A secretory protein gene of Fusarium graminearum, its mutants and their applications

By genetically modifying the secretory protein gene of Fusarium graminearum, a low-toxicity, high-immune-activating protein was obtained, solving the problems of plant pathogen variation and chemical resistance, and achieving a significant improvement in plant disease resistance and green prevention and control.

CN120865365BActive Publication Date: 2026-01-30SANYA INSTITUTE OF NANJING AGRICULTURAL UNIVERSITY +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511375181.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-25
Publication Date
2026-01-30
Estimated Expiration
2045-09-25

AI Technical Summary

Technical Problem

In the current technology, the continuous evolution and mutation of plant pathogens leads to the failure of crop disease resistance genes, the increase in the use of chemical agents, and the scarcity of existing plant immune inducer gene resources, making it difficult to develop broad-spectrum and highly efficient plant immune-activating protein pesticides.

Method used

We provide plant immune-inducing proteins secreted by Fusarium graminearum and their encoding genes. Through genetic modification, we obtain proteins with low toxicity but high immune-activating function. We then express these proteins in plants using recombinant vectors to enhance plant immunity and reduce disease damage.

Benefits of technology

It significantly improves plant disease resistance, has low application concentration, fast effect, high safety, and broad spectrum of action, providing a new green control approach.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120865365B_ABST
    Figure CN120865365B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of crop biological control technology, and discloses a gene for a secreted protein of *Fusarium graminearum*, its mutants, and their applications. The plant immune-inducing protein secreted by *Fusarium graminearum* has the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.3. This protein can significantly improve plant disease resistance and is characterized by low application concentration, rapid effect, high safety, and broad spectrum of action, providing a new approach to improving plant resistance and thus having broad application prospects in agricultural production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological control technology for crops, and relates to a secretory protein gene of Fusarium graminearum, its mutants and their applications. Background Technology

[0002] Plant diseases cause severe economic losses to agricultural production. Due to the continuous evolution and mutation of plant pathogens, crop resistance genes quickly become ineffective; simultaneously, pathogens develop resistance to different chemical agents, leading to a continuous increase in pesticide use. Therefore, developing green, efficient, and long-lasting crop control strategies is of great significance.

[0003] To resist pathogen infection, plants have evolved an innate immune system, mainly consisting of two types: one is pathogen-associated molecular patterns (PAMPs), which can be recognized by pattern recognition receptors (PRRs) on the surface of plant cell membranes, activating the host plant's non-specific basic defense response, namely the PTI immune response. This immune response has a certain effect on most pathogens and is persistent and broad-spectrum; the other is pathogen-free effector proteins, which can be recognized by intracellular NLR (Nucleotide-bounding leucine-rich repeat proteins) resistance proteins (i.e., R proteins), thereby triggering a stronger immune response in the plant, namely the ETI (Effector-triggered immunity) immune response. The two major types of plant immune systems, PTI and ETI, work synergistically to resist pathogen infection.

[0004] Plant immune inducers (plant vaccines) are novel biological pesticides that enhance the plant's innate immune system to improve disease resistance and stress, resulting in disease prevention, increased yield, and improved quality. Plant immune-activating proteins are a type of plant immune inducer; they are proteins isolated from various pathogens that can be recognized by plants and activate plant resistance. Compared to chemical pesticides, protein pesticides are produced by microorganisms, are biodegradable, and leave no harmful residues after use, meeting the requirements of green pest control. However, currently, representative products include only a few registered products such as "3% Alternaria spp. activating protein wettable powder" and β-lupin globulin, mainly due to the scarcity of gene resources available for developing plant immune-activating protein pesticides. Therefore, those skilled in the art can expect to identify broad-spectrum and highly effective immune-activating proteins, theoretically revealing the molecular mechanisms of plant-pathogen interactions, and practically providing high-quality gene resources for the development of protein-based plant immune inducers. Summary of the Invention

[0005] This invention provides a plant immune-inducing protein secreted by Fusarium graminearum and its application. This plant immune-inducing protein can significantly improve the disease resistance of plants. It has the characteristics of low concentration, rapid effect, high safety and broad spectrum of action, providing a new way to improve plant resistance and thus has broad application prospects in agricultural production.

[0006] The technical solution provided by the present invention is: a plant immune-inducing protein secreted by Fusarium graminearum, the amino acid sequence of which is shown in SEQ ID NO.2, or a derived protein of SEQ ID NO.2 with one or more amino acid residues substituted and / or deleted and / or added and related to plant immune induction, preferably, the amino acid sequence of which is shown in SEQ ID NO.3.

[0007] Meanwhile, the present invention provides a gene encoding the plant immune-inducing protein, the nucleotide sequence of which is shown in SEQ ID NO.1, or as shown in SEQ ID NO.8, or a nucleotide sequence having at least 70% homology with SEQ ID NO.1; preferably a nucleotide sequence having at least 80% homology with SEQ ID NO.1; more preferably a nucleotide sequence having at least 85% homology with SEQ ID NO.1; even more preferably a nucleotide sequence having at least 90% homology with SEQ ID NO.1; and most preferably a nucleotide sequence having at least 95% homology with SEQ ID NO.1.

[0008] The present invention also provides recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria for the said gene.

[0009] The recombinant vector described above is a prokaryotic expression vector obtained by inserting the encoding gene of the plant immune-inducing protein into pGEX-4T-2. This prokaryotic expression vector can be used for expression in *Escherichia coli* Rossetta(DE3). A fusion protein with a molecular weight of approximately 56 kDa was obtained, which can induce resistance responses in plants such as tobacco, soybean, rice, cotton, and strawberry, improve plant immunity, and reduce the damage caused by crop diseases caused by pathogens such as *Fusarium oxysporum*, *Phytophthora indic ... and *Phytophthora mosaic virus*.

[0010] Meanwhile, the present invention also provides the application of the plant immune induction protein, the gene or the recombinant vector, expression cassette, transgenic cell line or recombinant bacteria in inducing plant defense response and improving plant disease resistance.

