denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 1 min, 26 cycles; final fluorescence reading at 30℃ for 1 min.

[0016] Quantitative real-time PCR (qPCR) amplification was performed using primer sets Gm_Chr05_5102889-F1, Gm_Chr05_5102889-F2, and Gm_Chr05_5102889-R. If the PCR product only showed FAM fluorescence signal corresponding to primer Gm_Chr05_5102889-F1 with a fluorescent adapter sequence, the detection site indicated a 0 / 0 genotype, classifying it as homozygous with a low crude oil content phenotype. If the PCR product only showed VIC fluorescence signal corresponding to primer Gm_Chr05_5102889-F2 with a fluorescent adapter sequence, the detection site indicated a 1 / 1 genotype, classifying it as homozygous with a high crude oil content phenotype. If primers Gm_Chr05_5102889-F1 and Gm_Chr05_5102889-F2 with fluorescent adapter sequences were detected simultaneously, the genotype was classified as 1 / 1, classifying it as homozygous with a high crude oil content phenotype. The corresponding FAM and VIC fluorescence signals indicate that the detection site is a 0 / 1 genotype (corresponding to the GA genotype), which is determined to be a heterozygous type with a medium crude oil content phenotype.

[0017] In addition, this invention also protects a kit for identifying the crude oil content of soybeans, the kit containing primer sets Gm_Chr05_5102889-F1, Gm_Chr05_5102889-F2, and Gm_Chr05_5102889-R. Other components of the kit are conventional reagents. Specifically, it also includes 2×PCR Mix and ROX supplementation solution. This invention imposes specific restrictions on the concentration of the primer pairs; a concentration of 10 μM can be used. This invention does not impose specific restrictions on the source of the 2×PCR Mix and ROX supplementation solution; reagents for real-time quantitative PCR amplification well-known in the art can be used.

[0018] The kit of this invention can be used to quickly identify the crude oil content of soybeans, and can also be used to quickly identify the crude oil content genotype of soybeans. The specific method refers to the steps for identifying the crude oil content of soybeans. Analysis of the results of quantitative real-time PCR amplification reveals the following: If the PCR product only detects the FAM fluorescence signal corresponding to primer Gm_Chr05_5102889-F1 with a fluorescent adapter sequence, the detection site indicates a 0 / 0 genotype, classifying it as homozygous with a low crude oil content phenotype. If the PCR product only detects the VIC fluorescence signal corresponding to primer Gm_Chr05_5102889-F2 with a fluorescent adapter sequence, the detection site indicates a 1 / 1 genotype, classifying it as homozygous with a high crude oil content phenotype. If both FAM and VIC fluorescence signals corresponding to primers Gm_Chr05_5102889-F1 and Gm_Chr05_5102889-F2 with fluorescent adapter sequences are detected simultaneously, the detection site indicates a 0 / 1 genotype, classifying it as heterozygous with a medium crude oil content phenotype.

[0019] The present invention has the following advantages: (1) The inventors of this invention screened out a molecular marker Gm_Chr05_5102889 that is related to the crude oil content of soybeans. This molecular marker is located on chromosome 5. Using the molecular marker Gm_Chr05_5102889 of this invention, the crude oil content of soybeans can be quickly identified.

[0020] (2) Using markers linked to the crude oil content of soybeans for screening is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.

[0021] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity. They can be easily, quickly and with high throughput applied to molecular marker-assisted breeding practices and material identification related to crude oil content in soybeans. Attached Figure Description

[0022] Figure 1 The results of QTL localization analysis for crude oil content in soybeans.

[0023] Figure 2 This is a box plot showing the crude oil content distribution corresponding to the genotype at the Gm_Chr05_5102889 locus in the soybean population of Example 1 of this invention. 0 / 0 indicates a homozygous low crude oil content genotype at the Gm_Chr05_5102889 locus, and 1 / 1 indicates a homozygous high crude oil content genotype at the Gm_Chr05_5102889 locus. The dots represent the data distribution, and **** represents... P <0.0001.

