Application of silencing StSDP1 gene in breeding high quality potato
By silencing the potato StSDP1 gene, the content of linoleic acid and glucose is regulated, improving the aroma and appearance quality of potatoes. This solves the problem of poor aroma characteristics in existing technologies and enables the cultivation of high-quality potatoes.
Patent Information
- Application Number
- CN202511395358.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-28
- Publication Date
- 2026-02-27
- Estimated Expiration
- 2045-09-28
AI Technical Summary
Existing technologies cannot effectively control the oxidation process of unsaturated fatty acids in potatoes, resulting in poor aroma characteristics and failing to meet consumers' diverse demands for high-quality potatoes.
By silencing the StSDP1 gene using genetic engineering techniques, and downregulating its expression in potatoes using the CRISPR-Cas system or RNA interference technology, the content of linoleic acid and glucose is regulated, the production of lipid oxidized aldehyde compounds is increased, and the aroma characteristics are improved.
A potato germplasm resource with high linoleic acid and low glucose content was successfully created, which significantly enhances aroma and improves appearance quality, making it suitable for people with diabetes and high blood sugar. It has important health value and economic significance.
Smart Images

Figure CN120866407B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of agricultural biotechnology, and particularly relates to application of silencing StSDP1 gene in breeding high-quality potatoes. BACKGROUND
[0002] Potato, as the fourth largest food crop in the world, plays an important role in the world food security pattern, and its edible quality research is crucial for improving human nutrition and meeting market demand. Potato is rich in nutrients such as carbohydrates, proteins, dietary fiber, vitamins and minerals, which not only determine the basic nutritional value of potato, but also have an important impact on its edible quality, especially the aroma characteristics. With the deepening of the concept of healthy diet, developing potato varieties with better quality and better flavor to meet the diversified needs of consumers has become an important direction of potato research.
[0003] Aroma is one of the key indicators of potato edible quality, which directly affects the acceptance of consumers. The aroma characteristics of potato are mainly composed of various volatile flavor substances, most of which are converted from specific aroma precursors during the cooking process. In potato, lipids, especially unsaturated fatty acids, are important precursors of aroma. When potato is cooked, unsaturated fatty acids such as linoleic acid are broken down during oxidation to produce a variety of aroma compounds, especially various lipid oxidation aldehydes, which make a significant contribution to the flavor characteristics of potato products. Lipid oxidation aldehyde is an important contributor to the unique aroma of potato, mainly derived from the oxidative degradation of unsaturated fatty acids. During the cooking process of potato tubers, polyunsaturated fatty acids such as linoleic acid are oxidized under the action of enzymes such as lipoxygenase to form lipid oxidation aldehyde compounds such as hexanal, 2-hexenal and 2-heptenal. The types, contents and proportions of these lipid oxidation aldehydes directly determine the aroma characteristics and intensity of potato, and by regulating the content of precursor linoleic acid and its oxidation pathway, the aroma quality of potato can be effectively improved.
[0004] The application breaks the limitations brought by the genetic background itself by screening key genes affecting potato aroma substances, and uses genetic engineering means to regulate the content of key primary metabolites in potato, so as to realize flavor improvement and cultivate more potato varieties with excellent quality. SUMMARY
[0005] The main purpose of the application is to provide application of silencing StSDP1 gene in improving potato quality, down-regulate the expression of sugar-dependent protein 1 (StSDP1) gene by genetic engineering technology, and create potato high-linoleic acid and low-glucose germplasm resources. Specifically, the application provides the following technical solutions:
[0006] The application provides an application of silencing StSDP1 gene in cultivating high-quality potatoes by genetic engineering technology, wherein the StSDP1 gene sequence is shown as SEQ ID NO:1, and the high quality is any one of the following a, b or c: a high content of linoleic acid; b) low glucose content; c) high content of aroma substances.
[0007] The application also provides an application of a product of silencing StSDP1 gene in cultivating high-quality potatoes, wherein the StSDP1 gene sequence is shown as SEQ ID NO:1, and the high quality is any one of the following a, b or c: a high content of linoleic acid; b) low glucose content; c) high content of aroma substances.
[0008] Further, the product includes a gene editing product or an RNA interference product.
[0009] Further, the gene editing product includes a CRISPR-Cas system editor; and / or the RNA interference product includes siRNA, shRNA, miRNA or dsRNA.
