Nucleic acid multiple detection method and kit

Abstract

The invention discloses a nucleic acid multiple detection method and a kit, and relates to the technical field of nucleic acid analysis or gene detection. According to the detection method provided by the invention, a reaction system is greatly simplified, high-resolution accurate detection of a DNA template and / or an RNA template can be met, the method has universality, and the number of targets or pathogens which can be detected in the same reaction is expanded to a great extent by using a melting curve, so that the method has a good application prospect.

Description

Technical Field

[0001] This invention relates to the field of nucleic acid analysis or gene detection technology, and more specifically, to a method and kit for multiplex nucleic acid detection. Background Technology

[0002] Multiplex nucleic acid detection has become a core requirement for infectious disease diagnosis, tumor companion diagnostics, and food safety monitoring. Existing technologies mainly include real-time PCR with fluorescent probes, digital PCR, chip-based microarrays, and high-throughput sequencing. However, limited by the number of optical channels, probe synthesis costs, and instrument throughput, the conventional TaqMan probe method struggles to achieve more than five-fold detection in a single reaction. While microarrays and sequencing can achieve high multiplexes, they involve complex pretreatment, long cycles, and high costs, hindering their widespread adoption in clinical settings. Therefore, achieving simultaneous detection of >10 targets on a conventional fluorescent PCR platform using single-tube, closed-tube methods, while maintaining high sensitivity, specificity, and quantification, has become a critical technical bottleneck that the industry urgently needs to address.

[0003] To overcome the channel number limitation, researchers have attempted to add a dimension through melting curve analysis, distinguishing different amplicon melting temperatures (Tm) within the same fluorescent channel. Representative approaches include using saturated dyes (SYTO-9, EvaGreen) to monitor double-stranded DNA melting behavior; or labeling the 5' end of the probe with the same fluorescent group, utilizing probe length, GC content, and secondary structure differences to generate different Tm values. However, these methods still have significant drawbacks in high-polygon scenarios: ① overlapping melting peaks lead to misinterpretation; ② dye methods lack sequence specificity, and non-specific amplification easily forms false peaks; ③ probe methods require the design and synthesis of high-cost fluorescent probes for each target, and when the number of targets is >8 polygons, probe interactions significantly increase background signal, and Tm drift between different batches of probes is difficult to control. Therefore, a melting curve analysis strategy that can accurately distinguish >10 polygons without increasing the number of probes is urgently needed.

[0004] Existing technologies share the following common problems:

[0005] (1) Fluorescence channel resources are limited and cannot meet the requirements for >10-fold detection by simple superposition;

[0006] (2) Insufficient resolution of melting curves, peak overlap and Tm drift lead to false negatives / false positives;

[0007] (3) The amount of probe used increases linearly with the number of targets, resulting in a sharp increase in cost and complexity;

[0008] (4) Universal probes or tag sequences are prone to introducing non-specific amplification, affecting sensitivity and specificity.

[0009] Therefore, there is an urgent need in this field for a multiplex nucleic acid detection technology to achieve closed-tube, rapid, low-cost, and highly sensitive multi-target detection on conventional fluorescence PCR instruments, thereby addressing the pain points of clinical and field testing.

[0010] Patent CN107532213B discloses a multiplex nucleic acid detection method. Its principle involves a two-step PCR reaction. In the second PCR step, a tag sequence matching the probe is added to the primers, and the melting curve is used to distinguish multiple targets in the same fluorescence channel. According to this technology, up to 30 targets can be detected in the same reaction system. However, this patent has the following drawbacks:

[0011] The operation is complex, requiring four steps: A. PCR reaction; B. product ligation; C. PCR again; and D. melting curve analysis. The process involves multiple transfers of the reaction system and the use of multiple different enzymes, which is extremely inconvenient.

[0012] In view of this, the present invention is proposed. Summary of the Invention

[0013] The purpose of this invention is to provide a method and kit for multiplex nucleic acid detection to solve the above-mentioned technical problems.

[0014] This invention is implemented as follows:

[0015] In a first aspect, the present invention provides a nucleic acid multiplex detection method, which is not intended for disease diagnosis, and the detection method includes the following steps:

[0016] The test sample containing the target DNA template and / or target RNA template is blended with a first forward primer combination, a first reverse primer combination, a second forward primer combination, a second reverse primer combination, a probe combination, and a primer combination with a fluorescent excitation group, and reacted; multiple amplicons in the reaction product are detected in the reaction vessel, and the amplicones are detected by melting curve analysis;

[0017] The template binding regions of the second forward primer combination and the second reverse primer combination are located inside the template binding regions of the first forward primer combination and the first reverse primer combination;

[0018] The first forward primer combination includes multiple first forward primers, the first reverse primer combination includes multiple first reverse primers, the second forward primer combination includes multiple second forward primers, the second reverse primer combination includes multiple second reverse primers, and the probe combination includes multiple probes. The multiple first forward primers, multiple first reverse primers, multiple second forward primers, multiple second reverse primers, and multiple probes correspond to the detection of different target nucleic acids, and the multiple first forward primers and multiple second forward primers are complementary to the corresponding target DNA template and / or target RNA template.

[0019] Each second reverse primer includes, along the 5'-3' direction: a primer binding region, a tag sequence region, and a template binding region; the primer binding region is the same as that of the primer with a fluorescent excitation group; and the primer binding region does not have a fluorescent excitation group; the primer with a fluorescent excitation group does not specifically bind to the target DNA template and / or target RNA template; different target DNA templates and / or target RNA templates correspond to different tag sequences;

[0020] The tag sequence region is an artificial sequence, and the tag sequence region is completely complementary to the probe sequence or contains some mismatched nucleotides. The 3' end of the probe has a fluorescent reporter group, and the absorption spectrum of the fluorescent reporter group overlaps with the emission spectrum of the fluorescent excitation group.

[0021] The reaction provides multiple amplicones internally labeled with fluorescent reporter groups;

[0022] The sequence of the first forward primer used to detect the same target DNA template and / or target RNA template is different from the nucleotide sequence of the corresponding second forward primer or has at least 2 nucleotides of homology; the nucleotide sequence of the first reverse primer used to detect the same target DNA template and / or target RNA template is different from the nucleotide sequence of the template binding region of the corresponding second reverse primer or has at least 2 nucleotides of overlap.

[0023] Secondly, the present invention also provides a kit for performing the above-mentioned multiplex nucleic acid detection method. The kit includes: a first forward primer combination, a first reverse primer combination, a second forward primer combination, a second reverse primer combination, a probe combination, a primer combination with a fluorescent excitation group, and a nucleic acid polymerase.

