Method for producing N-acetylneuraminic acid by optimizing and improving whole-cell catalysis of mixed bacillus amyloliquefaciens engineering bacteria through metabolic pathway

Abstract

The invention discloses a method for improving whole-cell catalytic synthesis of N-acetylneuraminic acid (NeuAc) by bacillus amyloliquefaciens engineering bacteria through metabolic pathway optimization. According to the method, NeuAc synthesis precursor N-acetylglucosamine (GlcNAc) decomposition pathway genes nagA and nagB and a phosphate transport pathway gene nagP in bacillus amyloliquefaciens are knocked out through a genetic engineering method, meanwhile, a NeuAc synthesis precursor pyruvic acid competition pathway phosphate oxidase gene ydaP is knocked out, on the basis, a NeuAc key synthesis gene age or shnano A is further subjected to heterologous expression, and the NuAc synthesis precursor gene nagA or shnano B is obtained. Two strains of bacillus amyloliquefaciens engineering bacteria are obtained; the two engineering bacteria are used as catalysts, GlcNAc and sodium pyruvate are used as substrates, a whole-cell catalytic reaction is carried out, the yield of NeuAc reaches 134.68 g / L, the conversion rate of the GlcNAc is increased by 96% compared with that of a control bacterium, and the yield of NeuAc and the utilization rate of the substrates are remarkably increased.

Description

Technical Field

[0001] This invention belongs to the field of microbial genetic engineering and metabolic engineering technology, specifically involving a method to significantly increase the yield of N-acetylneuraminic acid (NeuAc) by knocking out key genes in the GlcNAc degradation pathway and pyruvate competitive pathway in Bacillus amyloliquefaciens and combining this with whole-cell catalytic process optimization. Background Technology

[0002] N-acetylneuraminic acid (NeuAc) is a 9-carbon monosaccharide derivative with biological diversity and functional specificity. As the terminal group of the sugar chain, NeuAc is directly exposed to the extracellular environment and interacts strongly with lipids and proteins, playing a crucial role in biological, pathological, and immune processes. NeuAc is also a key substance in the synthesis of human lactose oligosaccharides (HMOs). Importantly, NeuAc was approved as a novel food in 2017. In China, NeuAc has also been recognized as a novel biological product in the cosmetics, food, and pharmaceutical fields. Therefore, NeuAc has broad application prospects.

[0003] In the whole-cell catalytic synthesis of NeuAc, the key lies in ensuring an effective supply of the precursors N-acetylglucosamine (GlcNAc) and pyruvate. The invention application "A method for whole-cell catalytic production of N-acetylneuraminic acid using a mixed culture of engineered Bacillus amyloliquefaciens" (CN202410924655.1) achieved a NeuAc yield of 60.93 g / L by expressing AGE (N-acetylglucosamine-2-epimerase) and ShNanA (N-acetylneuraminic acid aldolase). However, the GlcNAc conversion rate was only 35%, indicating room for improvement. Traditional whole-cell catalytic synthesis of NeuAc leads to substrate loss and byproduct accumulation. Specifically, GlcNAc is broken down into fructose-6-phosphate by the N-acetylglucosamine-6-phosphate deacetase gene nagA and the N-acetylglucosamine-6-phosphate deaminase gene nagB, and then metabolized by the host bacteria; extracellular GlcNAc is phosphorylated by the N-acetylglucosamine-6-phosphate specific transferase gene nagP. Meanwhile, pyruvate, another precursor in NeuAc synthesis, is readily converted to lactate or acetic acid via the lactate dehydrogenase gene ldh or the pyruvate oxidase gene ydaP, reducing the synthesis flux of NeuAc. Bacillus amyloliquefaciens, as a food-grade safe chassis cell, is a host bacterium specified in the National Food Safety Standards for Food Additives. Therefore, this invention utilizes a metabolic engineering strategy to block the GlcNAc degradation pathway and pyruvate branch metabolism in Bacillus amyloliquefaciens, achieving the directed conversion of GlcNAc to pyruvate and significantly increasing the synthesis flux of NeuAc. Summary of the Invention

[0004] The purpose of this invention is to improve the substrate conversion efficiency by blocking the GlcNAc degradation pathway and the pyruvate competitive pathway in Bacillus amyloliquefaciens, and to increase the synthesis of NeuAc by using an engineered combination of Bacillus amyloliquefaciens bacteria through whole-cell catalysis.

[0005] To achieve the above objectives, the present invention employs the following technical measures:

[0006] A combination of engineered Bacillus amyloliquefaciens strains that enhances N-acetylneuraminic acid production through metabolic pathway optimization includes the following engineered strains:

[0007] I. In Bacillus amyloliquefaciens, the N-acetylglucosamine-6-phosphate deacetylase gene nagA, the N-acetylglucosamine-6-phosphate deaminase gene nagB, the N-acetylglucosamine-6-phosphate specific transferase gene nagP, and the pyruvate oxidase gene ydaP were simultaneously knocked out, and the N-acetylglucosamine-2-epimerase encoding gene age was overexpressed;

[0008] II. In Bacillus amyloliquefaciens, the N-acetylglucosamine-6-phosphate deacetylase gene nagA, the N-acetylglucosamine-6-phosphate deaminase gene nagB, the N-acetylglucosamine-6-phosphate specific transferase gene nagP, and the pyruvate oxidase gene ydaP were simultaneously knocked out, and the N-acetylneuraminic acid aldolase encoding gene shnanA was overexpressed.