[0010] Further, the sequence of the dsRNA is shown as SEQ ID NO:2.
[0011] Further, the product includes a kit or a reagent.
[0012] The application also provides a method for cultivating high-quality potatoes, wherein a vector for silencing StSDP1 gene is constructed by genetic engineering technology, is introduced into potato recipient plant cells, and is subjected to genetic transformation to obtain regenerated plants, and whether the StSDP1 gene is successfully silenced is detected, and plants with successful silencing are screened, wherein the StSDP1 gene sequence is shown as SEQ ID NO:1.
[0013] Further, the genetic engineering technology includes gene editing technology or RNA interference technology.
[0014] Further, the RNA interference technology includes the following steps:
[0015] (1) total RNA of potatoes is extracted, and a first strand of cDNA is obtained by reverse transcription;
[0016] (2) the cDNA obtained in step (1) is used as a template to perform PCR amplification;
[0017] (3) the PCR product in (2) is used as a template to perform PCR amplification, and the positive and negative templates of the amplified dsRNA sequence are obtained;
[0018] (4) product recovery is completed, a StSDP1-RNAi interference vector is constructed, and genetic transformation is performed in potatoes.
[0019] Further, the dsRNA sequence is as shown in SEQ ID NO. 2.
[0020] Compared with the prior art, the application has the following beneficial effects:
[0021] By specifically down-regulating the expression of potato StSDP1 gene through RNA interference technology, a potato germplasm resource with high linoleic acid and low glucose content is successfully created. Under boiling water cooking conditions, due to the increase of linoleic acid content by 3-4 times and the decrease of glucose content by 38%, the content of lipid oxidized polyunsaturated aldehyde in the tuber is significantly increased, so that the flavor and aroma are enhanced; under air frying conditions, due to the decrease of glucose content, the browning and blackening phenomenon caused by Maillard reaction is reduced, so that the fried potato presents golden yellow color, and the appearance quality is significantly improved. In addition, the decrease of glucose content makes the germplasm resource more suitable for people with diabetes and high blood sugar to eat, which has important health value. The application provides a new technical approach and germplasm resource for the directional improvement of potato quality, and has important significance for promoting the development of potato industry and improving the added value of products. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 For StSDP1 The result graph of identification of the RNAi gene interference strain; A is expression identification, and B is an expression amount statistical graph, wherein Q9cK refers to a wild type control; 1_4, 1_38, 1_11; 111-3, 138-1, 111-5, 104-3, 111-7, 111-9, 111-6, 104-1 are all strain numbers.
[0023] Figure 2 For StSDP1 The result graph of phenotype of the RNAi gene interference strain.
[0024] Figure 3 For StSDP1 The statistical graph of linoleic acid (C182) and total fatty acid (Total) content level difference of the RNAi gene interference strain; wherein A is linoleic acid (C182); B is total fatty acid (Total).
[0025] Figure 4 For StSDP1 The fluorescence observation graph of lipid droplet distribution in the RNAi gene interference strain material; note: blue is the nucleus structure, green is the lipid, and the green dot is the lipid droplet; WT refers to the wild type control.
[0026] Figure 5 For StSDP1 The statistical graph of D-glucose content abundance change in the representative strain of the RNAi gene interference.
[0027] Figure 6 Figure 6 is a chart of the change in the content of lipid oxidation products during the tuber curing process; Note: 20 min is the curing time for the phosphorus sulfur test and other volatile compound detection in boiling water cooking tests.
[0028] Figure 7 Figure 7 is a chart of the change in the color of the interfering material after air frying curing, Note: CK on the left side refers to the control, and 104-1 on the right side refers to StSDP1 -RNAi gene interference strain. DETAILED DESCRIPTION
[0029] In order to make the content described in the present application more convenient to understand, the technical solutions described in the present application will be further described below in combination with specific embodiments, but the present application is not limited thereto. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified. Example 1
[0030] 1. StSDP1 gene specific sequence amplification
[0031] The StSDP1 gene sequence is shown in SEQ ID NO: 1, and according to the sequence information, the StSDP1 gene specific primers are designed as shown in Table 1.
