Molecular marker gm_chr05_5102889 related to soybean crude oil content and application thereof

Abstract

The application belongs to the technical field of biology, and discloses a molecular marker Gm_Chr05_5102889 related to soybean crude oil content and application thereof. The application measures the crude oil content of soybean grains, and through QTL positioning analysis, a stable and reliable molecular marker Gm_Chr05_5102889 closely linked to the crude oil content is obtained, the molecular marker is located at the 5th chromosome of the soybean reference genome Glycine max Wm82.a4.v1 at the 5102889th position, and a marker for KASP detection is developed based on the site, and a primer set for amplifying the KASP marker is designed. The application further provides a method for rapidly identifying the crude oil content of soybean by using the primer set of the molecular marker, the method is simple and fast, the identification result is accurate, and has a good popularization and application prospect.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a molecular marker Gm_Chr05_5102889 related to soybean crude oil content and application thereof. BACKGROUND

[0002] Soybean (Glycine max (L.) Merr.) is an economic crop with high protein and high oil content, and has been an important source of food and oil since ancient times. Soybean oil is one of the most consumed plant oils in the world, and soybean protein also plays an irreplaceable role in the food industry and feed production. With the growth of population and the adjustment of dietary structure, the demand for vegetable oil continues to increase, and how to improve the crude oil content of soybean through genetic improvement has become one of the core tasks in soybean breeding research.

[0003] Soybean oil content is a quantitative trait, which is often regulated by multiple gene loci and shows significant differences in different ecological environments. This complex genetic background makes it difficult to achieve significant breakthroughs in a short period of time simply relying on traditional breeding methods. Traditional methods rely on field phenotypic determination, which not only consumes a lot of manpower and material resources, but also cannot effectively identify target genotypes in the early generations. Therefore, modern breeding techniques combining molecular markers and quantitative trait mapping have become a key way to break through the genetic bottleneck of oil content.

[0004] KASP (Kompetitive Allele Specific PCR) markers, as a type of molecular marker technology that has developed rapidly in recent years, have shown great potential in soybean genetic breeding due to their high sensitivity, high throughput, and low cost. KASP technology identifies genotypes through allele-specific primers and fluorescence signal detection, and can accurately genotype a large number of samples in a short time. In soybean oil improvement research, KASP markers developed around key genes or quantitative trait loci (QTL) regions have become important tools for assisted selection and material identification, enabling breeders to quickly distinguish between high-oil and low-oil genotypes in the early stages and accelerate the screening of excellent germplasm.

[0005] On the other hand, QTL mapping studies play an irreplaceable role in revealing the genetic mechanism of soybean oil content. By constructing mapping populations with different genetic backgrounds and systematically evaluating their oil content, researchers can identify key genetic intervals related to oil content in the whole genome by combining genotype information with molecular markers. These intervals often contain major genes or microgenes that regulate oil synthesis and accumulation. The results of their positioning provide a solid foundation for subsequent molecular marker development and gene function verification. By combining QTL mapping results with KASP marker development, markers can be closely linked to target traits, thereby improving the efficiency of molecular assisted selection.

[0006] Therefore, in the context of increasing global oil supply pressure, genetic improvement of soybean oil content not only has significant economic value, but also is of great significance to food and energy security. With the continuous development and improvement of KASP technology and QTL mapping methods, soybean oil breeding is gradually shifting from empirical selection to precise molecular design, which will open up a broader path for the breeding of high-oil soybean varieties. SUMMARY

[0007] One of the purposes of the present application is to provide a molecular marker Gm_Chr05_5102889 related to the crude oil content of soybean.

[0008] The second purpose of the present application is to provide the use of the above-mentioned molecular marker related to the crude oil content of soybean.