[0024] The present invention has the following beneficial effects:

[0025] This invention provides a nucleic acid multiplex detection method that eliminates the need for a ligation reaction. By setting a first forward primer combination, a first reverse primer combination, a second forward primer combination, a second reverse primer combination, a probe combination, and a primer combination with a fluorescent excitation group, a PCR reaction can be directly performed without a two-step PCR reaction or the need for transfer of the reaction system during the process. This invention eliminates the first tag sequence, significantly simplifying the reaction system. During detection, the tag sequence in the amplification product is complementary to the probe sequence. The fluorescent reporter group and the fluorescent excitation group on the probe sequence are physically close. Due to the overlap between the absorption spectrum of the fluorescent reporter group and the emission spectrum of the fluorescent excitation group, a fluorescence resonance energy transfer phenomenon occurs. This phenomenon can be observed and recorded by using the fluorescent excitation group as the incident light and recording the emission light of the reporter group. As the temperature increases, the probe gradually dissociates from the DNA strand, and the signal decreases. A melting curve is formed by recording the fluorescence signal. Near the melting temperature, the fluorescence signal drops sharply. The point with the largest temperature change rate is obtained through signal analysis, which is the melting temperature (Tm). In this process, the melting temperature of the probe is obtained by recording the fluorescence signal and forming a melting curve. Different detection targets use different tag sequences and corresponding probes, resulting in different melting temperatures. Finally, by analyzing the melting temperatures, the target being detected in the reaction system can be identified, thus distinguishing whether the sample contains the target gene or target nucleic acid.

[0026] According to the method provided by this invention, primer-probe combinations targeting any target DNA template and / or target RNA template can be designed, and this method is universal.

[0027] Compared with the scheme of patent CN107532213B, the primer design and operation provided by the present invention are greatly simplified, reducing the original two-step PCR reaction plus one-step ligation reaction to one-round PCR reaction. The reaction can be completed in a single system, avoiding the two-round PCR reaction required in the scheme of patent CN107532213B, and avoiding the possible contamination caused by the transfer of the product in the first round of reaction.

[0028] Compared to other methods that use fluorescent groups to distinguish different targets for multiplex detection, this invention significantly expands the number of targets or pathogens that can be detected in the same reaction by using melting curves. For example, in a commonly used 4-channel fluorescence PCR instrument, using fluorescent groups to distinguish different targets, each channel can only detect one target, so the four channels can detect a maximum of four different targets. Using the method of this invention, each channel can distinguish more than four different targets through different temperatures, potentially seven or even more targets. Therefore, four channels can simultaneously detect more than 30 different targets.

[0029] Compared to existing methods that use TaqMan probes to generate melting curves, the method of this invention uses artificially designed probes that are independent of the target sequence, resulting in better specificity. Furthermore, by utilizing the principle of fluorescence resonance energy transfer, the generated melting curves are clearer, have more stable Tm values, and better resolution. This allows for the inclusion of more melting curve peaks in the same channel with less mutual interference, thus contributing to improved identification accuracy. Attached Figure Description

[0030] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0031] Figure 1 This is a schematic diagram of the primer design for the DNA template or double-stranded RNA template to be tested according to the present invention.

[0032] Figure 2 This is a schematic diagram of the structure of the reverse primer R2 (also known as the second reverse primer);

[0033] Figure 3 This is a schematic diagram of the structure of a primer with a fluorescent excitation group (i.e., an excitation primer);

[0034] Figure 4 This is a schematic diagram illustrating the binding of the probe to the final product;

[0035] Figure 5 Melting curves of amplification products when the excitation group is located at different positions on the excitation primer;

[0036] Figure 6 Melting curves of reverse primer amplification products using the same activation primer binding region and template binding region but with different tag sequences. Figure 1 ;

[0037] Figure 7 Melting curves of reverse primer amplification products using the same activation primer binding region and template binding region but with different tag sequences. Figure 2 ;

[0038] Figure 8 Melting curves of amplification products obtained using different primer-probe systems to target influenza B virus primer-probe sequences;

[0039] Figure 9 Melting curves for novel coronavirus, influenza A virus, influenza B virus, and respiratory syncytial virus;

[0040] Figure 10 Melting curves for adenovirus, Mycoplasma pneumoniae, influenza A virus + influenza B virus, and respiratory syncytial virus + adenovirus;

[0041] Figure 11 Melting curves for novel coronavirus + adenovirus and blank control;

[0042] Figure 12 Melting curves of reverse primer amplification products using the same activation primer binding region and template binding region but with different tag sequences. Figure 3 . Detailed Implementation

[0043] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0044] Terminology Explanation:

[0045] Body fluids are a general term referring to all fluids present within an organism (including the human body). They include intracellular fluid and extracellular fluid. Intracellular fluid is the fluid located inside cells. Extracellular fluid is the fluid located outside cells and includes interstitial fluid / tissue fluid, plasma, blood, lymph, cerebrospinal fluid, aqueous humor, serous cavity fluid, synovial fluid, and secretions.

[0046] Multiple detection: Allows multiple detection of multiple (e.g., at least 2) different target sequences, even in single-tube or dual-tube systems.

[0047] In this invention, primers with fluorescent excitation groups are synonymous with "excitation primers".

[0048] The nucleic acid multiplex detection method provided by this invention allows for greater freedom in designing second reverse primer combinations, probe combinations, and primer combinations with fluorescent excitation groups, thereby enabling the engineering modification of primer and probe combinations. The specific method is as follows:

[0049] In a first aspect, the present invention provides a nucleic acid multiplex detection method, which is not intended for disease diagnosis, and the detection method includes the following steps:

[0050] The test sample containing the target DNA template and / or target RNA template is blended with a first forward primer combination, a first reverse primer combination, a second forward primer combination, a second reverse primer combination, a probe combination, and a primer combination with a fluorescent excitation group, and reacted; multiple amplicons in the reaction product are detected in the reaction vessel, and the amplicones are detected by melting curve analysis;

[0051] The template binding regions of the second forward primer combination and the second reverse primer combination are located inside the template binding regions of the first forward primer combination and the first reverse primer combination;

[0052] The first forward primer combination includes multiple first forward primers, the first reverse primer combination includes multiple first reverse primers, the second forward primer combination includes multiple second forward primers, the second reverse primer combination includes multiple second reverse primers, and the probe combination includes multiple probes. The multiple first forward primers, multiple first reverse primers, multiple second forward primers, multiple second reverse primers, and multiple probes correspond to the detection of different target nucleic acids, and the multiple first forward primers and multiple second forward primers are complementary to the corresponding target DNA template and / or target RNA template.