[0032] Table 1
[0033] F: TCTGAGGAACGAGATTGTTGAGG R: ATGATGGCAGTGACAGTGAGC
[0034] 2. Culture of test plant material
[0035] The potato variety 'Qingshu No. 9' used in the experiment was from the Potato Crop Research Institute of Yunnan Agricultural University, and the tissue culture seedlings were cultured in an artificial climate chamber. The medium used was MS30 solid medium (4.43 g / L MS basic salt + 30 g / L sucrose + 8 g / L agar, pH = 5.8), and the culture conditions were 23°C, 16h light / 8h darkness, and light intensity 3000lx.
[0036] 3. Extraction of RNA
[0037] Total RNA was extracted from potato leaves. 100 mg of fresh leaf tissue was weighed, and the total RNA was extracted according to the instructions of the RNAprep pure plant total RNA extraction kit of TianGen company.
[0038] 4. Synthesis of cDNA
[0039] cDNA was synthesized according to the instruction of the PrimeScript™ RT reagent Kit from KangRui Bioengineering Corporation. Specifically, the reverse transcription system was prepared as follows: 1 μg of the total RNA described above, 1 μl of oligo dT, 6.5 μl of nuclease-free water, 65 °C for 5 min in a PCR instrument; then 5x PrimeScript Buffer 4 μl, PrimeScript RT Enzyme Mix I 1 μl, RNase Inhibitor 0.5 μl were added. 37 °C for 60 min, 85 °C for 5 sec in a PCR instrument. After synthesis, the cDNA was stored in a refrigerator at -20 °C.
[0040] 5. Construction of StSDP1-RNAi interference vector
[0041] The dsRNA sequence for silencing of the StSDP1 gene was designed based on the RNAi interference technology, and the dsRNA sequence is shown as SEQ ID NO: 2. The RNA interference vector for silencing the StSDP1 gene was constructed using the Gateway technology. The Gateway technology is a fast and efficient gene cloning technology based on the bacteriophage lambda site-specific recombination system, which can avoid multiple enzyme digestion and ligation steps in traditional cloning methods. The Gateway technology manual of Invitrogen Corporation was followed, and the construction process was as follows:
[0042] (1) Amplification of the target gene fragment: The cDNA of 'Qingshu No. 9' was used as the template, and the primers in Table 1 were used for PCR amplification to obtain the StSDP1 specific fragment containing attB1 and attB2 sites. The PCR reaction system (50 μL) was as follows: 2x Phanta Max Master Mix 25 μL, 10 μmol / L upper and lower primers 2 μL each, template cDNA 2 μL, sterile distilled water 19 μL. The PCR reaction program was as follows: 95 °C for 3 min; 95 °C for 15 s, 58 °C for 15 s, 72 °C for 30 s, for a total of 35 cycles; 72 °C for 5 min. After the reaction was completed, agarose gel electrophoresis was performed, and then the target PCR product was recovered using a gel recovery kit.
[0043] (2) BP reaction: the PCR product obtained in the previous step was subjected to BP recombination reaction with the pDONR201 vector, and the reaction system (10 μL) was as follows: PCR product (50-100 ng) 2 μL, pDONR201 vector (150 ng / μL) 1 μL, BP Clonase II enzyme mixture 2 μL, TE buffer 5 μL. After thorough mixing, the reaction was carried out at room temperature overnight. After the reaction was completed, 1 μL of proteinase K was added, and the reaction was terminated by incubation at 37 °C for 10 min.
[0044] (3) Transformation of E. coli DH5a competent cells: 2 μL of the BP reaction product was added to 100 μL of E. coli DH5a competent cells, which were then incubated in an ice bath for 30 min, heated at 42°C for 60 s, and then incubated in an ice bath for 2 min. Then, 900 μL of SOC medium was added, and the mixture was incubated at 37°C for 1 h. 100 μL of the bacterial solution was spread on an LB plate containing 50 mg / L of kanamycin, and the plate was incubated at 37°C overnight.
[0045] (4) Positive clone screening and sequencing: a single colony was inoculated into liquid LB medium containing 50 mg / L of kanamycin, and the mixture was incubated at 37°C overnight. After the plasmid was extracted, PCR identification and sequencing verification were performed to confirm the correctness of the entry clone vector pENTR-StSDP1.