[0009] To achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0010] The molecular marker related to the crude oil content of soybean disclosed by the present application, the inventors measure the crude oil content of soybean grains, and through QTL mapping analysis, a linkage region is located in soybean, which contains a SNP site named Gm_Chr05_5102889. The site is located at position 5102889 of chromosome 5 of soybean reference genome Glycine max Wm82.a4.v1. The site has a G / A base mutation. The nucleotide sequence where the SNP site is located is shown in SEQ ID NO. 1. When the base of the site is G (GG genotype, also referred to as 0 / 0 genotype hereinafter), the crude oil content of the soybean material is low. When the base of the site is A (AA genotype, also referred to as 1 / 1 genotype hereinafter), the crude oil content of the soybean material is high. The population verification results show that the crude oil content of the soybean material with genotype 1 / 1 is significantly higher than that of the soybean material with genotype 0 / 0, and the difference between the two is extremely significant.

[0011] Specifically, the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein a G / A base mutation exists at the 25th position of the sequence shown in SEQ ID NO. 1, and the sequence is as follows:

[0012] CAAAATTAAAGCTAACAAAACACC G / A AATGACAAAAAAGCCAAAAAAAAATGGATGATGATGTGATCAACAAAATGCAGGGAGGGAGAATTTTCCTCCCTAGCCAAATACACATAAGGTTTTTCGTTCTTTGAACGTTTTTATGTATGTTGCCAAAGGGCATAGAGCGTTTCATAT. (shown as SEQ ID NO. 1, the SNP site Chr05_5102889 (G / A) is bold and underlined).

[0013] According to the SNP site, a primer set of a KASP marker is designed, and a primer set of a molecular marker related to the soybean crude oil content is amplified, and the primer set corresponding to the molecular marker Gm_Chr05_5102889 is as follows:

[0014] Gm_Chr05_5102889-F1: GAAGGTGACCAAGTTCATGCTCAAAATTAAAGCTAACAAAACACCG (shown as SEQ ID NO. 2);

[0015] Gm_Chr05_5102889-F2: GAAGGTCGGAGTCAACGGATTCAAAATTAAAGCTAACAAAACACCA (shown as SEQ ID NO. 3);

[0016] Gm_Chr05_5102889-R: ATCATCATCCATTTTTTTTTGGCTTTTTT (shown as SEQ ID NO. 4).

[0017] Two forward primers are respectively connected with different fluorescent linker sequences; the 5' end of the forward primer Gm_Chr05_5102889-F1 is connected with a FAM fluorescent linker sequence, and the 5' end of the forward primer Gm_Chr05_5102889-F2 is connected with a VIC fluorescent linker sequence; the FAM and VIC fluorescent linker sequences are as follows:

[0018] FAM: GAAGGTGACCAAGTTCATGCT (shown as SEQ ID NO. 5);

[0019] VIC: GAAGGTCGGAGTCAACGGATT (as shown in SEQ ID NO. 6).

[0020] The application further discloses application of the primer set of the molecular marker in soybean crude oil content related molecular marker assisted breeding. That is, the primer set of the molecular marker can be used in future molecular marker assisted breeding, and the crude oil content of soybean material is identified by extracting DNA of seedling leaves and detecting whether the molecular marker exists.

[0021] The application further discloses application of the primer set of the molecular marker in identifying the crude oil content of soybean. Specifically, the specific steps for identifying the crude oil content of soybean are as follows:

[0022] DNA of the tested soybean germplasm is used as a template for fluorescence quantitative PCR amplification, and the primer set of the above molecular marker Gm_Chr05_5102889 is used for fluorescence quantitative PCR amplification, and the reaction system of the fluorescence quantitative PCR amplification is as shown in Table 1.

[0023] Table 1 Reaction system of PCR amplification

[0024]

[0025] 30℃ pre-read fluorescence 1min, 94℃ initial denaturation 15min; 94℃ denaturation 20s, 61℃ annealing and extension 1min, 10 cycles; 94℃ denaturation 20s, 55℃ annealing and extension 1min, 26 cycles; 30℃ final reading fluorescence 1min.