[0024] Figure 3 This is an analysis diagram of the amplification results of the molecular marker at the Gm_Chr05_5102889 site in the soybean population of Example 1 of the present invention.

[0025] Figure 4 This is a box plot showing the distribution of crude oil content corresponding to the genotype at the Gm_Chr05_5102889 locus in soybean germplasm resources in Example 2 of this invention. 0 / 0 indicates a homozygous low crude oil content genotype at the Gm_Chr05_5102889 locus; 0 / 1 indicates a heterozygous medium crude oil content genotype; and 1 / 1 indicates a homozygous high crude oil content genotype. The dots represent the data distribution, and *** represents... P <0.001, * represents P <0.05. Detailed Implementation

[0026] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0027] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0029] Example 1: Development of molecular markers related to crude oil content in soybeans This invention analyzed 132 soybean population materials, using the crude oil content (%) in soybean grains as the measure of crude oil content. A higher value indicates a higher crude oil content, while a lower value indicates a lower crude oil content. The crude oil content in soybean grains was determined, and QTL mapping analysis located a linked region containing a SNP locus named Gm_Chr05_5102889. This locus is located at position 5102889 on chromosome 5 of the soybean reference genome Glycine max Wm82.a4.v1 (downloadable from https: / / phytozome-next.jgi.doe.gov / ). This locus contains a G / A base mutation, and the nucleotide sequence of this SNP locus is shown in SEQ ID NO.1, located at position 25 (counting from the first base at the 5' end as position 1). When the base at this locus is G (GG genotype, 0 / 0 genotype), the crude oil content of soybean materials is low; when the base at this locus is A (AA genotype, 1 / 1 genotype), the crude oil content of soybean materials is high. The box plot of crude oil content distribution corresponding to the genotypes at the Gm_Chr05_5102889 locus in the population is shown below. Figure 2 Soybean materials with genotype 0 / 0 have low crude oil content, while soybean materials with genotype 1 / 1 have high crude oil content. Furthermore, the crude oil content of soybean materials with genotype 1 / 1 is significantly higher than that of soybean materials with genotype 0 / 0, meaning that the difference in crude oil content between the two is extremely significant.

[0030] Based on this SNP site and its upstream and downstream sequences, markers for KASP detection were developed, and the following primer set was designed using SnapGene: Gm_Chr05_5102889-F1: GAAGGTGACCAAGTTCATGCTCAAAATTAAAGCTAACAAAACACCG (shown in SEQ ID NO.2); Gm_Chr05_5102889-F2: GAAGGTCGGAGTCAACGGATTCAAAATTAAAGCTAACAAAACACCA (shown in SEQ ID NO.3); Gm_Chr05_5102889-R: ATCATCATCCATTTTTTTTTGGCTTTTTT (shown in SEQ ID NO.4).

[0031] Using this primer set, quantitative real-time PCR amplification was performed on the test samples. The results showed that if the PCR product only detected FAM fluorescence signal corresponding to primer Gm_Chr05_5102889-F1 with a fluorescent adapter sequence, the detection site was a 0 / 0 genotype, indicating a homozygous type with a low crude oil content phenotype; if the PCR product only detected VIC fluorescence signal corresponding to primer Gm_Chr05_5102889-F2 with a fluorescent adapter sequence, the detection site was a 1 / 1 genotype, indicating a homozygous type with a high crude oil content phenotype; if both FAM and VIC fluorescence signals corresponding to primers Gm_Chr05_5102889-F1 and Gm_Chr05_5102889-F2 with fluorescent adapter sequences were detected simultaneously, the detection site was a 0 / 1 genotype, indicating a heterozygous type with a medium crude oil content phenotype. Figure 3 ).