[0046] (5) LR reaction: the correctly sequenced entry clone vector pENTR-StSDP1 and the target vector pBWA(V)KS were subjected to LR recombination reaction, and the reaction system (10 μL) was as follows: pENTR-StSDP1 (50-100 ng) 2 μL, pHellsgate8 vector (150 ng / μL) 1 μL, LR Clonase II enzyme mixture 2 μL, and TE buffer 5 μL. After thorough mixing, the mixture was incubated at room temperature overnight. After the reaction was completed, 1 μL of proteinase K was added, and the mixture was incubated at 37°C for 10 min to terminate the reaction.
[0047] (6) Transformation of E. coli DH5a competent cells: 2 μL of the LR reaction product was added to 100 μL of E. coli DH5a competent cells, which were then subjected to transformation and screening according to the above method, and an LB plate containing 100 mg / L of spectinomycin was used.
[0048] (7) Expression vector extraction and verification: after the plasmid was extracted, PCR and enzyme digestion were used to verify the correctness of the recombinant expression vector pBWA(V)KS-RNAi-StSDP1. The correctly verified expression vector was transformed into Agrobacterium GV3101 by electroporation, and a YEP plate containing 50 mg / L of rifampicin, 25 mg / L of gentamicin, and 100 mg / L of spectinomycin was used to screen positive transformants, which were further verified by PCR.
[0049] (8) The RNAi expression vector pBWA(V)KS-RNAi containing the hairpin structure of the StSDP1 gene fragment arranged in both forward and reverse directions was finally obtained. The vector stably exists in Agrobacterium and can be used in subsequent potato genetic transformation experiments.
[0050] 6. Potato genetic transformation
[0051] The pBWA(V)KS-RNAi-StSDP1 vector was transformed into potato 'Qingshu No. 9' by Agrobacterium-mediated method. The specific steps are as follows:
[0052] (1) Preparation of Agrobacterium liquid: Agrobacterium GV3101 containing pBWA(V)KS-RNAi-StSDP1 vector glycerol bacteria were taken out from -80°C refrigerator, and streaked on YEP plates containing 50 mg / L rifampicin, 25 mg / L gentamicin and 100 mg / L spectinomycin. Single colonies were inoculated into 10 mL liquid YEP medium containing the same antibiotics, and cultured at 28°C, 200 r / min in a shaker until OD 600 =0.8. The bacterial cells were collected by centrifugation at 4000 r / min at room temperature for 5 min, and then resuspended in MS liquid medium (4.43 g / L MS + 16 g / L glucose + 0.5 g / L MES, pH = 5.8) to OD 600 =0.6 for standby.
[0053] (2) Leaf transformation and regeneration procedure: the leaves of well-grown potato 'Qingshu No. 9' tissue culture seedlings were cut into small pieces of about 0.5 cm², and placed in 90 mm culture dishes containing 10 mL MS liquid medium and 80 μL Agrobacterium liquid (OD 600 =0.6). The co-culture was carried out at 23°C in the dark for 2 days. After co-culture, the leaves were transferred to sterile filter paper to absorb the surface liquid, and then transferred to CIM medium (4.43 g / L MS + 16 g / L glucose + 0.5 g / L MES + 8 g / L agar + 5 mg / L NAA + 0.1 mg / L 6-BA, pH = 5.8) containing 250 mg / L Cef and 50 mg / L Kan to induce callus formation. After 10 days, the leaves were transferred to SIM medium (4.43 g / L MS + 16 g / L glucose + 0.5 g / L MES + 8 g / L agar + 0.02 mg / L NAA + 2 mg / L ZT + 0.1 mg / L GA3, pH = 5.8) containing 250 mg / L Cef and 50 mg / L Kan. The medium was replaced every 7-10 days until the callus differentiated into adventitious buds. When the adventitious buds grew to 2-3 cm, they were cut and transferred to MS30 solid medium containing 50 mg / L Kan for rooting culture. After independent regeneration lines were obtained, they were used for subsequent screening and identification.
[0054] 7. PCR detection of transgenic plants
[0055] (1) Extraction of genomic DNA from transgenic potato leaves: Take about 100 mg of fresh leaves and extract genomic DNA using the CTAB method.
[0056] (2) PCR detection: Specific primers were designed to amplify the Kan gene and StSDP1-RNAi structure in the T-DNA region. PCR reaction system (20 μL): 10 μL 2×EsTaq MasterMix, 0.5 μL forward primer (10 μmol / L), 0.5 μL reverse primer (10 μmol / L), 1 μL template DNA (~50 ng / μL), 8 μL ddH2O. PCR reaction program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 32 cycles; 72℃ final extension for 10 min. The amplified products were detected by electrophoresis on a 1% agarose gel.