[0026] If the sample PCR product only detects the FAM fluorescence signal corresponding to the primer Gm_Chr05_5102889-F1 with the fluorescent linker sequence, the detection site is 0 / 0 genotype, and it is determined as a homozygous type with a low crude oil content phenotype; if the sample PCR product only detects the VIC fluorescence signal corresponding to the primer Gm_Chr05_5102889-F2 with the fluorescent linker sequence, the detection site is 1 / 1 genotype, and it is determined as a homozygous type with a high crude oil content phenotype; if the two kinds of FAM and VIC fluorescence signals corresponding to the primers Gm_Chr05_5102889-F1 and Gm_Chr05_5102889-F2 with the fluorescent linker sequence are detected at the same time, the detection site is 0 / 1 genotype (corresponding to GA genotype), and it is determined as a heterozygous type with a medium crude oil content phenotype.

[0027] In addition, the present application also protects a kit for identifying the crude oil content of soybean, which comprises the primer set Gm_Chr05_5102889-F1, Gm_Chr05_5102889-F2 and Gm_Chr05_5102889-R. The other components of the kit all belong to conventional reagents. Specifically, it also comprises 2x PCR Mix and ROX supplement. The present application has special restrictions on the concentration of the primer pair, and 10 μM concentration can be used. The present application has no special restrictions on the source of the 2x PCR Mix and ROX supplement, and the reagents for fluorescence quantitative PCR amplification known in the art can be used.

[0028] The kit of the present application can quickly identify the crude oil content of soybean, and can also quickly identify the crude oil content genotype of soybean. For specific methods, refer to the specific steps of identifying the crude oil content of soybean, and by analyzing the fluorescence quantitative PCR amplification results, if the sample PCR product only detects the FAM fluorescence signal corresponding to the primer Gm_Chr05_5102889-F1 connected with the fluorescent linker sequence, the detection site is 0 / 0 genotype, and it is determined that the sample is a homozygous type with low crude oil content phenotype; if the sample PCR product only detects the VIC fluorescence signal corresponding to the primer Gm_Chr05_5102889-F2 connected with the fluorescent linker sequence, the detection site is 1 / 1 genotype, and it is determined that the sample is a homozygous type with high crude oil content phenotype; if the two kinds of FAM and VIC fluorescence signals corresponding to the primers Gm_Chr05_5102889-F1 and Gm_Chr05_5102889-F2 connected with the fluorescent linker sequence are detected at the same time, the detection site is 0 / 1 genotype, and it is determined that the sample is a heterozygous type with medium crude oil content phenotype.

[0029] The present application has the following advantages:

[0030] (1) The present application has screened out a molecular marker Gm_Chr05_5102889 related to the crude oil content of soybean, which is located on chromosome 5. The molecular marker Gm_Chr05_5102889 of the present application can quickly identify the high and low of the crude oil content of soybean.

[0031] (2) The use of the marker linked to the crude oil content of soybean for screening is beneficial to molecular marker assisted selection breeding, and the method is simple and feasible, which is beneficial to improve the efficiency and save the cost.

[0032] (3) The molecular marker of the present application has the characteristics of convenient detection, stable amplification product and high specificity, and can be simply, quickly and high-throughput applied to the practice of molecular marker assisted breeding related to the crude oil content of soybean and material identification. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1 QTL positioning analysis results for the crude oil content of soybean.

[0034] Figure 2 The Gm_Chr05_5102889 site genotype of the soybean population in Example 1 of the present application is shown in the crude oil content distribution box plot. 0 / 0 is the homozygous low crude oil content genotype of the Gm_Chr05_5102889 site, 1 / 1 is the homozygous high crude oil content genotype of the Gm_Chr05_5102889 site, the round dot shows the data distribution, **** represents P<0.0001.

[0035] Figure 3 Figure 2 is a graph showing the results of the analysis of the amplified molecular marker of the Gm_Chr05_5102889 locus for the soybean population in Example 1 of the present application.