[0053] Each second reverse primer includes, along the 5'-3' direction: a primer binding region, a tag sequence region, and a template binding region; the primer binding region is the same as that of the primer with a fluorescent excitation group; and the primer binding region does not have a fluorescent excitation group; the primer with a fluorescent excitation group does not specifically bind to the target DNA template and / or target RNA template; different target DNA templates and / or target RNA templates correspond to different tag sequences;

[0054] The tag sequence region is an artificial sequence, and the tag sequence region is completely complementary to the probe sequence or contains some mismatched nucleotides. The 3' end of the probe has a fluorescent reporter group, and the absorption spectrum of the fluorescent reporter group overlaps with the emission spectrum of the fluorescent excitation group.

[0055] The reaction provides multiple amplicones internally labeled with fluorescent reporter groups;

[0056] The sequence of the first forward primer used to detect the same target DNA template and / or target RNA template is different from the nucleotide sequence of the corresponding second forward primer or has at least 2 homologous sequences; the nucleotide sequence of the first reverse primer used to detect the same target DNA template and / or target RNA template is different from the nucleotide sequence of the template binding region of the corresponding second reverse primer or has at least 2 overlapping nucleotides (i.e., has at least 2 identical nucleotides).

[0057] The template binding region binds to the target region that needs to be detected or amplified. In the PCR reaction system, the target region that needs to be detected can be used as a template for extension.

[0058] The sequence of the first forward primer used to detect the same target DNA template and / or target RNA template may not overlap with the nucleotide sequence of the corresponding second forward primer, or there may be partial overlap of bases, or they may even completely overlap and become one.

[0059] The nucleotide sequence of the first reverse primer used to detect the same target DNA template and / or target RNA template may not overlap with the nucleotide sequence of the template binding region of the corresponding second reverse primer, or there may be partial overlap of bases, or they may be completely identical.

[0060] A schematic diagram of the primer design of this invention is shown below. Figure 1 As shown, Figure 1 In the sequence, 1 is the amplification template, 2 is the forward primer F1 (i.e., the first forward primer), 3 is the forward primer F2 (i.e., the second forward primer), 4 is the reverse primer R1 (i.e., the first reverse primer), and 5 is the reverse primer R2 (i.e., the second reverse primer). The arrow end in each primer sequence represents the 3' end, and the end without an arrow represents the 5' end.

[0061] Refer to the schematic diagram of the structure of reverse primer R2 (i.e., the second reverse primer). Figure 2 As shown, from the 5' end to the 3' end are the (excitation) primer binding regions ( Figure 2 (as shown in number 3), tag sequence area ( Figure 2 (as shown by number 2 in the image) and template binding area ( Figure 2 (as shown by number 1 in the image).

[0062] A schematic diagram of the structure of a primer with a fluorescent excitation group (i.e., an excitation primer) is shown below. Figure 3 As shown, it has a fluorescent group at the 3' end. Figure 3 The number 1 indicates the excitation primer sequence, and the number 2 indicates the fluorescent excitation group.

[0063] If the template is an RNA template, the first forward primer or the first reverse primer acts as a reverse transcription primer, which reverse transcribes the RNA into DNA under the action of reverse transcriptase.

[0064] If the template is a DNA template, or after reverse transcription of the RNA template is completed, the target region of the template is amplified and enriched under the action of the first forward primer F1 and the first reverse primer.

[0065] Under the action of the second forward primer and the second reverse primer, the template or the product formed by the first forward primer and the first reverse primer is directly amplified to obtain a product with the sequence of the second reverse primer, that is, a tag sequence and a primer binding region are added to the product.

[0066] Subsequently, under the action of the second forward primer and the primer with a fluorescent excitation group (i.e., the excitation primer), a DNA strand with a tag sequence is amplified by extending the primer with the fluorescent excitation group.

[0067] These two stages occur sequentially in the early stages of the PCR reaction. In the middle and later stages, after a certain amount of product with the tagged sequence has been produced, the two stages occur simultaneously. By controlling the concentration of each primer and following the PCR reaction procedure, a large number of DNA strands with the tagged sequence, extended from the excitation primers, are ultimately generated.

[0068] After the PCR reaction, a melting curve program is initiated. The product is first heated to above 90°C to fully denature it, then cooled to 50°C or below to allow the probe to fully bind to the product DNA strand carrying the tagged sequence. Subsequently, the temperature is slowly increased, and the probe gradually dissociates from the product DNA strand carrying the tagged sequence. During probe-DNA binding, the reporter group on the probe and the excitation group introduced onto the DNA strand via the excitation primer come into physical proximity, resulting in fluorescence resonance energy transfer (FRET). This phenomenon can be observed and recorded by using a light source that excites the fluorescent excitation group on the excitation primer as the incident light and recording the emission light from the reporter group. As the temperature increases, the probe gradually dissociates from the DNA strand, and the signal decreases. Recording the fluorescence signal forms a melting curve. Near the melting temperature, the fluorescence signal drops sharply. The point with the largest rate of temperature change is identified through signal analysis; this is the melting temperature (Tm).

[0069] In this process, fluorescence signals are recorded to form a melting curve, thus obtaining the melting temperature of the probe. Different detection targets or pathogens use different tag sequences and corresponding probes, resulting in different melting temperatures. Finally, by analyzing the melting temperatures, the specific target or pathogen being detected in the reaction system can be identified.

[0070] A schematic diagram of the probe binding to the final product is shown below. Figure 4 As shown, Figure 4 In the sequence shown, the arrows represent the 3' end, and the ends without arrows represent the 5' end. Figure 4 In this diagram, number 1 represents the probe sequence, number 2 is the fluorescent reporter group at the 3' end of the probe, number 3 is the template sequence portion of the amplification product, number 4 is the tag sequence portion of the amplification product, number 5 is the fluorescent group on the amplification product (from the excitation primer), and number 6 is the excitation primer on the amplification product.

[0071] In a preferred embodiment of the invention, in the primer combination with a fluorescent excitation group, the fluorescent excitation group of each primer is located at the 3' end of the primer. In one embodiment, the fluorescent excitation group is modified on a T base.

[0072] The fluorescent exciter group is located at the 3' end of the primer, facilitating physical proximity (to the fluorescent reporter group of the probe, which is complementary to the tag sequence) to induce fluorescence resonance energy transfer. The probe sequence can match the tag sequence to form a characteristic melting curve, generating a specific melting temperature (Tm).