[0057] 8. RT-qPCR analysis of transgenic plants
[0058] (1) Total RNA extraction and cDNA synthesis: Total RNA was extracted from transgenic and non-transgenic control potato tubers and cDNA was synthesized according to steps 4 and 5 above.
[0059] (2) RT-qPCR analysis: Using SYBR Green I fluorescent dye and the potato EF1α gene as an internal reference, specific primers were designed to detect the expression level of the StSDP1 gene. The PCR reaction system (20 μL) consisted of: 10 μL 2×SYBR GreenMaster Mix, 0.4 μL forward primer (10 μmol / L), 0.4 μL reverse primer (10 μmol / L), 2 μL cDNA template, and 7.2 μL ddH2O. The PCR reaction program was: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 60℃ annealing and extension for 60 s, for 40 cycles. The relative expression level was calculated using the 2^(-ΔΔCt) method, with three biological replicates for each sample.
[0060] 9. Results
[0061] Figure 1 The results of the identification of transgenic lines are presented. The transgenic materials were identified using kanamycin resistance markers. Figure 1 A), with a conversion efficiency of approximately 46%. StSDP1 Among the single-interference transgenic lines, three lines, 1-04, 1-38, and 1-11, were selected. Tubers harvested from the T0 generation plants were then planted to harvest T1 generation tubers, and the results were analyzed. StSDP1 ( Figure 1The relative expression levels of the genes in the transgenic lines were determined by quantitative RT-PCR. The results showed that the expression levels of the genes in the transgenic lines were effectively reduced by RNA interference. In StSDP1 The single interference material (orange) is shown in the figure, StSDP1 The expression levels of the two lines 111-3 and 138-1 were reduced by more than 10 times, and the expression levels of the two lines 111-3 and 138-1 were reduced by more than 10 times. StSDP1- RNAi The phenotype of the transformed material was observed, and the results are shown in the figure. Figure 2 As shown in the figure, the representative transgenic lines (138-1, 111-3 and wild type control (Q9ck) showed obvious differences in phenotypic characteristics. StSDP1 The aboveground parts of the single gene interference lines (138-1 and 111-3) grew well, and the leaves were normal dark green, and the morphology and size were similar to the wild type, indicating that the inhibition of the genes did not affect the normal photosynthesis and vegetative growth of the plants. SDP1 The tuber development of the two lines was also good, among which 138-1 produced larger long oval red skin tubers with a light yellow cross section; 111-3 produced medium-sized oval red skin tubers with a darker yellow cross section. Example 2
[0062] 1. Fatty acid content analysis
[0063] (1) Extraction of total fat from potato tubers: After freeze-drying and grinding, 50 mg of dry sample was weighed, 2 mL of n-hexane:isopropyl alcohol mixed solution (3:2, v / v) was added, and it was extracted at 60°C water bath for 30 min. After centrifugation, the supernatant was collected, and the extraction was repeated 3 times. The supernatant was combined and blown dry with nitrogen to obtain the total fat extract.
[0064] (2) Fatty acid methyl esterification: 2 mL of methanol-sulfuric acid (97:3, v / v) solution was added to the total fat extract, and it was extracted at 70°C water bath for 2 h. After cooling, 1 mL of n-hexane and 1 mL of water were added, and it was vortexed to mix. The upper organic phase was taken, and it was concentrated to about 100 μL with nitrogen.
[0065] (3) GC analysis: The instrument used was Agilent 7890A gas chromatograph, the injection port was in splitless mode, the temperature was 250°C, the injection amount was 1 ul, DB-FastFAME (30 m × 0.25 mm, 0.25 um, Agilent, USA) was used, the carrier gas was helium, and the constant pressure was 12 psi. The temperature program was 80°C for 5 min, then increased to 165°C at 40°C / min, then increased to 230°C at 4°C / min, and then kept for 4 min. The detector temperature was 260°C, the hydrogen flow was 40 ml / min, the air flow was 400 ml / min, the tail gas was nitrogen, and the flow was 25 ml / min. A mixture of C14-C24 fatty acid standards was used to quantify the fatty acid content.
