Markers linked to maize kernel drying rate and their use
By developing markers qSB2, qSB5, and qSB8 that are closely linked to the dehydration rate of maize kernels, and combining them with KASP primers, the problem of low efficiency in mechanized harvesting caused by high moisture content of maize kernels was solved, achieving cost savings and efficiency improvement in breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-04
- Publication Date
- 2026-04-10
AI Technical Summary
In existing technologies, the high moisture content of corn kernels leads to low efficiency of mechanized direct harvesting, which affects the promotion and application of mechanized harvesting and also impacts post-harvest economic value.
We developed markers qSB2, qSB5, and qSB8 that are closely linked to the dehydration rate of maize kernels, and provided corresponding KASP primers to detect the dehydration rate of maize lines and screen for varieties with fast kernel dehydration rates.
By screening and breeding maize varieties with fast grain dehydration rates, we can improve breeding efficiency, shorten breeding time, reduce breeding costs, and enhance the efficiency of mechanized harvesting.
Smart Images

Figure CN120866556B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of molecular marker assisted breeding, and in particular to a marker closely linked to the dehydration rate of corn kernels and application thereof. BACKGROUND
[0002] Corn (Zea mays L.) is the first grain crop in China, and its yield ranks first among the three major grain crops in China, with a contribution rate of more than 80% to the grain yield of China. Therefore, corn production has important strategic significance in ensuring China's food security and stabilizing agricultural economy. With the innovation of agricultural technology, the level of full-process mechanization of corn production has been significantly improved, and the kernel dehydration rate has become a key agronomic trait restricting the efficiency of mechanized harvesting. Studies have shown that the kernel moisture content suitable for mechanical kernel direct harvesting should be 18-25%, while the kernel moisture content in the corn planting area in northern China is generally 30-40% at harvest time. The kernel moisture content at the harvest period not only directly affects the mechanical threshing efficiency and kernel breakage rate, but also regulates the accumulation of mycotoxins and respiratory loss during the storage period, thereby determining the post-production economic value.
[0003] The high kernel moisture content at harvest time is still a core problem restricting the mechanical kernel direct harvesting, which greatly limits the large-area application of mechanical kernel direct harvesting of corn, affects the production efficiency of corn, and hinders the transformation and upgrading of corn production mode. Therefore, reducing the kernel moisture content at the harvest period has been included in the core objectives of modern corn breeding, and constructing a mature kernel dehydration dynamic evaluation system and screening stable genetic markers have become a prerequisite to achieve this goal.
[0004] The application of molecular marker assisted selection (MAS) technology to corn variety breeding has the advantages of saving breeding cost, being convenient and fast, and being not affected by the environment, which can significantly improve the breeding efficiency, shorten the breeding period, and reduce the breeding workload. It is of great significance to screen and cultivate corn varieties with fast mature kernel dehydration rate and meet the mechanical direct harvesting standards. Therefore, it is of great significance to mine genetic genes related to the mature kernel dehydration rate, develop linked SNP and KASP molecular markers, and cultivate corn varieties with fast mature kernel dehydration rate. SUMMARY
[0005] The purpose of the present application is to provide a marker closely linked to the dehydration rate of corn kernels and application thereof, so as to help the breeding of corn varieties with fast kernel dehydration rate and the research of related molecular mechanisms.
[0006] In order to achieve the above-mentioned purpose, the present application provides markers closely linked to the dehydration rate of corn kernels, and the markers are qSB2, qSB5 and qSB8 respectively; wherein, qSB2 is located at the 134367336 site of chromosome 2; qSB5 is located at the 58559368 site of chromosome 5; and qSB8 is located at the 138002591 site of chromosome 8.
[0007] Preferably, when the bases of the markers qSB2, qSB5 and qSB8 are CC, GG and TT respectively, the corn strain shows a fast dehydration rate of kernels; and when the bases of the markers qSB2, qSB5 and qSB8 are TT, AA and AA respectively, the corn strain shows a slow dehydration rate of kernels.