[0011] In the preferred embodiment, the plant is tobacco, soybean, rice, wheat, strawberry, tomato, potato, or cucumber, etc.

[0012] In the preferred embodiment of the application, the disease resistance refers to resistance to plant diseases caused by Fusarium, Phytophthora soybeani, Phytophthora tobaccoi, rice blast fungus, potato late blight fungus, Fusarium, mosaic virus, etc.

[0013] The present invention also provides a method for preventing and controlling plant diseases, wherein the plant immune-inducing protein is used to treat plant diseases caused by Fusarium, Phytophthora soybeani, rice blast, Phytophthora tobaccois, etc.

[0014] Preferably, the method involves diluting the purified plant immune-inducing protein and spraying it onto diseased plants, such as tobacco, soybeans, rice, wheat, strawberries, tomatoes, potatoes, or cucumbers.

[0015] The plant immune-inducing protein described in this invention can be a protein expressed through genetic engineering technology or a protein purified using Fusarium graminearum culture medium, both of which have the same effect.

[0016] The beneficial effects of this invention are as follows:

[0017] The plant immune-inducing protein of this invention masks its function as a toxic factor, but can significantly improve plant disease resistance. It features low concentration, rapid effect, high safety, and broad spectrum of action. This plant immune-inducing protein utilizes the plant's own immune system, providing a new approach to enhancing plant resistance, and therefore has broad application prospects in agricultural production. Attached Figure Description

[0018] Figure 1 FpSP98 induced cell death in Nicotiana benthamiana. Figure a shows the cell death phenotype induced by Agrobacterium-mediated FpSP98 gene transient expression in Nicotiana benthamiana for 36 hours; INF1 is the negative control for cell death; FpSE_11045 is the negative control for the expression vector; and figure b shows the Western blot results. Figure 1 The relevant genes were correctly expressed in the protein of *Nicotiana benthamiana*.

[0019] Figure 2 FpSP98 and its mutants induced cell death in *Nicotiana benthamiana*. Figure a shows the phenotype of cell death induced by *Agrobacterium*-mediated FpSP98 gene and its mutants after 36 hours of transient expression in *Nicotiana benthamiana*. Figure b shows the intensity of cell death induced by the related genes shown in figure a after 36 hours of expression in *Nicotiana benthamiana*, figure c shows the phenotype of cell death induced by *Agrobacterium*-mediated FpSP98 gene and its mutants after 48 hours of transient expression in *Nicotiana benthamiana*, figure d shows the intensity of cell death induced by the related genes shown in figure a after 36 hours of expression in *Nicotiana benthamiana*, and figure e shows the Western blot results. Figure 2 The relevant genes were correctly expressed in the protein of *Nicotiana benthamiana*.

[0020] Figure 3 CBB staining confirmed the expression of FpSP98 and its mutant protein in prokaryotes.

[0021] Figure 4 FpSP98 and its mutants induce reactive oxygen species in *Nicotiana benthamiana*.

[0022] Figure 5 :FpSP98 E134D Inducing reactive oxygen species in target plants.

[0023] Figure 6 :FpSP98 E134D This helps tobacco resist infection by tobacco mosaic virus, where 'a' represents the tobacco leaf spray pretreatment FpSP98. E134D Phenotypic image of tobacco mosaic virus after inoculation with protein (GST protein as control). Green spots represent areas of virus infection and aggregation. b is the quantitative analysis. Figure 6 Figure a shows the relative virus content in tobacco leaves.

[0024] Figure 7 :FpSP98 E134D Helps tobacco resist infection by Phytophthora tobaccois, where 'a' represents tobacco spray pretreatment FpSP98. E134D Phenotypic image of disease after inoculation with tobacco mosaic virus following protein (GST protein as control). Dark brown areas represent lesions, and b represents pathogen biomass analysis. Figure 7 Figure a shows the relative biomass of Phytophthora in tobacco leaves.

[0025] Figure 8 :FpSP98 E134D To help soybeans resist soybean mosaic virus infection, 'a' represents the pretreatment of the leaves of the susceptible soybean variety Hefeng 47 using foliar spraying (FpSP98). E134D Phenotypic images of soybean mosaic virus infection after inoculation with protein (GST protein as a control). Green spots represent areas of virus infection and aggregation. b represents quantitative analysis. Figure 8 Figure a shows the relative virus content in soybean leaves.

[0026] Figure 9 :FpSP98 E134D To help soybeans resist soybean rust fungus infection, 'a' represents the foliar spray pretreatment of the susceptible soybean variety Hefeng 47 using FpSP98. E134D Phenotypic diagram of disease after inoculation with soybean rust spores following protein (GST protein as control). b is the pathogen biomass analysis. Figure a shows the relative content of pathogen in the leaves after soybean rust infection.

[0027] Figure 10 :FpSP98 E134D To help soybeans resist infection by Phytophthora soybean blight, 'a' represents the pretreatment of the leaves of the susceptible soybean variety Hefeng 47 using foliar spraying (FpSP98). E134D Phenotypic results of disease development after inoculation with *Phytophthora soybeani* zoospores following protein inoculation (GST protein as a control). b shows pathogen biomass analysis. Figure 10 Figure a shows the relative content of the pathogen in soybean leaves after infection with Phytophthora infestans.

[0028] Figure 11 :FpSP98 E134D This treatment helps potatoes resist infection by Phytophthora infestans, where 'a' represents a foliar spray pretreatment of the susceptible potato variety (Desiree) using FpSP98. E134D Phenotypic results of disease development after inoculation with zoospores of pathogenic *Phytophthora infestans* following protein inoculation (GST protein as a control). b shows pathogen biomass analysis. Figure 11 Figure a shows the relative content of pathogens in leaves after infection by Phytophthora infestans.