[0066] 2. Fluorescence microscopic observation of transgenic potato materials
[0067] Transgenic tubers were collected after RNAi interference and stored on ice until section preparation for imaging. Fresh, thin hand-operated sections were stained for 10 minutes with a solution containing 50 mM PIPES pH 7 and 2 µg / mL BODIPY 505–515 (4,4-difluoro-1,3,5,7-tetramethyl-4-boron-3a,4a-diazol-m-indocyanine). They were then rinsed in PIPES pH 7 and imaged immediately. Control sections were placed directly in 50 mM PIPES pH 7 for 10 minutes and then mounted on slides for imaging to establish tissue background fluorescence. All samples were imaged using a confocal laser scanning microscope (Leica TCS SP8) equipped with a white light laser and a 40× water immersion objective, controlled by LAS X software (Leica Microsystems).
[0068] 3. Results
[0069] Figure 3 The study demonstrated the differences in linoleic acid (C18:2) and total fatty acid (Total) levels among RNAi-interfered strains. The results indicate that RNAi interference mediates... StSDP1 Expression inhibition significantly altered the fatty acid content and composition of potato tubers. StSDP1 Gene interference most effectively increased the total fatty acid content of tubers, with the 111-3, 138-1, and 111-5 transgenic lines showing the most outstanding performance. Their total fatty acid contents reached 149.5 μg / 100mg, 127.8 μg / 100mg, and 124.1 μg / 100mg, respectively, representing increases of 57%, 33%, and 30% compared to the wild type. The linoleic acid (C18:2) content in these lines was also significantly increased, reaching 70.4 μg / 100mg, 59.6 μg / 100mg, and 59.4 μg / 100mg in the 111-3, 138-1, and 111-5 lines, respectively, an increase of 3-4 times compared to the wild type.
[0070] Fluorescence microscopy observation results ( Figure 4 This clearly demonstrates the significant impact of RNA interference-regulated lipid metabolism genes on oil body formation and accumulation in potato tuber cells. As shown in the figure, there are significant differences in the distribution and number of oil bodies between transgenic lines and wild-type lines. StSDP1A large number of green fluorescent stained oil body structures were observed in the tuber cells of the RNAi gene interference lines (138-1 and 111-3), appearing as bright punctate or globular structures (red dashed line box). The oil bodies in the 138-1 line were relatively dispersed but abundant in quantity, while in the 111-3 line, not only were the oil bodies increased in quantity, but also larger oil body aggregates appeared in some areas, which was highly consistent with the highest fatty acid content (149.5 μg / 100 mg) in the 111-3 line in the fatty acid detection results. These results directly proved that inhibiting the expression of the triglyceride lipase SDP1 could effectively reduce the hydrolysis of stored lipids and promote the stable accumulation of oil bodies.
[0071] Example 3 Glucose content analysis
[0072] (1) Sample pretreatment: Take fresh tuber pieces (9 cm x 5 cm x 3 cm) cut for flavor compound determination, 3 pieces per tuber, quickly cut into 1 cm3or so small pieces, mix well, freeze-dry under liquid nitrogen, and store in a -80℃ refrigerator. When the sample is detected, mix well before the material is dissolved. Take 400 mg of sample and transfer it into a 10 mL centrifuge tube. Add 100 μL of ribitol aqueous solution (2 mg·mL-1) as a polar internal standard. Add 1.36 mL of methanol and vortex for 1 min. Ultrasonic in ice water for 2 min, hand shake for 1 min, cycle 10 times. Centrifuge at 12 000 r / min for 10 min at 4℃. Take 250 μL of supernatant and dry it under nitrogen. After adding 50 μL of MOX pyridine solution (20 mg·mL-1), rotate and oscillate for 30 s, incubate at 50℃ for 4 h. After adding 40 μL of BSTFA, fill with nitrogen. After rotating and oscillating for 30 s, derivatize at 50℃ for 60 min.