[0008] A kit for detecting the dehydration rate of corn kernels comprises primers for detecting the above-mentioned markers closely linked to the dehydration rate of corn kernels.
[0009] Preferably, the primers are KASP primers or other primers capable of amplifying the above-mentioned markers closely linked to the dehydration rate of corn kernels.
[0010] Preferably, the KASP primer sequence of the qSB2 marker is shown in SEQ ID NO. 4-SEQ ID NO. 6; the KASP primer sequence of the qSB8 marker is shown in SEQ ID NO. 7-SEQ ID NO. 9; and the KASP primer sequence of the qSB5 marker is shown in SEQ ID NO. 10-SEQ ID NO. 12.
[0011] A marker closely linked to the dehydration rate of corn kernels as described above is applied in the breeding of corn varieties, and the corn variety is a variety with a fast dehydration rate of kernels.
[0012] A kit for detecting the dehydration rate of corn kernels as described above is applied in the breeding of corn varieties, and the corn variety is a variety with a fast dehydration rate of kernels.
[0013] A marker closely linked to the dehydration rate of corn kernels as described above is applied in the identification of the dehydration rate of corn kernels.
[0014] A kit for detecting the dehydration rate of corn kernels as described above is applied in the identification of the dehydration rate of corn kernels.
[0015] Therefore, the present application provides markers closely linked to the dehydration rate of corn kernels and the application thereof, and the specific technical effects are as follows:
[0016] (1) The present application first discovers three markers closely linked to the dehydration rate of corn kernels, qSB2, qSB5 and qSB8; wherein qSB2 is located at the 134367336 site of chromosome 2; qSB8 is located at the 138002591 site of chromosome 8; qSB5 is located at the 58559368 site of chromosome 5; when the bases of the markers qSB2, qSB8 and qSB5 are CC, TT and GG respectively, the corn strain shows a fast dehydration rate of kernels; when the bases of the markers qSB2, qSB8 and qSB5 are TT, AA and AA respectively, the corn strain shows a slow dehydration rate of kernels;
[0017] (2) The present application also provides KASP primers for detecting the three markers closely linked to the dehydration rate of corn kernels, the KASP primer sequence of the qSB2 marker is shown as SEQ ID NO. 4-SEQ ID NO. 6; the KASP primer sequence of the qSB8 marker is shown as SEQ ID NO. 7-SEQ ID NO. 9; the KASP primer sequence of the qSB5 marker is shown as SEQ ID NO. 10-SEQ ID NO. 12;
[0018] (3) The markers closely linked to the dehydration rate of corn kernels and the related KASP primers for detecting the markers provided by the present application can be used for the breeding of corn varieties with fast dehydration rate of kernels and the identification of the dehydration rate of kernels of plants, which has important significance for saving breeding cost, improving breeding efficiency and shortening breeding period.
[0019] The technical solutions of the present application will be further described in detail below with the help of the accompanying drawings and examples. BRIEF DESCRIPTION OF DRAWINGS
[0020] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the description of the embodiments of the present application will be briefly introduced, and obviously, the drawings in the following description can only be some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.