[0036] Figure 4 Figure 3 is a box plot showing the distribution of crude oil content corresponding to the genotypes of the Gm_Chr05_5102889 locus for the soybean germplasm in Example 2 of the present application. 0 / 0 means that the genotype of the Gm_Chr05_5102889 locus is homozygous low crude oil content genotype, 0 / 1 means that the genotype of the Gm_Chr05_5102889 locus is heterozygous medium crude oil content genotype, 1 / 1 means that the genotype of the Gm_Chr05_5102889 locus is homozygous high crude oil content genotype, and the round dots show the data distribution, and *** represents P <0.001, and * represents P <0.05. DETAILED DESCRIPTION

[0037] The present application will be further described with reference to the following examples. The advantages and features of the present application will become apparent during the course of the following description, of the preferred embodiments, wherein, by way of illustration, the preferred embodiments of the present application are contemplated. It is to be understood that other specific embodiments can be resorted to, without departing from the spirit and scope of the present application. Thus, functions performed by the methods disclosed can be carried out in alternate orders, sequences or formats than those described herein without affecting the scope of the present application.

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, exemplary methods and materials are described herein. The materials, methods, and examples are illustrative only and not intended to be limiting.

[0039] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, exemplary methods and materials are described herein. The materials, methods, and examples are illustrative only and not intended to be limiting.

[0040] Example 1: Development of molecular markers related to crude oil content in soybean

[0041] The present application analyzes 132 soybean population materials, measures the crude oil content of soybean materials in terms of the crude oil content of soybean seeds (unit: %), the higher the value, the higher the crude oil content of the soybean material; the lower the value, the lower the crude oil content of the soybean material. The crude oil content of soybean seeds is determined, and through QTL positioning analysis, a linkage region is located in soybean, which contains a SNP site, named Gm_Chr05_5102889. The site is located at position 5102889 on chromosome 5 of soybean reference genome Glycine max Wm82.a4.v1 (download address: https: / / phytozome-next.jgi.doe.gov / ), and the site has G / A base mutation. The nucleotide sequence of the SNP site is shown in SEQ ID NO. 1, which is at position 25 (counting from the first base at the 5' end as position 1) of the sequence shown in SEQ ID NO. 1. When the base of the site is G (GG genotype, 0 / 0 genotype), the crude oil content of the soybean material is low, and when the base of the site is A (AA genotype, 1 / 1 genotype), the crude oil content of the soybean material is high. The genotype distribution box plot of the crude oil content of the population Gm_Chr05_5102889 site is shown in Figure 2 , the crude oil content of the soybean material with genotype 0 / 0 is low, the crude oil content of the soybean material with genotype 1 / 1 is high, and the crude oil content of the soybean material with genotype 1 / 1 is significantly higher than that of the soybean material with genotype 0 / 0, that is, the difference in crude oil content between the two is extremely significant.

[0042] According to the SNP site and its upstream and downstream sequences, a marker for KASP detection is developed, and the following primer set is designed by SnapGene:

[0043] Gm_Chr05_5102889-F1: GAAGGTGACCAAGTTCATGCTCAAAATTAAAGCTAACAAAACACCG (shown in SEQ ID NO. 2);

[0044] Gm_Chr05_5102889-F2: GAAGGTCGGAGTCAACGGATTCAAAATTAAAGCTAACAAAACACCA (shown in SEQ ID NO. 3);

[0045] Gm_Chr05_5102889-R: ATCATCATCCATTTTTTTTTGGCTTTTTT (shown in SEQ ID NO. 4).

[0046] The fluorescence quantitative PCR amplification of the primer set is carried out on the sample to be tested, and the results show that if the sample PCR product only detects the FAM fluorescence signal corresponding to the primer Gm_Chr05_5102889-F1 connected with the fluorescence linker sequence, the detection site is 0 / 0 genotype, and it is determined that the homozygous type with low crude oil content phenotype; if the sample PCR product only detects the VIC fluorescence signal corresponding to the primer Gm_Chr05_5102889-F2 connected with the fluorescence linker sequence, the detection site is 1 / 1 genotype, and it is determined that the homozygous type with high crude oil content phenotype; if the two kinds of FAM and VIC fluorescence signals corresponding to the primers Gm_Chr05_5102889-F1 and Gm_Chr05_5102889-F2 connected with the fluorescence linker sequence are detected at the same time, the detection site is 0 / 1 genotype, and it is determined that the heterozygous type with medium crude oil content phenotype Figure 3 ).