[0029] Figure 12 :FpSP98 E134D This treatment helps rice resist infection by rice blast fungus, where 'a' represents the foliar spray pretreatment of a susceptible rice variety (CO39) using FpSP98. E134D Phenotypic diagram of disease development after inoculation with rice blast fungus spores (GST protein as control). b shows the statistical count of the number of lesions. Figure 12 Figure a shows the disease situation of rice blast fungus infecting the leaves.

[0030] Figure 13 :FpSP98 E134D It helps wheat resist Fusarium infection, where a is FpSP98. E134D Phenotypic diagram of wheat disease after germination of Fielder wheat seeds soaked in protein (GST protein as control) and inoculation of coleoptiles with Fusarium spores. b shows the pathogen biomass analysis. Figure 13 Figure a shows the relative content of pathogens at the base of wheat stems after infection with *Fusarium graminearum*. Detailed Implementation

[0031] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores. The primers involved in the implementation of this invention were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0032] Example 1. Isolation and identification of plant immune-inducing protein FpSP98

[0033] The sequencing standard *Fusarium graminearum* strain was inoculated onto PDA plates (200g of peeled potatoes, cut into small pieces, boiled in ultrapure water for 30 min, filtered through four layers of gauze to remove potato pieces, 20g of glucose and 15g of agar powder were added to the filtrate, and the filtrate was made up to 1000mL with ultrapure water, dissolved, dispensed, and autoclaved at 121℃ for 30 min) and cultured at 25℃ for 7 days. The edge of the colony was picked and inoculated into a 200mL Erlenmeyer flask containing 80mL of PDA liquid medium (same formula as PDA medium, but without agar powder) and cultured in a shaker at 25℃ and 100r / min for 7 days to obtain *Fusarium graminearum* spore suspension. The mycelia were filtered using Miracloth (Merck, catalog number 475855) to obtain spore suspension. The spores were enriched by centrifugation at 25℃ and 5000rpm for 5 min and resuspended in 5mL of sterile water. The enriched spore suspension was inoculated into a 3L Erlenmeyer flask containing 800mL of CMC medium (Antelope Methyl Cellulose Sodium Broth, MM6180-250g) and cultured for 15 days at 25℃ and 100 rpm to obtain *Fusarium graminearum* culture broth. The culture filtrate was centrifuged at 4℃ and 12000 rpm for 30 min, and the supernatant was collected. The supernatant was further filtered through a 0.22 μM filter membrane to remove impurities, freeze-dried and concentrated, and the protein was resuspended in 10mL of sterile water. Purification and desalting were then performed using Sephadex G-25 Superfine chromatography media (29048684) to obtain high-purity *Fusarium graminearum* culture filtrate protein. The culture filtrate protein was sent to BGI Genomics in Shenzhen for proteomics analysis. Based on the completed sequencing of the Fusarium pseudograss genome, the peptide data obtained from proteomics analysis were compared with the Fusarium pseudograss protein database, resulting in the identification of more than 200 candidate proteins secreted by Fusarium pseudograss in the culture filtrate.

[0034] In this example, the inventors named the 98th candidate protein identified by mass spectrometry as FpSP98. F usarium p seudograminearum s ecreted p rotein 98The amino acid sequence of the gene encoding FpSP98 is shown in SEQ ID NO.2. The NCBI Fusarium pseudograminearum (CS3096) protein database accession number is FPSE_05807, described as an unstudied pseudogene (Hypothetical protein FPSE_05807). The nucleotide sequence of the gene encoding FpSP98 is shown in SEQ ID NO.1, and the GenBank accession number is EKJ74033.1.

[0035] Example 2. Cloning and transient expression of the gene encoding the plant immune-inducing protein FpSP98 in plants.

[0036] The specific cloning and identification methods for the plant immune-inducing protein FpSP98 are as follows:

[0037] (1) Total RNA extraction: Using liquid-cultured Fusarium pseudograss mycelium as material, total RNA was extracted using the Tarkara RNA extraction kit according to the instructions, and the RNA content and quality were detected by spectrophotometer.

[0038] (2) Reverse transcription to generate the first strand: Take 1 μg of RNA as a template and synthesize cDNA according to the instructions for use of Takara PrimeScript reverse transcriptase reagent. Adjust the volume to 20 μL. Take an appropriate amount of the reverse transcription product for subsequent gene cloning PCR.

[0039] (3) Using the positive strand of cDNA as a PCR template, PCR was performed using standard methods to amplify the full length of the FpSP98 encoding gene:

[0040] Cloning PCR primer sequences:

[0041] Upstream primer: gaacgatagggtacccccgggATGAAATTCCTCAGCATTGTGTCTC (SEQ ID NO.4);

[0042] Downstream primer: agtggatccgtcgaccccgggGTTGACAGACAGGCTATAAGCAGAA (SEQ ID NO.5);

[0043] The 50 μL reaction mixture consisted of 25 μL of 2 × Phanta Max Master Mix (Novozymes, catalog number P515), 1 μL each of forward and reverse primers, 1 μL of template cDNA, and water added to a final volume of 50 μL. The PCR amplification program was: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 15 s, 62℃ annealing for 15 s, 72℃ extension for 12 s, repeated 34 times, followed by a final extension at 72℃ for 5 min. Agarose gel electrophoresis and ethidium bromide staining were used to determine if the obtained bands were the target bands. The PCR product encoding the FpSP98 gene was further recovered by gel excision. The electrophoretic bands were recovered using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (TaKaRa, catalog number: 9762). The PCR product of the obtained FpSP98 encoding gene was ligated into the SmaI-digested pBIN::3HA vector according to the instructions of the CloneExpressII One Step Cloning Kit (Novozymes, catalog number: C112-01) to obtain the pBIN::FpSP98-3HA plasmid. This plasmid was further transformed into E. coli competent cells JM109, plated on LB agar plates (containing 100 μg / mL kanamycin), and incubated at 37°C for 16 h. Colony PCR was then performed to verify the colony. Positive clones were picked, and plasmids were extracted using a plasmid extraction kit (Takara, catalog number: 9760) and sent to the company for sequencing (Shanghai Sangon Biotech). The nucleotide sequence is shown in SEQ ID NO.1.