[0021] Figure 1 is the genotyping result in the first embodiment of the present application; wherein A is the qSB2 marker; B is the qSB8 marker; C is the qSB5 marker;
[0022] Figure 2is the result of the genotyping information and trait association analysis in the second embodiment of the present application; wherein A is the genotyping map of the grain dehydration rate at 134367336 of chromosome 2, B is the genotyping map of the grain dehydration rate at 138002591 of chromosome 8, and C is the genotyping map of the grain dehydration rate at 58559368 of chromosome 5; the abscissa is the genotype; ** and **** respectively indicate significant at the 0.01, 0.001 probability level;
[0023] Figure 3 is the result of multiple comparison analysis in the third embodiment of the present application;
[0024] Figure 4 is the genotyping result of 3 markers for detecting known maize inbred lines with fast and slow dehydration rates in the fourth embodiment of the present application; wherein A is the genotyping map of qSB2 marker for 10 inbred lines with fast dehydration rate; B is the genotyping map of qSB8 marker for 10 inbred lines with fast dehydration rate; C is the genotyping map of qSB5 marker for 10 inbred lines with fast dehydration rate; wherein D is the genotyping map of qSB2 marker for 10 inbred lines with slow dehydration rate; E is the genotyping map of qSB8 marker for 10 inbred lines with slow dehydration rate; F is the genotyping map of qSB5 marker for 10 inbred lines with slow dehydration rate. DETAILED DESCRIPTION
[0025] The technical solutions of the present application are further described below by means of the accompanying drawings and examples.
[0026] In order to make the purpose, technical solutions and advantages of the present application more clear, thorough and complete, the technical solutions of the present application are described clearly and completely below by means of the accompanying drawings and examples. The following detailed description is the description of the embodiments, which aims to provide further detailed description of the present application. Unless otherwise specified, all technical terms used in the present application have the same meaning as generally understood by those skilled in the art to which the present application belongs.
[0027] The instrument equipment and reagent materials used in the examples are obtained through commercial channels; the method steps not described in detail in the examples are conventional technical means in the art.
[0028] Example 1
[0029] The maize plants are genotyped by using the sites qSB2, qSB5 and qSB8, specifically as follows:
[0030] (1) qSB2 is located at the 134367336th site of chromosome 2, qSB5 is located at the 58559368th site of chromosome 5, and qSB8 is located at the 138002591th site of chromosome 8. The sequence of the marker qSB2 and 100 bp upstream and downstream thereof is shown as SEQ ID NO. 1, the sequence of the marker qSB5 and 100 bp upstream and downstream thereof is shown as SEQ ID NO. 2, and the sequence of the marker qSB8 and 100 bp upstream and downstream thereof is shown as SEQ ID NO. 3, which are obtained from the corn genome database (http: / / www.maizegdb.org).
[0031] SEQ ID NO. 1:
[0032] GCCTCCACTTGGTATCCTATTGGAACACCACTAGCTTACGTGCATGCTACGAAGGTAAACCACCACTGCATGGCCTATAAATACCAATGCAGTATTCAGT[C / T]GAAACTCATCATCACAACTCAAGCACCTATAGTAGTACCTCACAATGGCAGACAAAAAGCTAATACCGTTGGGGCTCATTATCCTCATGAGCATAGGATT
[0033] SEQ ID NO. 2:
[0034] TTGTTACATATCTACATTTTTTCTGTTCTGGCATTCCTTGCAGCCTCCTCCCATTTACAACATGTCTGAAGGTTCCGACACCAATGCCATGATATTTTTT[A / G]TATGCTGGTGGCTGCTTCAGGCATATTCACATCTGAAGGTTGTCTGCCTTCACTACTCTTGTATTCAGTTATCATCAAATTATGGCAGTGACAGATTGTA
[0035] SEQ ID NO. 3:
[0036] AGATACCCCAATCCAACCAAAGCCAAGTCGTTAACTCTTGTTACCGCATCGAGGGACTTTTCACCGTACAGAAGGTGCCTTGCCCCAAACACATCCCCGA[A / T]CGCGATCGCTCAGAGTGTACAGAGTAGGAACAAGAACTGCAGAGGTACCAAACAGGAGGAGCAGCATCCAGATGCTTGATAACGCCATGAACATCGATTGG
[0037] The primers for amplifying qSB2, qSB5, and qSB8 markers are shown in Table 1. Each primer includes two upstream genotyping primers, A and B (each targeting one of the two alleles), and one downstream universal primer, C. The KASP primer sequence information in Table 1 was sent to the company for primer synthesis, and the primers were dissolved according to the instructions provided with the received primers.