[0047] In this study, 74 soybean materials have 0 / 0 genotype at Chr05_5102889 site, and 58 soybean materials have 1 / 1 genotype at Chr05_5102889 site among 132 soybean materials for marker development. T test shows that the difference between 0 / 0 type and 1 / 1 type is extremely significant P <0.0001). The detection results correspond to the genotype at Chr05_5102889 site and the actual crude oil content determination results Figure 2 .

[0048] The 132 soybean materials used for marker development are soybean materials disclosed in the article "Lei Lei, et al. Classification of Soybean Heterotic Groups Based on SSR Molecular Markers for Yield-Related Traits[J]. Crops, 2022(4): 54-61".

[0049] Example 2 Verification of accuracy of the molecular marker of the application

[0050] The above-mentioned molecular marker is used to identify 39 soybean germplasm resources in the germplasm resource library, and the crude oil content of the soybean germplasm materials and the genotype corresponding to Chr05_5102889 site are as shown in Table 2:

[0051] Table 2 Crude oil content of 39 germplasm materials and genotype corresponding to Chr05_5102889 site

[0052]

[0053] The genomic DNA of the soybean to be identified is used as a template, and the primer pair is used for fluorescence quantitative PCR amplification to obtain a fluorescence quantitative PCR product.

[0054] The reaction system of the fluorescence quantitative PCR amplification is as follows: 1 μL of genomic DNA, 5 μL of 2x PCR Mix, 0.16 μL of ROX supplement, 0.1 μL of upstream primer F1, 0.1 μL of upstream primer F2, 0.3 μL of downstream primer R, and sterile distilled water is supplemented to 10 μL.

[0055] The reaction procedure of the fluorescence quantitative PCR amplification is preferably as follows: 30 °C pre-reading fluorescence for 1 min, 94 °C initial denaturation for 15 min; 94 °C denaturation for 20 s, 61 °C annealing and extension for 1 min, 10 cycles; 94 °C denaturation for 20 s, 55 °C annealing and extension for 1 min, 26 cycles; 30 °C final reading fluorescence for 1 min.

[0056] The fluorescence quantitative PCR product is used to determine the crude oil content of the soybean:

[0057] As shown in Table 2, 25 soybean germplasm resources have a genotype of 0 / 0 at the Chr05_5102889 locus, 5 soybean germplasm resources have a genotype of 0 / 1 at the Chr05_5102889 locus, and 9 soybean germplasm resources have a genotype of 1 / 1 at the Chr05_5102889 locus. T test shows that the difference between 0 / 0 and 1 / 1 is extremely significant ( P <0.001), and the difference between 0 / 0 and 0 / 1 is significant ( P <0.05). The detection result is consistent with the genotype at the Chr05_5102889 locus and the actual crude oil content determination result ( Figure 4 ), so the KASP molecular marker of the present application can effectively identify the high and low crude oil content of soybean, and can be used for prediction and screening of soybean materials with high crude oil content.

[0058] The above-described embodiments are only preferred embodiments of the present application, merely used to explain the present application, and are not intended to limit the scope of the present application. For those skilled in the art, other embodiments can be easily obtained by substitution or change based on the technical content disclosed in the present specification, and therefore, any changes and improvements made on the principle of the present application shall be included in the scope of the present application.

Claims

1. The use of a molecular marker Gm_Chr05_5102889 associated with soybean crude oil content in identifying or assisting in identifying soybean crude oil content, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein a G / A base mutation exists at position 25 of the sequence shown in SEQ ID NO. 1, wherein when the base at the site is G, the soybean material has low crude oil content, and when the base at the site is A, the soybean material has high crude oil content.