[0044] Colony PCR primer sequences:

[0045] Upstream primer: AGCAATTTCTGAAAATTTTCACCATT (SEQ ID NO.6);

[0046] Downstream primer: CATCTAGATTAAGCGTAATCTG (SEQ ID NO.7).

[0047] (4) Agrobacterium transformation and culture

[0048] The correctly sequenced plasmid was electroporated into Agrobacterium GV3101, plated on LB agar plates (containing 100 μg / mL kanamycin and 50 μg / mL rifampin), and cultured at 28°C. After 48 hours, routine colony PCR was performed for verification (primers as described above), and the correct clones were selected for subsequent experiments.

[0049] Single colonies of Agrobacterium GV3101 transfected with pBIN::FpSP98-3HA and pBIN::GFP-3HA control vectors were picked from plates and inoculated into 2 mL of LB broth (containing 100 μg / mL kanamycin and 50 μg / mL rifampicin) and incubated overnight at 28°C and 200 rpm until the OD600 reached 2.0. The overnight cultured Agrobacterium GV3101 was centrifuged at 5000g for 3 min to collect the cells. The cells were resuspended in buffer (components: 10 mM 2-[N-morpholino]ethanesulfonic acid, 10 mM MgCl2, 200 μM acetosyringone, pH 5.6) and then centrifuged again. The cells were washed twice with buffer solution and then diluted with buffer to a final concentration of OD600 = 0.6.

[0050] (5) Transient expression of the FpSP98 encoding gene on tobacco leaves

[0051] Agrobacterium was diluted to OD600=0.6 and injected into tobacco leaves using a syringe with the needle removed (1 mL). The tobacco was then cultured in a greenhouse (22℃, 14h light / 10h dark).

[0052] (6) Western blot method for detecting the cumulative amount of FpSP98 protein

[0053] Tobacco leaves collected 30 hours after injection (before necrosis) were used to detect protein expression levels. The collected tobacco leaves were flash-frozen in liquid nitrogen, ground, and added to a protein extraction buffer (components: 150 mM NaCl, 50 mM Tris-HCl, pH 7.5, 1.0% (v / v) NP-40, 1.0% (v / v) protease inhibitor cocktail). The mixture was incubated on ice for 30 min to lyse. The supernatant was collected by centrifugation at 12000 g and 4 °C. 80 μL of the supernatant was added to 20 μL of 5× protein loading buffer, mixed thoroughly, and then boiled in a water bath for 10 min. 20 μL of the sample was then electrophoretically separated on an SDS-PAGE gel at 120 V for 1.5 h. After gel running, the protein sample was transferred to a PVDF membrane and blocked with 1×PBST containing 5% (w / v) skim milk for 1 h. After incubating with HA primary antibody (Abmart, catalog number: M20003) diluted 1:5000 for 4 h, wash the membrane three times with 1×PBST for 5 min each time. Then, add mouse antibody (LI-CORirdye 800, catalog number 926-32210) diluted 1:10000 and incubate for 60 min. Wash the membrane three times with 1×PBST for 5 min each time. Scan the membrane and take pictures to record the data.

[0054] Example Results: Forty-eight hours after transient expression of the FpSP98 gene on tobacco leaves, the tobacco leaves exhibited a significant hypersensitive necrosis response (e.g., ...). Figure 1 (a) Western blot analysis confirmed that FpSP98 was normally expressed (e.g., ...). Figure 1 (b)

[0055] Example 3. Optimization and prokaryotic expression of plant immune-inducing protein FpSP98

[0056] (1) Sequence optimization and modification of plant immune induced protein FpSP98

[0057] Searching the FpSP98 protein sequence in the NBCI Conserved Domain Database revealed that FpSP98 possesses a functional domain for hydrolyzing hemicellulose in the host cell wall and has two conserved enzyme active sites. The hydrolysis and destruction of the host cell wall by FpSP98 is its toxic function. Therefore, we aimed to optimize the FpSP98 protein sequence through gene mutation technology, causing it to lose its toxic function while retaining its ability to induce plant immunity. Thus, we synthesized a single base of FpSP98 (FgSP98) via in vitro DNA synthesis (gene synthesis services provided by Shanghai Sangon Biotech). E143D FgSP98 E230D ) and the two-base enzyme activity mutant (FgSP98) E143D&E202D The gene sequence of FgSP98. E143D The gene nucleotide sequence is shown in SEQ ID NO.8, encoding FgSP98 with the amino acid sequence shown in SEQ ID NO.3. E143D Protein, FgSP98 E230D The nucleotide sequence of the gene is shown in SEQ ID NO. 9, FgSP98 E143D&E202D The gene nucleotide sequence is shown in SEQ ID NO.10.

[0058] Using the method described in Example 2 above, the synthesized sequences were constructed into the pBIN::3HA vector to form pBIN::FpSP98. E143D -3HA, pBIN::FpSP98 E230D -3HA, pBIN::FpSP98 E143D&E230D Three vectors, -3HA, were used; and they were transformed into Agrobacterium using the method described in Example 2 above. The vectors were then transiently expressed on tobacco leaves. The results showed that FpSP98 was transiently expressed on tobacco leaves. E143D FpSP98 E230D FpSP98 E143D&E230DThirty-six hours later, tobacco leaves showed obvious allergic necrosis reactions, including those injected with FpSP98. E143D The necrosis intensity is comparable to that of FpSP98, while FpSP98 E230D FpSP98 E143D&E230D The intensity of necrosis gradually weakens (e.g.) Figure 2 (a) and (b); FpSP98 was injected 48 hours later. E143D FpSP98 E230D FpSP98 E143D&E230D All experienced cell death of the same intensity (e.g.) Figure 2 (c and d). Western blot analysis confirmed that the relevant proteins were expressed normally (e.g., Figure 2 (e).