[0032] This study developed markers in 132 soybean accessions. 74 accessions showed a genotype of 0 / 0 at the Chr05_5102889 locus, while 58 accessions showed a genotype of 1 / 1 at the Chr05_5102889 locus. A t-test showed that the difference between the 0 / 0 and 1 / 1 genotypes was extremely significant. P <0.0001). The detection results are consistent with the genotype at the Chr05_5102889 locus and the actual crude oil content determination results. Figure 2 ).

[0033] The 132 soybean materials used for marker development were those published in the article "Lei Lei, et al. Classification of Soybean Heterotic Groups Based on SSR Molecular Markers for Yield-Related Traits[J]. Crops, 2022(4): 54–61".

[0034] Example 2: Accuracy verification of the molecular markers described in this invention The above molecular markers were used to identify 39 soybean germplasm resources in the germplasm resource bank. The crude oil content and genotype corresponding to the Chr05_5102889 locus of the soybean germplasm materials used are shown in Table 2. Table 2. Crude oil content of soybean seeds and genotypes corresponding to the Chr05_5102889 locus in 39 germplasm materials.

[0035] Using the genomic DNA of the soybean to be identified as a template, the primer pair was used for real-time PCR amplification to obtain the real-time PCR product.

[0036] The reaction system for real-time PCR amplification is as follows: 1 μL genomic DNA, 5 μL 2×PCR Mix, 0.16 μL ROX supplement, 0.1 μL upstream primer F1, 0.1 μL upstream primer F2, 0.3 μL downstream primer R, and sterile distilled water to a final volume of 10 μL.

[0037] The preferred reaction program for quantitative real-time PCR amplification is as follows: 30℃ pre-read fluorescence for 1 min, 94℃ initial denaturation for 15 min; 94℃ denaturation for 20 s, 61℃ annealing and extension for 1 min, 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing and extension for 1 min, 26 cycles; 30℃ final fluorescence reading for 1 min.

[0038] Determining the crude oil content of soybeans based on quantitative real-time PCR products: Table 2 shows that among the 39 soybean germplasm resources identified in this study, 25 resources had a genotype of 0 / 0 at the Chr05_5102889 locus; 5 resources had a genotype of 0 / 1 at the Chr05_5102889 locus; and 9 resources had a genotype of 1 / 1 at the Chr05_5102889 locus. The t-test indicated that the difference between the 0 / 0 and 1 / 1 genotypes was extremely significant. P <0.001), the differences between 0 / 0 and 0 / 1 types are significant ( P <0.05%. The detection results are consistent with the genotype at the Chr05_5102889 locus and the actual crude oil content determination results. Figure 4 Therefore, the KASP molecular marker of the present invention can effectively identify the crude oil content of soybeans and can be used for the prediction and screening of soybean materials with high crude oil content.

[0039] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. The molecular marker Gm_Chr05_5102889 associated with soybean crude oil content, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein there is a G / A base mutation at position 25 of the sequence shown in SEQ ID NO.

1. When the base at this position is G, the crude oil content of the soybean material is low, and when the base at this position is A, the crude oil content of the soybean material is high.

2. The molecular marker Gm_Chr05_5102889 related to soybean crude oil content according to claim 1, characterized in that, The molecular marker is the KASP marker.

3. A primer set for amplifying the molecular marker according to claim 1, characterized in that, The primer set includes: Gm_Chr05_5102889-F1: GAAGGTGACCAAGTTCATGCTCAAAATTAAAGCTAACAAAACACCG; Gm_Chr05_5102889-F2:GAAGGTCGGAGTCAACGGATTCAAAATTAAAGCTAACAAAACACCA; Gm_Chr05_5102889-R:ATCATCATCATTTTTTTTTGGCTTTTTT.

4. The primer set of the molecular marker according to claim 3, characterized in that, Two forward primers are used, each ligating a different fluorescent adapter sequence. The 5' end of forward primer Gm_Chr05_5102889-F1 is ligated to the FAM fluorescent adapter sequence, and the 5' end of forward primer Gm_Chr05_5102889-F2 is ligated to the VIC fluorescent adapter sequence. The FAM and VIC fluorescent adapter sequences are as follows: FAM: GAAGGTGACCAAGTTCATGCT; VIC: GAAGGTCGGAGTCAACGGATT.