2. Use according to claim 1, characterized in that, The molecular marker is a KASP marker.

3. Use of a primer set for amplifying the molecular marker of claim 1 in identifying or aiding in identifying soybean crude oil content, characterized in that, The primer set comprises: Gm_Chr05_5102889-F1: GAAGGTGACCAAGTTCATGCTCAAAATTAAAGCTAACAAAACACCG; Gm_Chr05_5102889-F2: GAAGGTCGGAGTCAACGGATTCAAAATTAAAGCTAACAAAACACCA; Gm_Chr05_5102889-R: ATCATCATCCATTTTTTTTTGGCTTTTTT.

4. Use according to claim 3, characterized in that, Two forward primers are respectively connected with different fluorescent linker sequences; the 5' end of the forward primer Gm_Chr05_5102889-F1 is connected with a FAM fluorescent linker sequence, and the 5' end of the forward primer Gm_Chr05_5102889-F2 is connected with a VIC fluorescent linker sequence; the FAM and VIC fluorescent linker sequences are respectively: FAM: GAAGGTGACCAAGTTCATGCT; VIC: GAAGGTCGGAGTCAACGGATT.

5. Use according to claim 4, characterized in that, The method for identifying the crude oil content of soybean comprises the following steps: (1) extracting soybean genomic DNA to be tested; (2) using the primer set of the molecular marker to perform fluorescent quantitative PCR amplification on the extracted genomic DNA in step (1) as a template, and analyzing the fluorescent quantitative PCR amplification results; (3) determining according to the results of step (2), and the specific standard is: using the primer set Gm_Chr05_5102889-F1, Gm_Chr05_5102889-F2 and Gm_Chr05_5102889-R to perform fluorescent quantitative PCR amplification, if the sample PCR product only detects the FAM fluorescent signal corresponding to the primer Gm_Chr05_5102889-F1 connected with the fluorescent linker sequence, then the site is 0 / 0 genotype, and it is determined as a homozygous type with low crude oil content phenotype; if the sample PCR product only detects the VIC fluorescent signal corresponding to the primer Gm_Chr05_5102889-F2 connected with the fluorescent linker sequence, then the site is 1 / 1 genotype, and it is determined as a homozygous type with high crude oil content phenotype; if both the primers Gm_Chr05_5102889-F1 and Gm_Chr05_5102889-F2 connected with the fluorescent linker sequence are detected, then the site is 0 / 1 genotype, and it is determined as a heterozygous type with medium crude oil content phenotype.

6. Use of a kit for identifying crude oil content in soybeans, characterized in that, The kit comprises the molecular marker primer set as described in claim 3, wherein the 5' end of forward primer Gm_Chr05_5102889-F1 is connected with a FAM fluorescent linker sequence, and the 5' end of forward primer Gm_Chr05_5102889-F2 is connected with a VIC fluorescent linker sequence; the 25th position of the molecular marker has a G / A base mutation, wherein when the base at this position is G, the soybean material has low crude oil content, and when the base at this position is A, the soybean material has high crude oil content.

7. Use according to claim 6, characterized in that, The method for identifying the crude oil content of soybean using the kit is as follows: (1) extracting soybean genomic DNA to be tested; (2) using the extracted genomic DNA in step (1) as a template, performing fluorescent quantitative PCR amplification using the molecular marker primer set, and analyzing the fluorescent quantitative PCR amplification results; (3) analyzing the fluorescent quantitative PCR amplification results, if the sample PCR product only detects the FAM fluorescent signal corresponding to the primer Gm_Chr05_5102889-F1 connected with the fluorescent linker sequence, then the site is 0 / 0 genotype, and it is determined as a homozygous type with low crude oil content phenotype; if the sample PCR product only detects the VIC fluorescent signal corresponding to the primer Gm_Chr05_5102889-F2 connected with the fluorescent linker sequence, then the site is 1 / 1 genotype, and it is determined as a homozygous type with high crude oil content phenotype; if both the FAM and VIC fluorescent signals corresponding to the primers Gm_Chr05_5102889-F1 and Gm_Chr05_5102889-F2 connected with the fluorescent linker sequence are detected, then the site is 0 / 1 genotype, and it is determined as a heterozygous type with medium crude oil content phenotype.

Images