[0059] (2) Construction of a prokaryotic expression system for plant immune-inducing proteins

[0060] To further verify FpSP98, FpSP98 E143D FpSP98 E230D FpSP98 E143D&E230D To induce plant immune function through protein expression, we constructed a prokaryotic expression vector, as follows:

[0061] Specific primers constructed from the 4T-2-FpSP98 vector,

[0062] Upstream primer: ggatccccaggaattcccgggTCGCCCACTACTCCCTCCA (SEQ ID NO.11)

[0063] Downstream primer: ggccgctcgagtcgacccgggTTAGTTGACAGACAGGCTATAAGCAGA (SEQ ID NO. 12).

[0064] The 50 μL reaction system consisted of 25 μL of 2 × Phanta Max Master Mix (Novozymes, catalog number: P515), 1 μL each of forward and reverse primers, and FpSP98 as the template. E143D FpSP98 E230D FpSP98 E143D&E230D1 μL of the gene was added to 50 μL with water; the PCR amplification program was 98℃ pre-denaturation for 3 min, 98℃ denaturation for 15 s, 62℃ annealing for 15 s, 72℃ extension for 12 s, for 34 cycles, followed by a final extension at 72℃ for 5 min; the bands were detected by agarose gel electrophoresis and ethidium bromide staining to determine if they were the target bands, and the electrophoretic bands were further recovered using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (TaKaRa, catalog number: 9762) to obtain FpSP98 and FpSP98, respectively. E143D FpSP98 E230D FpSP98 E143D&E230D PCR products encoding the gene were ligated into the SmaI-digested pGEX-4T-2 vector according to the CloneExpress II One Step Cloning Kit (Novozymes, catalog number: C112-01) instructions to obtain pGEX-4T-2-FpSP98 and pGEX-4T-2-FpSP98, respectively. E143D pGEX-4T-2-FpSP98 E230D pGEX-4T-2-FpSP98 E143D&E230D The plasmid was further transformed into *E. coli* competent cells JM109, plated on LB agar plates (containing 100 μg / mL kanamycin), and incubated at 37°C for 16 h. Colony PCR was then performed for verification (using specific primers for the 4T-2-FpSP98 vector). Positive clones were picked, and the plasmid was extracted using a plasmid extraction kit (Takara, catalog number: 9760) and sent for sequencing (Shanghai Sangon Biotech). The correctly sequenced plasmid was then heat-shock transformed into *E. coli* Rossetta (DE3) competent cells and plated on LB agar plates (containing 100 μg / mL ampicillin). The cells were incubated at 37°C for 16 h, followed by colony PCR verification (using specific primers for the 4T-2-FpSP98 vector). Positive clones were picked for subsequent experiments.

[0065] The validated expression strain was activated and cultured overnight, with a strain containing the pGEX-4T-2 empty plasmid used as a control. 1 mL of the overnight culture was added to 100 mL LB liquid medium (2% inoculum) containing 100 μg / mL ampicillin. The culture was incubated at 37°C with shaking at 200 rpm for 2–3 h, until the OD600 reached 0.6–0.8. After pre-cooling at 4°C for 10 min, IPTG inducer was added to a final concentration of 0.5 mM. The culture was then continued at 20°C with shaking at 220 rpm for 16 h to induce the expression of the target protein. The bacterial cells were collected by high-speed centrifugation and added to buffer. The resulting bacterial suspension was then autoclaved, centrifuged at 12000 rpm at 4°C for 10 min, and the supernatant was collected to obtain the fusion protein expression solution. Further purification of the prokaryotic expressed protein was performed using an ÄKTA™ pure chromatography system. A 5 mL GST-tagged protein purification pre-packed column (Shanghai Yisheng, catalog number: 20510ES08) was used for affinity chromatography. The affinity chromatography column was first equilibrated with equilibration buffer (1×PBS). The protein supernatant obtained in the above steps was injected at a flow rate of 1 mL / min. After the injection, the column was washed with 100 mL of equilibration buffer (1×PBS) until the baseline stabilized. Elution was then performed with elution buffer (1×PBS, 10 mM reduced glutathione). The elution peak was collected, and the fractions of the elution peak were desalted and concentrated using an ultrafiltration tube. The purity of the protein was then detected by SDS-PAGE electrophoresis.

[0066] Example Result: A purified prokaryotic recombinant target protein (GST-FpSP98) with a size of approximately 50 kDa was obtained. E143D GST-FpSP98 E230D GST-FpSP98 E143D&E230D ), and the 25kDa empty vector GST protein (such as Figure 3 ).

[0067] Example 4. Activation of defense responses in plants by plant immune-inducing protein FpSP98 and its mutants.

[0068] (1) FpSP98 and FpSP98 E143D Compared to other mutant proteins, this protein induces a stronger burst of reactive oxygen species in plants.

[0069] Reactive oxygen species (ROS) bursts are one of the main immune responses of plants to resist pathogen invasion. We used the luminol method to assess the ROS bursts activated by induced resistance proteins in plants.

[0070] Add ddH2O to a 96-well plate, 200 μL per well. Using a clean punch with a diameter of 0.5 cm, punch leaf discs on the leaves of the tobacco plant. Use tweezers to pick up the leaf discs and place them in the 96-well plate with the back of the leaf discs facing up. Place the plate at room temperature in the dark overnight.

[0071] Preparation of treatment solutions: 200 μL per well: 35.4 μg / mL Luminol (Sigma, Catalog No.: 123072); 10 μg / mL Horseradish peroxidase (Sigma, Catalog No.: 77332); 0.01% (v / v) SILWETL-77; the purified recombinant target protein at a final concentration of 1 μM; and control protein GST protein.

[0072] Extract ddH2O from the 96-well plate and quickly add 200 μL of treatment solution. Place the reactive oxygen species plate in a ROS (Glomax, Promega) analyzer to detect and collect data.