[0073] (2) Glucose determination: GCMS metabolite analysis: The chromatographic column was HP-5 ms (30 m x 0.25 mm x 0.25 μm) capillary column, the carrier gas was helium, the injection amount was 1 μL, the split flow was 10 mL·min-1, the split ratio was 20:1, and the septum purge was 3 mL·min-1. The injection port temperature was 280℃, the column flow was 2 mL·min-1. The initial temperature was 80℃ for 2 min, then increased to 310℃ at 10℃·min-1, and maintained for 6 min. The mass spectrometry conditions were: electron impact ion source (EI), electron energy 70 eV. The transfer line temperature was 250℃, the ion source temperature was 230℃, and the quadrupole rod temperature was 150℃. The scan range (m / z) was 50-600, followed by running at 70℃ for 6 min, and the solvent delay was 3 min. The quantification was performed by area normalization method.
[0074] As Figure 5 shown, the representative glucose D-glucose content decreased by 38%, the competitive inhibition effect of free amino acids was weakened, the activities of lipoxygenase (LOX) and hydroperoxide lyase (HPL) were significantly increased, and a large amount of polyunsaturated fatty acids such as linoleic acid were released due to the continuous action of dehydrogenase.
[0075] Example 4: Flavor compound detection and cooking quality evaluation
[0076] (1) Boiling water cooking test: Select the tuber of large potato, wash, dry, peel, and use a stainless steel puncher with a diameter of 1 cm to form a cylinder, then cut it into small pieces with a thickness of about 1 cm. Use kitchen paper to absorb the surface moisture. Take 3 g of the cut pieces and quickly put them into a 20 ml headspace bottle, wrap the bottle opening with tin paper, label it, and put it into a steamer. After steaming for 20 min, quickly crush the mud.
[0077] (2) Air frying test: Select the tuber of large potato, wash, dry, peel, and use a stainless steel puncher with a diameter of 1 cm to form a cylinder, then cut it into small pieces with a thickness of about 1 cm. Use kitchen paper to absorb the surface moisture. Take 200 g and wrap it with tin paper. After preheating the air fryer to 100℃ for 10 min, put the wrapped potato chips into the air fryer and heat at 150℃ for 30 min. Cut the surface 1-1.5 mm thick sample, mix it thoroughly after cutting. Then optimize the extraction conditions.
[0078] (3) Volatile compound detection by gas chromatography-mass spectrometry:
[0079] GC-MS analysis conditions: The chromatographic column is HP-5 ms (30 m x 0.25 mm x 0.25 um) capillary column, the carrier gas is helium, the injection is not split, the flow rate is 1.2 mL·min-1. The temperature conditions are as follows: the initial temperature is 40℃, maintained for 3 min, increased to 200℃ at a rate of 5℃·min-1, then increased to 230℃ at a rate of 10℃·min-1, maintained for 5 min. The mass spectrometry conditions are as follows: electron impact ion source (EI), electron energy 70 eV, transmission line temperature 280℃, ion source temperature 230℃, quadrupole temperature 150℃, mass scan range (mz) 33-550, solvent delay 1 min.
[0080] Compound identification: Peak alignment and correction were performed using Agilent ChemStation software and XCMS, respectively. The potential peaks identified by metGC and ChemStation were subjected to NIST14 comparison. The peaks with both positive and negative matches greater than 800 were filtered and selected using the retention index method (RI). The selected results were combined with manual spectrum interpretation and standard mass spectrum comparison for compound identification. The peak area response value was used as the measurement in the experiment, and some results were normalized. Color changes were recorded by taking photos.
[0081] Experimental results:
[0082] Figure 6 The TBA value is related to the content of lipid oxidation products. The higher the value, the higher the content of lipid oxidation products, which interferes StSDP1 The peak value of the RNAi sample was 20 minutes (25 μmol / g), and the TBA value remained high at 30 minutes, indicating that the substrate for lipid oxidation in the transgenic material was more abundant. In contrast, the wild type sample (WT) maintained the lowest TBA value throughout the process, with a peak value of only 16 μmol / g. In the later stage of cooking, the TBA value decreased, which was due to the continuous oxidation and decomposition of fat as the heating time increased, thus limiting the content of fatty acids. In addition, the final product, malondialdehyde (MDA), could react with other amino-containing compounds in the cell and thus be consumed.
[0083] The results are shown in Table 2 StSDP1 The main aldehyde compounds in the cooked tubers of the interference material were analyzed, and the data analysis showed that the interference StSDP1 The gene significantly increased the overall content of aldehyde compounds in potato tubers, verifying the research hypothesis that "increasing lipid metabolism can promote the increase of volatile compound content". Specifically, the content of most aldehyde compounds in the interference material was significantly higher than that in the wild type. The most significant change occurred in E,E-2,4-Nonadienal, which was 32.5 times higher in the interference material (4218.56 μg / kg) than in the wild type.