5. The application of the primer set of the molecular marker as described in claim 3 in the identification or auxiliary identification of crude oil content in soybeans.

6. The application according to claim 5, characterized in that, The method for determining the crude oil content of soybeans includes the following steps: (1) Extract soybean genomic DNA for testing; (2) Using the genomic DNA extracted in step (1) as a template, perform real-time PCR amplification using the primer set of the molecular markers, and analyze the results of real-time PCR amplification. (3) Make a judgment based on the result of step (2), and the specific criteria are as follows: Quantitative real-time PCR (qPCR) amplification was performed using primer sets Gm_Chr05_5102889-F1, Gm_Chr05_5102889-F2, and Gm_Chr05_5102889-R. If the PCR product only showed FAM fluorescence signal corresponding to primer Gm_Chr05_5102889-F1 with a fluorescent adapter sequence, the locus was classified as genotype 0 / 0, indicating a homozygous type with a low crude oil content phenotype. If the PCR product only showed VIC fluorescence signal corresponding to primer Gm_Chr05_5102889-F2 with a fluorescent adapter sequence, the locus was classified as genotype 1 / 1, indicating a homozygous type with a high crude oil content phenotype. If primers Gm_Chr05_5102889-F1 and Gm_Chr05_5102889-F2 with fluorescent adapter sequences were detected simultaneously, the locus was classified as genotype 1 / 1, indicating a homozygous type with a high crude oil content phenotype. If the corresponding FAM and VIC fluorescence signals are present, then the locus is a 0 / 1 genotype, and is determined to be a heterozygous type with a medium crude oil content phenotype.

7. A reagent kit for identifying the crude oil content of soybeans, characterized in that, A primer set comprising the molecular markers described in claim 3.

8. The application of the kit according to claim 7 in identifying the crude oil content of soybeans.

9. The application according to claim 8, characterized in that, The method for identifying the crude oil content of soybeans using the aforementioned kit is as follows: (1) Extract soybean genomic DNA for testing; (2) Using the genomic DNA extracted in step (1) as a template, perform real-time PCR amplification using the primer set of the molecular markers, and analyze the results of real-time PCR amplification. (3) Analyze the results of quantitative real-time PCR amplification. If the sample PCR product only detects the FAM fluorescence signal corresponding to the primer Gm_Chr05_5102889-F1 with the fluorescent adapter sequence, then the site is a 0 / 0 genotype and is determined to be a homozygous type with a low crude oil content phenotype. If the sample PCR product only detects the VIC fluorescence signal corresponding to the primer Gm_Chr05_5102889-F2 with the fluorescent adapter sequence, then the site is a 1 / 1 genotype and is determined to be a homozygous type with a high crude oil content phenotype. If both FAM and VIC fluorescence signals corresponding to the primers Gm_Chr05_5102889-F1 and Gm_Chr05_5102889-F2 with the fluorescent adapter sequence are detected at the same time, then the site is a 0 / 1 genotype and is determined to be a heterozygous type with a medium crude oil content phenotype.

Citation Information

Patent Citations

  • Molecular marker related to fat content of millet grains, KASP primer pair and application of molecular marker and KASP primer pair

    CN119265343A

  • Application of soybean GmLRR1 gene in regulation and control of soybean oil content

    CN119932101A

  • KASP molecular marker for identifying soybean oil content and application

    CN120624704A

  • Molecular marker for identifying or assisting in identifying soybean oil content and application

    CN120624705A

  • Mutant gene that regulates oil-and-fat content in seed and method for regulating oil-and-fat content in seed

    US20110041220A1

Cited By

  • Molecular marker located in chromosome 5 and related to soybean branch number and application of molecular marker

    CN121874398A