[0073] The results analysis showed that GST-FpSP98, GST-FpSP98 E143D GST-FpSP98 E230D GST-FpSP98 E143D&E230D Both FpSP98 and GST empty vector proteins can activate immune responses on tobacco, but FpSP98 is the most effective. E143D Its activation strength for reactive oxygen species is comparable to that of FpSP98. E230D FpSP98 E143D&E230D Activated reactive oxygen species intensity and FpSP98 E143D It is weaker than FpSP98 (e.g.) Figure 4 This is consistent with the cell death intensity phenotype in Example 3 above. Therefore, the FpSP98 mutant, which loses its toxic function but does not change its immune activation function, was subsequently selected. E143D Conduct follow-up case studies.

[0074] (2) FpSP98 E143D It can activate the release of various plant reactive oxygen species.

[0075] 1) Add ddH2O to each well of a 96-well plate, 200 μL. 2) Using a clean punch with a diameter of 0.5 cm, punch leaf discs on the leaves of the target plants (soybeans, wheat, rice, strawberries, tomatoes, cucumbers, cotton, potatoes). Use tweezers to pick up the leaf discs and place them in the ddH2O in the wells of the 96-well plate, with the back of the leaf discs facing up. Place them at room temperature in the dark overnight.

[0076] Prepare the treatment solution as described above.

[0077] Extract ddH2O from the 96-well plate and quickly add 200 μL of treatment solution. Place the reactive oxygen species plate in a ROS (Glomax, Promega) analyzer to detect and collect data.

[0078] The results analysis showed that the optimized immune-activating protein GST-FpSP98 E143D It can activate the release of reactive oxygen species in multiple target plants within a short period of time (within 1 hour). Figure 5 ).

[0079] Example 5. Plant immune-inducing proteins enhance plant disease resistance.

[0080] (1) FpSP98 E143D It can help tobacco resist infection by tobacco mosaic virus.

[0081] The purified GST-FpSP98 E143DThe protein and control protein GST were diluted to 500 nM with spray buffer (0.01% (v / v) SILWETL-77 aqueous solution) and sprayed evenly onto tobacco (Nicotiana benthamiana). Three plants were used in each of the experimental and treatment groups, with three replicates. After 24 h of induction, infectious clones of Tobacco mosaic virus tagged with GFP were rubbed onto the treated leaves. Ten days after inoculation, the disease phenotype was observed under UV light. Samples were collected and Western blot was used for quantitative determination of Tobacco mosaic virus infection. The specific Western blot procedure was as follows: diseased tobacco leaves were collected, flash-frozen in liquid nitrogen, ground, and mixed with protein extraction buffer (components: 150 mM NaCl, 50 mM Tris-HCl, pH 7.5, 1.0% (v / v) NP-40, 1.0% (v / v) protease inhibitor cocktail). The mixture was placed on ice for lysis for 30 min. Centrifuge at 12000g, 4℃, collect 80 μL of supernatant, add 20 μL of 5× protein loading buffer, mix well, and incubate in a boiling water bath for 10 min. Take 20 μL of sample and perform electrophoresis on an SDS-PAGE gel, run the gel at 120 V for 1.5 h. After gel running, transfer the protein sample to a PVDF membrane and block with 1×PBST containing 5% (w / v) skim milk for 1 h. Add 1:5000 diluted GFP primary antibody (Abmart, catalog number: M20004S) and incubate for 4 h, then wash the membrane three times with 1×PBST for 5 min each time. Then add 1:10000 diluted mouse antibody (LI-CORirdye 800, catalog number 926-32210) and incubate for 60 min, then wash the membrane three times with 1×PBST for 5 min each time. Scan the membrane, take pictures and record the data, and analyze the gray values ​​of the Western blot bands using ImageJ.

[0082] Results: Compared with the control protein, GST-FpSP98 was used E143D The treated tobacco leaves all showed a significant reduction in symptoms after inoculation with tobacco mosaic virus. Figure 6 In (a), the biomass of tobacco mosaic virus infection was significantly reduced. Figure 6 (b)

[0083] (2) FpSP98 E143D It can help tobacco resist infection by Phytophthora infestans.

[0084] The purified GST-FpSP98 E143DGST protein and control protein were diluted to 500 nM with spray buffer (0.01% (v / v) SILWETL-77 aqueous solution) and uniformly sprayed onto tobacco (Nicotiana benthamiana). Three plants were used in each of the experimental and treatment groups, with three replicates. After 24 h of induction, Phytophthora tobaccois (a fungus) was inoculated onto the sprayed leaves. Phytophthora parasitica Two days after inoculation, samples were taken and quantitative real-time PCR was used to determine the biomass of Phytophthora tobacco infection.

[0085] The specific steps for quantitative real-time PCR are as follows: Total RNA was extracted using the Omega RNA extraction kit according to the instructions, and the RNA content and quality were measured using a spectrophotometer; 1 μg of RNA was used as a template, and cDNA synthesis was performed according to the instructions for the Takara PrimeScript reverse transcriptase reagent, with the volume adjusted to 20 μL. An appropriate amount of the reverse transcription product was used for subsequent quantitative real-time PCR, which was performed according to the instructions for the Vazyme Taq Pro Universal SYBR qPCR Master Mix (catalog number: Q712).

[0086] The quantitative internal control primers for Phytophthora indicum are:

[0087] Upstream primer: ATGAACTTCCGCGCTCTGTTC (SEQ ID NO.13);

[0088] Downstream primer: CAGTGACGCGCACGTAGACGA (SEQ ID NO.14).

[0089] The tobacco quantitative internal control primer is:

[0090] Upstream primer: TGGTGTCCTCAAGCCTGGTA (SEQ ID NO.15);

[0091] Downstream primer: TGCATATCCTGAGAAACCATT (SEQ ID NO.16).