[0038] Table 1. KASP primer information for amplification markers qSB2, qSB5, and qSB8.
[0039]
[0040]
[0041] (2) Genomic DNA was extracted from 111 maize inbred lines provided by the Hebei Branch of the National Maize Improvement Center of Hebei Agricultural University, which had been used in breeding practices in both China and the United States (these 111 inbred lines broadly represent the germplasm resource base of the main maize producing areas in China; for inbred line information, see Zhang Dongmei, Liu Yang, Zhao Yongfeng, et al. Analysis of grain filling rate of maize in different heterotic groups [J]. Chinese Agricultural Science, 2014, 47(17):3323-3335; Guo Jinjie, Zhao Yongfeng, Zhang Dongmei, et al. Analysis of grain dehydration rate of maize in different heterotic groups [J]. Journal of Plant Genetic Resources, 2018, 19(01):39-48.DOI:10.13430 / j.cnki.jpgr.2018.01.005.). After electrophoresis and Nanodrop detection, high-quality DNA solutions were selected, and DNA was added at 1.5 μL and 2× Master mix (KASP V4.02X Mastermix). 96 / 384, Catalog No.: KBS-1016-012, Brand: LGC) 0.75μL, primers 0.0417μL, ddH2O 0.75μL, total volume 3μL. Amplification program: 94℃ for 15min; 94℃ for 20s, 61-55℃ (gradient annealing, decreasing by 0.6℃ per cycle) for 60s, 10 cycles; 94℃ for 20s, 55℃ for 60s, 26 cycles; 94℃ for 20s, 57℃ for 60s, 5 cycles.
[0042] After the PCR reaction, the fluorescence signal was converted into analyzable values using an Omega fluorescence signal reader and an Araya instrument. Genotyping was then performed using Kraken™ software provided by LGC (Laboratory of the Government Chemist). The results were visualized using SNPviewer software. The specific principles for genotyping were as follows:
[0043] If the tested material shows a blue fluorescent signal at the qSB2-labeled site, its genotype is homozygous CC; if it shows a dark red fluorescent signal, its genotype is TT; if it shows a green fluorescent signal, its genotype is TC; black dots represent NTC empty tube controls; pink and purple are unknown. If the tested material shows a blue fluorescent signal at the qSB8-labeled site, its genotype is homozygous AA; if it shows a dark red fluorescent signal, its genotype is TT; if it shows a green fluorescent signal, its genotype is AT; black dots represent NTC empty tube controls; pink and purple are unknown. If the tested material shows a blue fluorescent signal at the qSB5-labeled site, its genotype is homozygous AA; if it shows a dark red fluorescent signal, its genotype is GG; if it shows a green fluorescent signal, its genotype is AG; black dots represent NTC empty tube controls; pink and purple are unknown.
[0044] The results of PCR amplification using a mixed primer set of 2-A, 2-B, and 2-C (qSB2 labeled) are as follows: Figure 1 As shown in A, if the primer combination perfectly matches the genomic DNA, the fluorescence signal in the detection result will be red, indicating that the detected plant is homozygous TT genotype; if the fluorescence signal in the detection result is blue, it indicates that the detected plant is homozygous CC genotype; if the fluorescence signal in the detection result is green, it indicates that the detected plant is heterozygous TC genotype.
[0045] The results of PCR amplification using a mixed primer set of 5-A, 5-B, and 5-C (qSB55 labeled) are as follows: Figure 1 As shown in B, if the primer combination perfectly matches the genomic DNA, the fluorescence signal in the detection result will be red, indicating that the detected plant is homozygous GG genotype; if the fluorescence signal in the detection result is blue, it indicates that the detected plant is homozygous AA genotype; if the fluorescence signal in the detection result is green, it indicates that the detected plant is heterozygous AG genotype.