[0073] In a preferred embodiment of the present invention, the fluorescent excitation group of the primer with the fluorescent excitation group is located at any nucleotide position from the 1st to the 10th nucleotide starting from the 3' end of the primer.

[0074] In a preferred embodiment of the present invention, the fluorescent excitation group of the primer with the fluorescent excitation group is located at any nucleotide position from the 3rd to the 5th nucleotide starting from the 3' end of the primer.

[0075] In primers containing fluorescent excitatory groups, if the excitatory group and the reporter group in the probe are too close together, it may have adverse effects; if they are too far apart, the fluorescence resonance energy transfer will be weakened. Modifying the fluorescent excitatory group at the above-mentioned positions results in primers with fluorescent excitatory groups exhibiting higher fluorescence signals.

[0076] In a preferred embodiment of the present invention, the primers with fluorescent excitation groups are artificial sequences or derived from unrelated species.

[0077] The fluorescent excitation group on the primer with the fluorescent excitation group is a fluorescent gene that absorbs and emits a relatively short wavelength in the fluorescence spectrum, while the fluorescent reporter group on the probe is a fluorescent gene that absorbs and emits a relatively long wavelength in the fluorescence spectrum.

[0078] The aforementioned "fluorescent groups with relatively short absorption and emission wavelengths in the fluorescence spectrum" are relative to the fluorescent reporter group on the probe. The "fluorescent excitation group" on the primer with the fluorescent excitation group acts as the donor, and the fluorescent reporter group on the probe acts as the acceptor. When the excitation group on the primer with the fluorescent excitation group and the reporter group on the probe sequence are close to each other, fluorescence resonance energy transfer (FRET) occurs. Specifically, light of a specific wavelength (usually laser or monochromatic light) irradiates the sample, exciting the donor fluorescent molecule. Utilizing the dipole-dipole interaction between the donor and acceptor, the energy from the excited donor is directly transferred to the acceptor, causing the acceptor to emit emission light characteristic of the reporter group, while the donor itself does not emit fluorescence. When the two move away from each other, the fluorescence resonance energy transfer phenomenon disappears, and the characteristic emission signal of the reporter group disappears or weakens.

[0079] The absorption wavelength of the fluorescent exciter group is relatively shorter than that of the fluorescent reporter group, and the emission wavelength of the fluorescent exciter group is relatively shorter than that of the fluorescent reporter group.

[0080] In one embodiment, a fluorescent group with relatively short absorption and emission wavelengths in the fluorescence spectrum can also be defined as a fluorescent group with "excitation wavelength <500nm and emission wavelength <550nm".

[0081] In a preferred embodiment of the present invention, the fluorescent excitation group includes, but is not limited to, ATTO 425, ATTO 488, ATTO 532, Alexa Fluor 405, Alexa Fluor 488, Alexa Fluor 532, or 6-FAM; the fluorescent reporter group includes, but is not limited to, ROX, Cy5, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, Texas Red, Cy5.5, or Quasar670;

[0082] In a preferred embodiment of the present invention, primers with fluorescent excitation groups are as shown in SEQ ID NO: 1 (ACCTGAAGACGGAACATCATCG) or SEQ ID NO: 26 (ACGACGAGGACCTGCATTATC). These sequences were designed from the genomes of the model plant Arabidopsis thaliana and the M13 bacteriophage genome. Through theoretical screening and experimental verification, primer sequences with high amplification efficiency and good specificity were selected as potential primers with fluorescent excitation groups. In other embodiments, the invention is not limited to these sequences; primers can be designed from the genomes of any two species, and through theoretical screening and experimental verification, primer sequences with high amplification efficiency and good specificity can be selected as potential primers with fluorescent excitation groups.

[0083] Primers with fluorescent excitation groups play a key role in the present invention. The excitation primers have excitation groups, and a large number of primer chains with fluorescent excitation groups need to be generated to bind to the probe. Therefore, primers with fluorescent excitation groups need to have high amplification efficiency, good specificity, and not produce non-specific reactions with the target.

[0084] The probe is fundamental to generating melting curves and is one of the key components of this invention. According to the concept of this invention, the probes used in this scheme are independent of the amplified target sequence and can be genomic sequences from other species not related to the target, or artificially designed fragments. More preferably, this embodiment obtains a series of probe sequences with specific melting temperatures (Tm) through artificial design and screening. For different nucleic acid sequences, a theoretical melting temperature (Tm) can be calculated, but different algorithms and tools will yield different theoretical melting temperatures (Tm). Melting temperature is related not only to the sequence itself but also to the reaction system, such as salt ion concentration, dNTP concentration, nucleic acid concentration, organic solvent, etc., and the temperature control module of each fluorescence PCR instrument is not entirely consistent. Therefore, the theoretical melting temperature (Tm) and the actual measured melting temperature (Tm) of the probe sequences screened in this invention only represent those obtained under the prediction tools or experimental conditions in this embodiment, and should be used as a reference for probe selection, not as a limitation of the method or the application of the sequence. In the application of probes, situations where they are similar to the template or form higher-order structures that affect the results should be avoided.

[0085] In a preferred embodiment of the present invention, the fluorescent reporter group of the probe sequence is located at any one of the nucleotide positions from the 1st to the 10th nucleotide starting from the 3' end of the probe.

[0086] In a preferred embodiment of the present invention, the fluorescent reporter group of the probe sequence is located at any one of the nucleotide positions from the 1st to the 5th nucleotide starting from the 3' end of the probe.

[0087] In a preferred embodiment of the present invention, the sequence of the first forward primer used to detect the same target DNA template and / or target RNA template is identical to the nucleotide sequence of the corresponding second forward primer.

[0088] In a preferred embodiment of the present invention, in the system for detecting the same target DNA template and / or target RNA template, the final concentrations of the first forward primer, the second forward primer, the first reverse primer, the second reverse primer, the probe, and the primer with a fluorescent excitation group are 0-0.8 μM, 0-0.8 μM, 0-0.8 μM, 0-0.4 μM, 0.1-2 μM, and 0.1-2 μM, respectively; and the final concentrations of the first forward primer and the second forward primer are not both 0.

[0089] The first and second forward primers function similarly and can coexist or be combined; the first reverse primer has a significant promoting effect on the reaction system. In one embodiment, when the sequence of the first forward primer used to detect the same target DNA template and / or target RNA template is the same as the nucleotide sequence of the corresponding second forward primer, it has a higher signal peak.