[0092] Results: Compared with the control protein, GST-FpSP98 was used E143D The treated tobacco leaves all showed a significant reduction in lesion diameter after inoculation with Phytophthora tobaccois. Figure 7 In (a), the biomass of *Phytophthora indicum* infection was significantly reduced. Figure 7 (b)

[0093] (3) FpSP98 E143D It can help soybeans resist infection by soybean mosaic virus.

[0094] The purified GST-FpSP98 E143D The protein and control protein GST were diluted to 500 nM with spray buffer (0.01% (v / v) SILWETL-77 aqueous solution) and sprayed evenly onto soybean (Hefeng 47) leaves. Three plants were used in each of the experimental and treatment groups, with three replicates. After 24 h of induction, infectious clones of soybean mosaic virus (SMV) with GFP fluorescent tags were rubbed onto the sprayed leaves. Fourteen days after inoculation, the disease phenotype of the plants was observed under UV light, and samples were taken for quantitative determination of SMV infection using Western blot.

[0095] Results: Compared with the control protein, GST-FpSP98 was used E143D Soybean leaves treated with soybean mosaic virus showed a significant reduction in symptoms after inoculation with the virus. Figure 8 In (a), the biomass of soybean mosaic virus infection was significantly reduced. Figure 8 (b)

[0096] (4) FpSP98 E143D It can help soybeans resist infection by soybean rust fungus.

[0097] The purified GST-FpSP98 E143D The protein and control protein GST were diluted to 500 nM with spray buffer (0.01% (v / v) SILWETL-77 aqueous solution) and sprayed evenly onto soybean (Hefeng 47) leaves. Three plants were used in each of the experimental and treatment groups, with three replicates. After 24 h of induction, the pre-stored soybean rust fungus (GST) was removed from the freezer at -80 ℃. Phakopsorapachyrhizi Uredinium spores were heat-shocked in a 42 ℃ water bath for 5 min, then suspended in 0.1% (v / v) Tween-20, centrifuged at 12000 rpm at room temperature for 5 min, the Tween solution was discarded, and sterile water was added to prepare 1.0×10⁻⁶ spores. 5 A spore suspension of 1 spore / mL was placed in a spray bottle and evenly sprayed onto the leaves of the immunized soybean plants. After the soybean leaves were moistened, the soybeans were placed in an incubator at 25 ℃ with a photoperiod of 16 h light and 8 h dark and high humidity. FpSP98 was observed in the greenhouse 14 days after inoculation. E143D To assess the effectiveness of soybean rust control, samples were taken and the biomass of soybean rust fungus infection was determined using quantitative real-time PCR.

[0098] The quantitative internal control primers for soybean rust fungus are:

[0099] Upstream primer: CCAAGGCTTCTTCGTGTTTCA (SEQ ID NO.17);

[0100] Downstream primer: CAAGAGAAGAGCGCCAAACC (SEQ ID NO.18).

[0101] The soybean quantitative internal control primers are:

[0102] Upstream primer: CGGGACCAGTGTGCTTCTTCA (SEQ ID NO.19);

[0103] Downstream primer: CCCCTCCACTACAAAGGCTCG (SEQ ID NO.20).

[0104] Results: Compared with the control protein, GST-FpSP98 was used E143D Soybean leaves treated with this method showed a significant reduction in lesions after inoculation with soybean rust. Figure 9 In (a), the biomass of soybean rust fungus infection was significantly reduced ( Figure 9 (b)

[0105] (5) FpSP98 E143D It can help soybeans resist infection by Phytophthora infestans.

[0106] The purified GST-FpSP98 E143D The protein and control protein GST were diluted to 100 nM with a buffer solution (0.01% (v / v) SILWETL-77 aqueous solution). Etiological soybean seedlings (Hefeng 47) were immersed in the diluted solution. Three seedlings were used in each of the experimental and treatment groups, with three replicates. After 12 h of induction, *Phytophthora indicum* (soybean phytodes) was inoculated at the hypocotyl of the etiolated soybean seedlings. Phytophthora sojae Zoospores (concentration 100 spores / μL) were collected, and FpSP98 was observed after 48 hours of incubation at 25°C in the dark. E143D To assess the effectiveness of control over soybean blight, samples were taken and the biomass of *Phytophthora infestans* infection was determined using quantitative real-time PCR.

[0107] The quantitative internal control primers for soybean Phytophthora are:

[0108] Upstream primer: ACTGCACCTTCCAGACCATC (SEQ ID NO.21);

[0109] Downstream primer: CCACCACCTTGATCTTCATG (SEQ ID NO.22).

[0110] The soybean quantitative internal control primers are:

[0111] Upstream primer: CGGGACCAGTGTGCTTCTTCA (SEQ ID NO.19);

[0112] Downstream primer: CCCCTCCACTACAAAGGCTCG (SEQ ID NO.20).

[0113] Results: Compared with the control protein, GST-FpSP98 was used E143D After treatment of soybean hypocotyls, inoculation with Phytophthora soybean resulted in a significant reduction in symptoms. Figure 10 In (a), the relative biomass of soybean infected with Phytophthora indicum was significantly reduced. Figure 10 (b)

[0114] (6) FpSP98 E143D It can help potatoes resist infection by pathogenic Phytophthora.

[0115] The purified GST-FpSP98 E143D GST protein and control protein were diluted to 1 μM with buffer solution (0.01% (v / v) SILWETL-77 aqueous solution) and sprayed evenly onto potato (Desiree) leaves. Three plants were used in each of the experimental and treatment groups, with three replicates. After 12 h of induction, the treated leaves were sprayed with Phytophthora inoculum (…). Phytophthora infestans ) spores (concentration of 100 spores / μL) were released, and the soybean leaves were kept moist. The soybeans were then placed in a high-humidity incubator at 25℃ with a photoperiod of 16 h light and 8 h darkness, maintaining humidity as needed. After one week, the FpSP98 spores in the greenhouse were observed. E143D To assess the control effect against potato late blight, samples were taken and the biomass of pathogenic Phytophthora infestans was determined using quantitative real-time PCR.