[0046] The results of PCR amplification using a mixed primer set of 8-A, 8-B, and 8-C (qSB88 labeled) are as follows: Figure 1If the primer combination completely matches the genomic DNA, the detection result is red fluorescence signal, indicating that the detected plant is homozygous TT genotype; if the detection result is blue fluorescence signal, it indicates that the detected plant is homozygous AA genotype; if the detection result is green fluorescence signal, it indicates that the detected plant is heterozygous TA genotype.
[0047] Example Two
[0048] According to the information of the dehydration rate (GDR1) of 10-20 days after pollination and the dehydration rate (GDR4) of 40-50 days after pollination of the 111 corn inbred lines known at present (see Gao Y, Li J, Ning R, Zheng Y, Song W, Hou P, Zhu L, Jia X, Zhao Y, Song W, et al. Evaluation of Grain Moisture Content at Maturity and Screening for Identification Indexes of Maize Inbred Lines. Agronomy. 024; 14(7): 1480. https: / / doi.org / 10.3390 / agronomy14071480), the genotyping information of the markers qSB2, qSB5 and qSB8 obtained in Example One was associated with the information of GDR1 and GDR4, and the results are shown in Table 2 and Figure 2
[0049] According to the fluorescence signal of the qSB2 marker, the genotype of the 134367336 locus on chromosome 2 is CC or TT, wherein the average value of GDR1 containing the C gene is 2.09, and the average value of GDR1 containing the C gene d is 2.52. According to the fluorescence signal of the qSB8 marker, the genotype of the 138002591 locus on chromosome 8 is TT or AA, wherein the average value of GDR1 containing the A gene is 2.08, and the average value of GDR1 containing the T gene is 2.41. According to the fluorescence signal of the qSB5 marker, the genotype of the 58559368 locus on chromosome 5 is GG or AA, wherein the average value of GDR4 containing the A gene is 0.60, and the average value of GDR4 containing the G gene is 0.99.
[0050] Table 2 Genotype results of qSB2, qSB5 and qSB8 markers on 111 corn inbred lines
[0051]
[0052] Example Three
[0053] It has been shown that the identification of target traits by using combined markers is more accurate than that by using single marker (Zill P, Buttner A, Eisenmenger W, et al. Single nucleotide polymorphism and haplotype analysis of a novel tryptophan hydroxylase isoform (TPH2) gene in suicide victims [J]. Biological psychiatry, 2004, 56(8): 581-586). The three markers qSB2, qSB5 and qSB8 provided by the present application can constitute eight major haplotype combinations as shown in Table 3.
[0054] Table 3 Haplotype combinations of three markers
[0055] Label name Hap 1 Hap 2 Hap 3 Hap 4 Hap 5 Hap 6 Hap 7 Hap 8 qSB 2 T T T T C C C C qSB 8 T T A A T T A A qSB 5 A G A G A G A G
[0056] The 111 corn inbred lines in Example One were subjected to multiple comparison analysis by using the eight haplotype combinations shown in Table 3, and the results are shown in Table 4. Figure 3 and Table 4, different haplotype combinations have significant effects on the corn kernel dehydration rate trait, and the haplotype combinations Hap5 (CTA) and Hap6 (CTG) are the haplotype combinations of fast kernel dehydration rate. It can be seen that the haplotype combination Hap6 (CTG) can be used as a better combination for the selection of corn kernel dehydration rate trait materials.
[0057] Table 4 Effects of different haplotype combinations on the corn kernel dehydration rate
[0058]
[0059]
[0060] Example Four
[0061] The sites qSB2, qSB8 and qSB5 of the maize inbred lines H21, MS71, SG1533, B95, CHANGK, PH6WC, IB014, PHP55, Z31B and W64A (see Gao Y, Li J, Ning R, Zheng Y, Song W, Hou P, Zhu L, Jia X, Zhao Y, Song W, et al. Evaluation of Grain Moisture Content at Maturity and Screening for Identification Indexes of Maize Inbred Lines. Agronomy. 2024; 14(7): 1480. https: / / doi.org / 10.3390 / agronomy14071480) with fast grain dehydration rate and the maize inbred lines DH40, D1139, QIONG51, R150, 953, 9058, DAN599, D88, M1016, SC30-1 (see Gao Y, Li J, Ning R, Zheng Y, Song W, Hou P, Zhu L, Jia X, Zhao Y, Song W, et al. Evaluation of Grain Moisture Content at Maturity and Screening for Identification Indexes of Maize Inbred Lines. Agronomy. 2024; 14(7): 1480. https: / / doi.org / 10.3390 / agronomy14071480) with slow grain dehydration rate were analyzed using the primers in Table 1, and the method was the same as Example 1.