[0090] For detection to occur, signal generation requires a template complementary to the probe. Therefore, optimizing reaction conditions necessitates generating as many template strands as possible that are complementary to the probe. This is achieved by adjusting the proportions of different primers.

[0091] In a preferred embodiment of the present invention, the probe combination comprises a nucleotide sequence selected from at least one of the sequences shown in SEQ ID NO: 2-25. This probe combination is a probe combination obtained through screening according to the present invention, but is not limited thereto.

[0092] In a preferred embodiment of the present invention, the sample to be tested is a human or animal respiratory sample, a human or animal cerebrospinal fluid sample, a human or animal reproductive tract sample, a human or animal body fluid, a human or animal feces, a dairy product, or an environmental sample. The detection method provided by the present invention can be used for the detection of pathogens such as bacteria, viruses, fungi, and mycoplasma.

[0093] In a preferred embodiment of the present invention, the nucleotide sequences of the tag sequence regions of any two second reverse primers in the second reverse primer combination are different, and the nucleotide sequences of the tag sequence regions are not completely complementary to the amplification regions of the target DNA template and / or target RNA template. This avoids the occurrence of nonspecific signals.

[0094] Secondly, the present invention also provides a kit for performing the above-mentioned multiplex nucleic acid detection method. The kit includes: a first forward primer combination, a first reverse primer combination, a second forward primer combination, a second reverse primer combination, a probe combination, a primer combination with a fluorescent excitation group, and a nucleic acid polymerase.

[0095] Nucleic acid polymerases, such as DNA polymerases, include but are not limited to Taq polymerase, Tth polymerase, Pfu polymerase, or mixtures of multiple enzymes.

[0096] In a preferred embodiment of the present invention, the multiple probes in the probe array have different melting temperatures; this arrangement facilitates multiplex detection of more target genes or nucleic acids in a single channel for different target genes or nucleic acids.

[0097] In a preferred embodiment of the present invention, the melting temperatures of the multiple probes in the probe assembly differ by at least 3 degrees Celsius.

[0098] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0099] Example 1

[0100] This embodiment provides a method for designing and screening primers with fluorescent excitation groups (i.e., excitation primers).

[0101] The excitation primer plays a key role in the present invention. The excitation primer has an excitation group and a large number of chains with excitation primers need to be generated to bind to the probe. Therefore, the excitation primer needs to have high amplification efficiency, good specificity, and not produce non-specific reactions with the target.

[0102] Primer sequences can come from other unrelated species or can be artificially designed sequences.

[0103] Taking the screening of pathogen detection schemes as an example, in this embodiment, primers were designed from the genome of the model plant Arabidopsis thaliana and the genome of M13 bacteriophage, respectively. Through theoretical screening and experimental verification, primer sequences with high amplification efficiency and good specificity were selected as potential excitation primer sequences.

[0104] Primer name Sequence (5'-3') source M13-GR-F1 TGGTCAGTTCGGTTCCCTTATG M13 bacteriophage genome M13-GR-R1 TTTGACCCCCAGCGATTATACC M13 bacteriophage genome M13-GR-F5 GCAAGGCCGATAGTTTGAGTTC M13 bacteriophage genome M13-GR-R5 AACAGGAGGCCGATTAAAGGG M13 bacteriophage genome A.th-ole-F7 ACCTGAAGACGGAACATCATCG (SEQ ID NO: 1) Oleosin gene of Arabidopsis thaliana A.th-ole-R7 TCTCTTTCTCCAGAGCCAAACC Oleosin gene of Arabidopsis thaliana A.th-ole-F8 ACGACGAGGACCTGCATTATC (SEQ ID NO: 26) Oleosin gene of Arabidopsis thaliana A.th-ole-R8 ACGGCCCACATATCCACTATTG Oleosin gene of Arabidopsis thaliana

[0105] For the above four primer pairs, PCR reactions were performed using the SYBR dye method with M13 phage DNA and Arabidopsis thaliana genomic DNA as templates, according to the following system and procedure. After the PCR reaction, melting curve analysis was performed to determine nonspecificity.

[0106] Reaction system:

[0107]

[0108]

[0109] Reaction procedure:

[0110]

[0111] The experimental results are as follows:

[0112] primer pairs template Ct value Non-specific cases M13-GR-F1 / M13-GR-R1 M13 bacteriophage genomic DNA 32.5±0.5 Nothing special M13-GR-F5 / M13-GR-R5 M13 bacteriophage genomic DNA 33.6±0.8 Mild nonspecific A.th-ole-F7 / A.th-ole-R7 Arabidopsis thaliana genomic DNA 30.2±0.3 Nothing special A.th-ole-F8 / A.th-ole-R8 Arabidopsis thaliana genomic DNA 29.6±0.2 Nothing special

[0113] Based on the above experimental results, the combination of A.th-ole-F7 / A.th-ole-R7 and A.th-ole-F8 / A.th-ole-R8 is superior to M13-GR-F1 / M13-GR-R1 and M13-GR-F5 / M13-GR-R5.

[0114] Furthermore, to further screen primers with better amplification efficiency, this embodiment uses asymmetric PCR to conduct comparative tests with different upstream and downstream primer ratios.

[0115] The system for asymmetric PCR is as follows:

[0116]

[0117]

[0118] The reaction procedure is as follows: (consistent with the procedure described above)

[0119]

[0120] The results are as follows:

[0121]

[0122] The results showed that primers A.th-ole-F7 and A.th-ole-F8 had good amplification efficiency and could both be used as excitation primers.

[0123] Example 2

[0124] This embodiment screens for fluorescent excitation groups in primers (i.e., excitation primers) that contain fluorescent excitation groups.

[0125] When the fluorescent exciter group in the excitation primer and the reporter group in the probe are physically close, fluorescence resonance energy transfer occurs. Therefore, the positions of these two groups are crucial. From the perspective of facilitating synthesis, the reporter group of the probe is usually located at the 3' end, and modification of the 3' end with a fluorescent group further improves the stability of the probe.

[0126] Since the 3' end of the excitation primer needs to be extended, the excitation group should not be on the last base at the 3' end. In addition, due to the steric hindrance effect, if the excitation group in the excitation primer and the reporter group in the probe are too close, it may have an adverse effect, while if they are too far apart, the fluorescence resonance energy transfer will be weakened.

[0127] In this embodiment, an example is used to explore the influence of the position of the excitation group in the excitation primer on the experimental results.