[0116] The quantitative internal control primers for Phytophthora infestans are:

[0117] Upstream primer: AGAACTCGTCATACTTCGTCGA (SEQ ID NO.23);

[0118] Downstream primer: CTTGAACATCTCTTGGATAGCAG (SEQ ID NO.24).

[0119] The quantitative internal control primers for potatoes are:

[0120] Upstream primer: TTTGGCCCTACTGGTTTGAC (SEQ ID NO.25);

[0121] Downstream primer: GCACTGGAGCATATCCGTTT (SEQ ID NO.26)

[0122] Results: Compared with the control protein, GST-FpSP98 was used E143D Potato leaves treated with Phytophthora showed a significant reduction in symptoms after inoculation with the pathogenic fungus. Figure 11 In (a), the relative biomass of pathogenic Phytophthora infection was significantly reduced ( Figure 11 (b)

[0123] (7) FpSP98 E143D It can help rice resist infection by rice blast fungus.

[0124] The purified GST-FpSP98 E143D The protein and control protein GST were diluted to 1 μM with buffer solution (0.01% (v / v) SILWETL-77 aqueous solution) and sprayed evenly onto the leaves of rice (CO39). Three plants were used in each of the experimental and treatment groups, with three replicates. After 12 h of induction, rice blast fungus (GST) was sprayed onto the treated leaves. Magnaportheoryzae )Spore suspension (1×10 5 (number per mL). The inoculated rice was placed in an incubator at 25℃ and 90% humidity. It was first cultured in the dark for 24 h, and then cultured for 7 days under alternating light and dark conditions for 12 h each. The disease incidence was then statistically analyzed and photographed.

[0125] Results: Compared with the control, using GST-FpSP98 E143D The treated rice plants all showed a significant reduction in symptoms after inoculation with rice blast fungus. Figure 12 (a and b).

[0126] (8)FpSP98 E143D It can help wheat resist infection by Fusarium graminearum.

[0127] The purified GST-FpSP98 E143D GST protein and control protein were diluted to 1 μM with buffer solution (0.01% (v / v) SILWETL-77 aqueous solution) and used to soak and germinate wheat (Fielder) seeds. Three plants were used in each of the experimental and treatment groups, with three replicates. After the wheat seedlings developed coleoptiles, they were inoculated with *Fusarium graminearum*. Fusarium pseudograminearum FpSP98 was inoculated with 200 spores / μL and then placed in a dark, high-humidity incubator. FpSP98 was observed after 2 days. E143D The study investigated the control effect of *Fusarium graminearum* on wheat stem base rot and determined the biomass of *Fusarium graminearum* infection by sampling and quantitative real-time PCR.

[0128] The quantitative internal control primers for Fusarium graminearum are:

[0129] Upstream primer: AGTACTCCGTCTGGATCGGT (SEQ ID NO.27);

[0130] Downstream primer: GATTTGAAGGACCGCTCTCGT (SEQ ID NO.28).

[0131] The quantitative internal reference primers for wheat are:

[0132] Upstream primer: GATGCAGCCAACAACTTCGCC (SEQ ID NO.29);

[0133] Downstream primer: CAGTTCCACCTCCAACAGCGT (SEQ ID NO.30).

[0134] Results: Compared with the control protein, GST-FpSP98 was used E143D Wheat treated with Fusarium graminearum showed significant symptom relief after inoculation. Figure 13 In the middle (a), the relative biomass of *Fusarium graminearum* infection was significantly reduced ( Figure 13 (b)

Claims

1. A plant immunity eliciting protein secreted by Fusarium pseudograminearum, characterized in that, The amino acid sequence of which is shown as SEQ ID NO.

3.

2. The gene encoding the plant immune elicitor protein of claim 1, the nucleotide sequence of which is shown as SEQ ID NO.

8.

3. An expression cassette comprising the gene encoding of claim 2.

4. A recombinant vector comprising the gene encoding of claim 2.

5. The recombinant vector of claim 4, wherein, The recombinant vector is a prokaryotic expression vector obtained by inserting the gene encoding the plant immune elicitor protein of claim 1 into pGEX-4T-2.

6. A recombinant bacterium comprising the gene encoding of claim 2.

7. Use of the plant immune elicitor protein of claim 1, the gene encoding of claim 2, the expression cassette of claim 3, the recombinant vector of claim 4 or 5, or the recombinant bacterium of claim 6 in inducing plant defense response and improving plant disease resistance; The plant is tobacco, soybean, rice, wheat or potato; The disease resistance of tobacco refers to the tobacco diseases caused by Phytophthora parasitica and tobacco mosaic virus; The disease resistance of soybean refers to the soybean diseases caused by soybean rust and soybean mosaic virus; The disease resistance of rice refers to the rice diseases caused by Pyricularia oryzae; The disease resistance of wheat refers to the wheat diseases caused by Fusarium; The disease resistance of potato refers to the potato diseases caused by Phytophthora infestans.

8. A method of controlling plant diseases, characterized by, The plant diseases caused by Fusarium, Phytophthora parasitica, Phytophthora infestans, Pyricularia oryzae, Phytophthora parasitica, tobacco mosaic virus, soybean mosaic virus and soybean rust are treated with the plant immune elicitor protein of claim 1; The disease resistance of tobacco refers to the tobacco diseases caused by Phytophthora parasitica and tobacco mosaic virus; The disease resistance of soybean refers to the soybean diseases caused by soybean rust and soybean mosaic virus; The disease resistance of rice refers to the rice diseases caused by Pyricularia oryzae; The disease resistance of wheat refers to the wheat diseases caused by Fusarium; The disease resistance of potato refers to the potato diseases caused by Phytophthora infestans.

Citation Information

Patent Citations

  • Plant immune activator protein FoPII1 secreted by fusarium oxysporum and its application

    CN110194790A

  • Plant immune induced resistance protein FgPII1 secreted by fusarium graminearum and application of plant immune induced resistance protein FgPII1

    CN110922457A