[0084] It is worth noting that the production pattern of aldehyde compounds showed obvious specificity in the interference. Polyunsaturated aldehydes can produce unique oil aroma, so the changes in these aldehyde compounds will have a unique impact on the aroma formation of transgenic potatoes. The results verified the influence of fatty acid content on the production of aroma substances, StSDP1 Gene interference inhibited the degradation of fatty acids, leading to an increase in the accumulation of fatty acids, which provided more substrates for oxidation.
[0085] Table 2StSDP1 Main aldehyde compound content of tubers after interference material maturation
[0086] Compound (μg / kg) WT _RNAi (E,E)-2,4-Heptadienal 721.66±26.87c 2571.06±255.13a E Z-2 6-Nonadie nal 308.62±17.27b 496.39±30.93a E E-2 4-Decadienal 16969.36±1353.90c 55052.16±3665.84a E E-2 4-Nonadienal 129.60±9.55c 4218.56±51.98a Dodecanal 106.84±4.27b 155.13±10.21a Octanal 837.90±50.41c 1350.36±75.63b Benzeneacetaldehyde 1153.17±128.50b 1351.63±30.52b Nonanal 967.44±30.26c 1954.09±101.84b Heptanal 3603.19±379.63b 5378.37±72.69a Hexanal 9686.16±340.34c 30613.04±1483.96a Pentanal 68.00±3.69c 115.26±6.08b Decanal 107.63±5.11c 149.82±5.55b E-2-Nonenal 169.55±11.14c 284.77±26.87b E-2-Dodecenal 65.34±3.00c 82.11±1.72b E-2-Octenal 6.91±0.90b 8.04±1.27b E-2-Decenal 0.00±0.00b 7.85±1.20a E-2-Hexenal 2.59±0.32c 5.58±0.15b E-2-Heptenal 39.16±6.37c 94.59±4.10b 2-Dodecenal 15.75±0.61b 20.55±0.76a 2-Undecenal 23.06±1.51c 262.83±16.80b
[0087] In summary, by reducing the expression level of StSDP1 in potato through RNA interference technology, the content of linoleic acid in tubers is increased by 3-4 times, the content of glucose is reduced by 38%, and the content of lipid oxidation polyunsaturated aldehyde in tubers under boiling water cooking is increased, and the aroma is obviously increased; under air frying, the color is lighter, the outer appearance is golden yellow, and the appearance quality is significantly improved. Figure 7 ).
[0088] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited by the above examples, various modifications and changes can be made to the details according to all the teachings disclosed, any change, modification, replacement, combination, simplification made without departing from the spirit and principles of the present application should be equivalent replacement mode, all included in the protection scope of the present application.
Claims
1. Use of silencing StSDP1 gene by genetic engineering techniques for breeding potato with increased linoleic acid content and decreased glucose content, characterized in that, The StSDP1 gene sequence is shown as SEQ ID NO:
1.
2. Use according to claim 1, characterized in that, The genetic engineering technology includes a gene editing technology or an RNA interference technology.
3. A method for breeding a potato having an increased linoleic acid content and a decreased glucose content, characterized in that, A vector silencing the StSDP1 gene is constructed by a genetic engineering technology, introduced into potato recipient plant cells, and genetic transformation is performed to obtain regenerated plants, whether the StSDP1 gene of the regenerated plants is successfully silenced is detected, and plants with successful silencing are screened.
4. The method of claim 3, wherein, The genetic engineering technology includes a gene editing technology or an RNA interference technology.
5. The method of claim 4, wherein, The RNA interference technology includes the following steps: (1) Total RNA of potato is extracted, and a first strand of cDNA is obtained by reverse transcription; (2) The cDNA obtained in step (1) is used as a template to perform PCR amplification; (3) The PCR product in (2) is used as a template to perform PCR amplification, and the positive and negative templates of the amplified dsRNA sequence are obtained; (4) The product is recovered, the StSDP1-RNAi interference vector is constructed, and genetic transformation is performed in potato.
6. The method of claim 5, wherein, The dsRNA sequence is a sequence shown as SEQ ID NO. 2.