[0128] According to the present invention, the excitation group of the excitation primer is a fluorescent gene that absorbs and emits a relatively short wavelength in the fluorescence spectrum, such as ATTO425, 6-FAM, etc.; the reporter group on the probe sequence is a fluorescent gene that absorbs and emits a relatively long wavelength in the fluorescence spectrum, such as ROX, Cy5, etc.; in this embodiment, the excitation group is 6-FAM and the reporter group is ROX.

[0129] In this embodiment, primers are used to simulate the product expected to be obtained in this scheme. The reverse primer R2 is also used as a template. The primer design is slightly different from the target application. The primer design is as follows:

[0130] Probe sequence:

[0131] Pb-30009-ROX:CGAGATGGTCAACAGCGAGACGTGTGATGGCGAGCTA-ROX (3' ​​end ROX modification).

[0132] Forward primer:

[0133] Rtail:TGGTTCGGTGGGAAAGAATTTG.

[0134] Reverse primer (which also serves as the template itself):

[0135] infB-gb-R2:

[0136] ACGACGAGGACCTGCATTATC TAGCTCGCCATCACACGTCTCGCTGTTGACCATCTCG CAAATTCTTTCCCA CCGAACCA.

[0137] The reverse primer consists of three parts: the 5' end is the excitation primer-binding region, which has the same nucleotide sequence as the excitation primer (i.e., matches); the 3' end is the template-binding region. In this embodiment, to be complementary to the forward primer, infB-gb-R2 itself can be used as a template and amplified by the forward primer Rtail and different excitation primers. The underlined part is the tag sequence; in this embodiment, the tag sequence is completely complementary to the probe.

[0138] List of excitation primers (excitation groups can only be modified on T bases):

[0139]

[0140] The amplification reaction system is as follows:

[0141]

[0142]

[0143] Amplification reaction procedure:

[0144]

[0145] Experimental results refer to Figure 5 As shown, the results indicate that the excitation group located at different positions on the excitation primer can produce the expected results of this experimental scheme. However, the excitation primers that excite the gene closer to the 3' end have higher fluorescence signals (the excitation primers of A.th-ole-F8-FAM4 and A.th-ole-F8-FAM5 have higher fluorescence signals than A.th-ole-F8-FAM9).

[0146] Example 3

[0147] This embodiment involves screening tag sequences and probe sequences.

[0148] In this invention, the probe is fundamental to generating the melting curve and is one of the key components. According to the concept of this invention, the probe used is independent of the amplified target sequence and can be a genomic sequence from another species not related to the target, or it can be an artificially designed fragment. More preferably, this embodiment obtains a series of probe sequences with specific melting temperatures (Tm) through artificial design and screening. For different nucleic acid sequences, a theoretical melting temperature (Tm) can be calculated, but different algorithms and tools will yield different theoretical melting temperatures (Tm). The melting temperature is related not only to the sequence itself but also to the reaction system, such as salt ion concentration, dNTP concentration, nucleic acid concentration, organic solvent, etc., and the temperature control module of each fluorescence PCR instrument is not entirely consistent. Therefore, the theoretical melting temperature (Tm) and the actual measured melting temperature (Tm) of the probe sequences screened in this embodiment only represent the results obtained under the prediction tools or experimental conditions in this embodiment, and should be used as a reference for probe selection, not as a limitation on the method or the application of the sequence.

[0149] The primer sequences used in this embodiment are as follows:

[0150] Forward primer (same as in Example 2): Rtail: TGGTTCGGTGGGAAAGAATTTG.

[0151] Excitation primer (same as in Example 2): A.th-ole-F8-FAM4:ACGACGAGGACCTGCATTATC.

[0152] The FAM modifier is located at position 18 (4th from 3').

[0153] The probe sequence is as follows: The theoretical Tm was calculated using the Tm Prediction tool provided by Qiagen (https: / / geneglobe.qiagen.com / us / tools / tm-prediction).

[0154]

[0155]

[0156] The reverse primers are shown in the table below. Reverse primers with the same number are used in conjunction with the same probe. The underlined part is the region that binds to the probe:

[0157]

[0158]

[0159] The reaction system is as follows (same as in Example 2):

[0160] Reverse primers and probes with the same number can be used in the same system, such as using reverse primer infB-18248-R2 and probe Pb-18248-ROX simultaneously.

[0161] Components Dosage 10x PCR Buffer 2.5μl dNTPs (2.5mM each) 0.1μl Taq DNA Polymerase 0.125μl Forward primer Rtail (10 μM) 0.2μl As shown in the table above, the reverse primer 0.05μl As shown in the table above, the probes 0.25μl Activation primers 1μl ddH2O 20.775μl Total volume 25μl

[0162] Reaction procedure (same as in Example 2):

[0163]

[0164]

[0165] Experimental results refer to Figure 6 , Figure 7 and Figure 12 As shown, sequences with better peak shapes were selected from the experimental results as candidate probes for practical applications. When using probes, it is important to avoid situations where they resemble the template or form higher-order structures that could affect the results.

[0166] Using the method described in this embodiment, the following list of usable probe sequences was obtained. Fluorescent groups can be added as needed for the channels:

[0167]

[0168]

[0169]

[0170] Example 4

[0171] This embodiment optimizes the amplification reaction and detection conditions. According to the design of this invention, signal generation requires a template complementary to the probe during detection. Therefore, optimizing the reaction conditions requires generating as many template strands as possible that are complementary to the probe. This is achieved by adjusting the ratio of different primers.

[0172] In this embodiment, primer design is performed using influenza B virus as an example, and different reaction conditions are tested using influenza B virus cDNA as a template.

[0173] The primer and probe sequences used in this embodiment are as follows:

[0174] Forward primer F1,

[0175] infB-gb-F1:GCCTACCTGCTTTCATTGACAG.

[0176] Reverse primer R1,

[0177] infB-gb-R1:TCCATTCCAAGGCAGAGTCTAG.

[0178] Forward primer F2,

[0179] infB-gb-F2:TGGAGAAGGCAAAGCAGAAC.

[0180] Reverse primer R2 (same as in Example 2).

[0181] infB-gb-R2:

[0182] ACGACGAGGACCTGCATTATCTAGCTCGCCATCACACGTCTCGCTGTTGACCATCTCGCAAATTCTTTCCCACCGAACCA.

[0183] Probe sequence (same as in Example 2):

[0184] Pb-30009-ROX:CGAGATGGTCAACAGCGAGACGTGTGATGGCGAGCTA-ROX (3' ​​end ROX modification).

[0185] Excitation primers (same as in Example 2):

[0186] A.th-ole-F8-FAM4:ACGACGAGGACCTGCATTATC.

[0187] The FAM modifier is located at position 18 (4th from 3').