[0062] The results are shown in Table 5, Figure 4 As shown in Table 5,
[0063] In 10 inbred lines with low grain dehydration rate, the results of marker qSB2 showed that 9 inbred lines were TT genotype and 1 inbred line was TG genotype; the results of marker qSB8 showed that 10 inbred lines belonged to AA genotype; the results of marker qSB5 showed that 7 inbred lines belonged to AA genotype and 3 inbred lines belonged to AG genotype. In single marker detection, the screening rates of three markers for detecting the dominant genes of corn grain dehydration rate were 60% (CC), 80% (TT) and 90% (GG) respectively. The screening rate of multi-marker was 60% (CTG). The screening rates of three markers for detecting the genes of corn grain dehydration rate were 90% (GG), 100% (CC) and 70% (GG) respectively. The screening rate of multi-marker was 70%
[0064] Therefore, the three markers can be used for screening the grain dehydration rate of corn inbred lines.
[0065] Table 5 qSB2, qSB8 and qSB5 base
[0066]
[0067] Therefore, the three markers can be used for screening the grain dehydration rate of corn inbred lines.
[0068] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application rather than limit it, although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that: it can still modify or equivalently replace the technical solutions of the present application, and these modifications or equivalent replacements also cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.
Claims
1. Use of a marker tightly linked to the dehydration rate of corn kernels in the selection of corn varieties, characterized in that: The corn variety is a corn kernel dehydration rate fast variety; The markers closely linked to the corn kernel dehydration rate are qSB2, qSB5 and qSB8, respectively; wherein qSB2 is located at the 134367336 site of chromosome 2; qSB5 is located at the 58559368 site of chromosome 5; qSB8 is located at the 138002591 site of chromosome 8; The sequence of marker qSB2 and 100bp upstream and downstream thereof is shown as SEQ ID NO. 1, the sequence of marker qSB5 and 100bp upstream and downstream thereof is shown as SEQ ID NO. 2, and the sequence of marker qSB8 and 100bp upstream and downstream thereof is shown as SEQ ID NO. 3; When the genotypes of markers qSB2, qSB5 and qSB8 are CC, GG and TT, respectively, the corn line shows a fast kernel dehydration rate; when the genotypes of markers qSB2, qSB5 and qSB8 are TT, AA and AA, respectively, the corn line shows a slow kernel dehydration rate.
2. Use of a kit for detecting the dehydration rate of corn kernels in the selection of corn varieties, characterized in that: The corn variety is a corn kernel dehydration rate fast variety; The kit for detecting the corn kernel dehydration rate comprises primers for detecting the markers closely linked to the corn kernel dehydration rate as claimed in claim 1; The primers are KASP primers; The KASP primer sequence of qSB2 marker is shown as SEQ ID NO. 4-SEQ ID NO. 6; The KASP primer sequence of qSB8 marker is shown as SEQ ID NO. 7-SEQ ID NO. 9; and the KASP primer sequence of qSB5 marker is shown as SEQ ID NO. 10-SEQ ID NO.
12.
3. Use of the marker closely linked to the corn kernel dehydration rate as claimed in claim 1 in the identification of the corn kernel dehydration rate.
4. Use of the kit for detecting the corn kernel dehydration rate as claimed in claim 2 in the identification of the corn kernel dehydration rate.