[0188] The specific experimental groups are as follows:

[0189]

[0190] Reaction procedure (basically the same as in Example 2, only the number of cycles is different): The reaction procedure in this example is only for illustration. Adjustments to different temperatures and different numbers of cycles do not affect the scope of protection of this invention.

[0191]

[0192]

[0193] Experimental results refer to Figure 8 As shown in the results analysis, utilizing the design of this invention, the forward primers F1 and F2 have similar functions and can coexist or be combined; the reverse primer R1 has a significant promoting effect on the reaction system. Group E shows that when the forward primers F1 and F2 are the same, a higher fluorescence signal is observed.

[0194] This embodiment only demonstrates the results of the ROX fluorescence channel; applications of other fluorescence channels are within the scope of this invention.

[0195] Example 5

[0196] This embodiment provides a detection method for multiplex nucleic acid detection of respiratory-associated pathogens.

[0197] In diseases such as respiratory tract infections, central nervous system infections, sexually transmitted infections, and gastrointestinal infections, multiple pathogens can cause the same or similar symptoms. Therefore, it is crucial to utilize technological means to rapidly detect and identify pathogens and implement appropriate treatment measures. Taking respiratory tract infections as an example, pathogens that can cause respiratory infection symptoms include numerous and diverse pathogens such as viruses (e.g., influenza virus, respiratory syncytial virus, coronavirus), mycoplasma (e.g., Mycoplasma pneumoniae), chlamydia (e.g., Chlamydia pneumoniae), bacteria (e.g., pertussis, Legionella), and fungi (e.g., Aspergillus, Mucor).

[0198] According to the present invention, multiple pathogens can be detected simultaneously in the same reaction system. In this embodiment, the method of the present invention is used with six respiratory pathogens as examples to illustrate the design and application method of the present invention. The scope of protection of the present invention includes other sites and combinations of other pathogens, and the number of pathogens is not limited to six; it can be 30 or more.

[0199] Abbreviations for pathogens in this embodiment:

[0200] Novel coronavirus, SARS-CoV-2;

[0201] Influenza A virus, infA;

[0202] Influenza B virus, infB;

[0203] Respiratory syncytial virus (RSV);

[0204] Adenovirus, ADV;

[0205] Mycoplasma pneumoniae, MP.

[0206] Primer design methods:

[0207] The template binding regions of forward primer F1, forward primer F2, reverse primer R1, and reverse primer R2 are all designed based on conserved sequences on the pathogen's genome; the primer and probe sequences for influenza B virus are consistent with those in Example 4.

[0208] The probes were selected from the list obtained in Example 2 based on the difference in Tm values, and the two detection channels, ROX and Cy5, were used respectively.

[0209] The excitation primers used were the excitation primer sequences screened in Example 1;

[0210] Excitation primer:

[0211] A: th-ole-F7-FAM3:ACCTGAAGACGGAACATCATCG (the 20th position, which is the third from the end, has the base T modified with the FAM fluorescent group).

[0212] The forward primer F1 sequence is shown in the table below:

[0213]

[0214]

[0215] The forward primer F2 sequence is shown in the table below:

[0216] Species name Sequence (5'-3') novel coronavirus SARS2-F2 CATTGGCATGGAAGTCACACC Influenza A virus infA-F2 CAGAGACTGGAAAGTGTCTTTGC Influenza B virus infB-F2 TGGAGAAGGCAAAGCAGAAC Respiratory syncytial virus RSV-F2 GGAAACTACACACATCCCCTCTATG adenovirus ADV-F2 CCCTCCGTTACCCAGAAAAAG Mycoplasma pneumoniae MP-F2 AAGGAAGCTGACTCCGACAAG

[0217] The reverse primer R1 sequence is shown in the table below:

[0218] Species name Sequence (5'-3') novel coronavirus SARS2-R1 TTAGGCTCTGTTGGTGGGAATG Influenza A virus infA-R1 GGGCATTTTGGATAAAGCGTCTAC Influenza B virus infB-R1 TCCATTCCAAGGCAGAGTCTAG Respiratory syncytial virus RSV-R1 CTGTCGGTTCTTGTTAAGCAGATG adenovirus ADV-R1 GCCCATAGACATGAAGTTGCTG Mycoplasma pneumoniae MP-R1 TGCCACCAAACACCAAAAGC

[0219] The reverse primer R2 sequence is shown in the table below:

[0220]

[0221]

[0222] The probe sequences are shown in the table below. The sequences are obtained from Example 3, and the modifying groups are assigned according to the channels according to ROX and Cy5.

[0223]

[0224] To simultaneously detect these six different pathogens in the same system, the reaction system was prepared as follows: (Unlike previous examples, this is a universal reaction component except for the template, because reverse transcriptase was added to the component due to the presence of RNA in the pathogens used):

[0225]

[0226]

[0227] Prepare the above components according to the required reaction quantities. When using, add the template of the corresponding pathogen to the above system, and add 5 μl of the nucleic acid of the corresponding pathogen to every 20 μl (some pathogens have DNA nucleic acid, such as Mycoplasma pneumoniae, and some pathogens have RNA nucleic acid, such as the novel coronavirus).

[0228] Reaction procedure (basically the same as the previous embodiment, except for the addition of reverse transcription time): The reaction procedure in this embodiment is only an example. Adjustments to different temperatures and different number of cycles do not affect the scope of protection of this invention.

[0229]

[0230] Experimental results refer to Figure 9 , Figure 10 and Figure 11 As shown, Figure 9 In the study, the melting curves for the novel coronavirus template showed a ROX channel Tm of 64.3, consistent with the designed target pathogen. The melting curves for influenza A virus showed a ROX channel Tm of 74.0, consistent with the designed target pathogen. The melting curves for influenza B virus showed a ROX channel Tm of 78.4, consistent with the designed target pathogen. The melting curves for respiratory syncytial virus showed a Cy5 channel Tm of 57.7, consistent with the designed target pathogen.

[0231] Figure 10 In the melting curves for adenovirus, the Cy5 channel showed a value of 63.1, consistent with the designed target pathogen. For Mycoplasma pneumoniae, the melting curve showed a Cy5 channel value of 79.0, consistent with the designed target pathogen. For influenza A virus + influenza B virus, the melting curves showed characteristic peaks for the ROX channel at Tm73.8 and Tm78.5, indicating a mixed infection of the two pathogens, consistent with the designed target pathogen. For respiratory syncytial virus + adenovirus, the melting curves showed characteristic peaks for the Cy5 channel at Tm57.6 and Tm72.2, indicating a mixed infection of the two pathogens, consistent with the designed target pathogen.

[0232] Figure 11 In the melting curve analysis for novel coronavirus + adenovirus, characteristic peaks of Tm64.6 in the ROX channel and Tm78.1 in the Cy5 channel were observed, indicating a mixed infection of the two pathogens, consistent with the designed target pathogens. The melting curve for the blank control (without pathogen template) showed no characteristic peaks in either the ROX or Cy5 channels, indicating a negative sample, consistent with expectations.

[0233] The experimental results show that, by using the method of this invention, following the ideas and scheme of this invention, and designing primers to construct a multiplex pathogen nucleic acid detection system, the types of pathogens in a sample can be detected and identified in the same system through melting curve analysis. Both single-pathogen infections and mixed infections with multiple pathogens can be detected correctly.

[0234] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A nucleic acid multiplex detection method, wherein the multiplex detection method is not intended for disease diagnosis, characterized in that, The detection method includes the following steps: The test sample containing the target DNA template and / or target RNA template is blended with a first forward primer combination, a first reverse primer combination, a second forward primer combination, a second reverse primer combination, a probe combination, and a primer combination with a fluorescent excitation group, and reacted; multiple amplicons in the reaction product are detected in the reaction vessel, and the amplicones are detected by melting curve analysis; The template binding regions of the second forward primer combination and the second reverse primer combination are located inside the template binding regions of the first forward primer combination and the first reverse primer combination; The first forward primer combination includes multiple first forward primers, the first reverse primer combination includes multiple first reverse primers, the second forward primer combination includes multiple second forward primers, the second reverse primer combination includes multiple second reverse primers, and the probe combination includes multiple probes. The multiple first forward primers, multiple first reverse primers, multiple second forward primers, multiple second reverse primers, and multiple probes correspond to the detection of different target nucleic acids, and the multiple first forward primers and multiple second forward primers are complementary to the corresponding target DNA template and / or target RNA template. Each second reverse primer includes, along the 5'-3' direction: a primer binding region, a tag sequence region, and a template binding region; the primer binding region is the same as that of the primer with a fluorescent excitation group; and the primer binding region does not have a fluorescent excitation group; the primer with a fluorescent excitation group does not specifically bind to the target DNA template and / or the target RNA template; different target DNA templates and / or target RNA templates correspond to different tag sequences; The tag sequence region is an artificial sequence, and the tag sequence region is completely complementary to the probe sequence or contains 1-5 mismatched nucleotides. The 3' end of the probe has a fluorescent reporter group, and the absorption spectrum of the fluorescent reporter group overlaps with the emission spectrum of the fluorescent excitation group. The reaction product provides multiple amplicones internally labeled with fluorescent reporter groups; The sequence of the first forward primer used to detect the same target DNA template and / or target RNA template is different from the nucleotide sequence of the corresponding second forward primer or has at least 2 nucleotide homologous sequences; the nucleotide sequence of the first reverse primer used to detect the same target DNA template and / or target RNA template is different from the nucleotide sequence of the template binding region of the corresponding second reverse primer or has at least 2 nucleotide overlaps.

2. The nucleic acid multiplex detection method according to claim 1, characterized in that, In the primer combination with a fluorescent excitation group, the fluorescent excitation group of each primer is located at the 3' end of the primer; Preferably, the fluorescent excitation group of the primer with the fluorescent excitation group is located at any nucleotide position from the 1st to the 10th nucleotide starting from the 3' end of the primer; Preferably, the fluorescent excitation group of the primer with the fluorescent excitation group is located at any nucleotide position from the 3rd to the 5th nucleotide starting from the 3' end of the primer.

3. The nucleic acid multiplex detection method according to claim 2, characterized in that, The primers with fluorescent excitation groups are artificial sequences or derived from unrelated species; The absorption and emission wavelengths of the fluorescent excitation group are correspondingly shorter than those of the fluorescent reporter group; Preferably, the fluorescent excitation group is selected from ATTO 425, ATTO 488, ATTO 532, Alexa Fluor 405, Alexa Fluor 488, Alexa Fluor 532 or 6-FAM; Preferably, the primers with fluorescent excitation groups are as shown in SEQ ID NO: 1 or SEQ ID NO:

26.

4. The nucleic acid multiplex detection method according to claim 3, characterized in that, The fluorescent reporter group of the probe sequence is located at any one of the nucleotide positions from the 1st to the 10th nucleotide starting from the 3' end of the probe; Preferably, the fluorescent reporter group of the probe sequence is located at any one of the nucleotide positions from the 1st to the 5th nucleotide starting from the 3' end of the probe.

5. The nucleic acid multiplex detection method according to claim 1, characterized in that, The sequence of the first forward primer used to detect the same target DNA template and / or target RNA template is identical to the nucleotide sequence of the corresponding second forward primer.

6. The nucleic acid multiplex detection method according to claim 1, characterized in that, In a system used to detect the same target DNA template and / or target RNA template, the final concentrations of the first forward primer, the second forward primer, the first reverse primer, the second reverse primer, the probe, and the primer with a fluorescent excitation group are 0-0.8 μM, 0-0.8 μM, 0-0.8 μM, 0-0.4 μM, 0.1-2 μM, and 0.1-2 μM, respectively; and the final concentrations of the first forward primer and the second forward primer are not both 0.

7. The nucleic acid multiplex detection method according to claim 1, characterized in that, The probe assembly comprises: a nucleotide sequence selected from at least one of the sequences shown in SEQ ID NO: 2-25.

8. The nucleic acid multiplex detection method according to claim 1, characterized in that, The samples to be tested are human or animal respiratory samples, human or animal cerebrospinal fluid samples, human or animal reproductive tract samples, human or animal body fluids, human or animal feces, dairy products, or environmental samples.

9. The nucleic acid multiplex detection method according to claim 1, characterized in that, The nucleotide sequences of the tag sequence regions of any two second reverse primers in the second reverse primer combination are different, and the nucleotide sequences of the tag sequence regions are not completely complementary to the amplification regions of the target DNA template and / or target RNA template.

10. A kit for performing the nucleic acid multiplex detection method according to any one of claims 1-9, characterized in that, The kit includes: a first forward primer set, a first reverse primer set, a second forward primer set, a second reverse primer set, a probe set, a primer set with a fluorescent excitation group, and a nucleic acid polymerase; Preferably, the probes in the probe assembly have different melting temperatures; Preferably, the melting temperatures of the multiple probes in the probe assembly differ by at least 3 degrees Celsius.

Images