[0009] The nucleotide sequences of the nagA and nagB are shown in SEQ ID NO.1, the nucleotide sequence of the nagP is shown in SEQ ID NO.2, the nucleotide sequence of the ydaP is shown in SEQ ID NO.3, the nucleotide sequence of the age gene is shown in SEQ ID NO.4, and the nucleotide sequence of the shnanA gene is shown in SEQ ID NO.5.

[0010] Preferably, the gene age or the gene shnanA is expressed in free form, and the expression of the gene age or the gene shnanA is enhanced using a mutated promoter P43, the sequence of which is shown in SEQ ID NO.12.

[0011] The fermentation culture method of the above-mentioned Bacillus amyloliquefaciens engineered strain combination: the fermentation broth uses xylose as the carbon source and also includes yeast powder, tryptone, (NH4)2SO4, KH2PO4, K2HPO4·3H2O and MgSO4.

[0012] The above-mentioned engineered Bacillus amyloliquefaciens strain combination is used in the whole-cell catalytic synthesis of N-acetylneuraminic acid. Specifically, the engineered Bacillus amyloliquefaciens strain combination is used as a catalyst, and N-acetylglucosamine and sodium pyruvate are used as substrates to carry out a whole-cell catalytic reaction; the catalytic reaction solution also includes polyethylene glycol octylphenyl ether (Triton X-100) and MgCl2. Preferably, the temperature of the catalytic reaction is 30-60℃.

[0013] Compared with the prior art, the present invention has the following advantages and effects:

[0014] 1. For the first time, GlcNAc degradation and pyruvate pathway were blocked in Bacillus amyloliquefaciens, improving substrate utilization by 96% to as high as 77%.

[0015] 2. By optimizing the whole-cell catalytic reaction conditions, the catalytic activity of the cells was further enhanced. After whole-cell catalysis by the optimized Bacillus amyloliquefaciens engineered bacteria, the yield of N-acetylneuraminic acid reached 134.68 g / L. Attached Figure Description

[0016] Figure 1 Verification bands for engineered strain HZ-12ΔnagAnagB. Lane M: DL5000 DNA Marker; Lanes 1 and 2: PCR products using *Bacillus amyloliquefaciens* HZ-12 and HZ-12ΔnagAnagB as templates, with *nagAnagB-AF* and *nagAnagB-BR* as primers, respectively.

[0017] Figure 2 Verification bands for engineered strain HZ-12ΔnagAnagBΔnagP. Lane M: DL5000 DNA Marker; Lanes 1 and 2: PCR products using *Bacillus amyloliquefaciens* HZ-12 and HZ-12ΔnagAnagBΔnagP as templates, with *nagP-AF* and *nagP-BR* as primers, respectively.

[0018] Figure 3 Verification bands for engineered strain HZ-12ΔnagAnagBΔnagPΔydaP. Lane M: DL5000 DNA Marker; Lanes 1 and 2: PCR products using ydaP-AF and ydaP-BR as primers, respectively, with Bacillus amyloliquefaciens HZ-12 and HZ-12ΔnagAnagBΔnagPΔydaP as templates.

[0019] Figure 4Comparison of the whole-cell synthesis of NeuAc by engineered Bacillus amyloliquefaciens strains HZ-12ΔnagAnagBΔnagPΔydaP / pHY-RBS3-age and HZ-12ΔnagAnagBΔnagPΔydaP / pHY-RBS3-shnanA (abbreviated as HZ-12ΔnagAnagBΔnagPΔydaP in the figure) and mixed strains HZ-12 / pHY-RBS3-age and HZ-12 / pHY-RBS3-shnanA (CK). Detailed Implementation

[0020] Description of biological materials:

[0021] Bacillus amyloliquefaciens HZ-12 is a publicly known biological material, which has been reported in the article (Ruan Liying, Li Lu, Zou Dian, Jiang Cong, Wen Zhiyou, Chen Shouwen, Deng Yu, Wei Xuetuan, (2019) Metabolic engineering of Bacillus amyloliquefaciens for enhanced production of S-adenosylmethionine by coupling of an engineered S-adenosylmethionine pathway and the tricarboxylic acid cycle. Biotechnol. Biofuels 12, 211), and is currently deposited in the Microbial Engineering Laboratory of Huazhong Agricultural University.

[0022] Example 1 Construction of strains HZ-12ΔnagAnagB and HZ-12ΔnagAnagBΔnagP 1. Construction of thermosensitive knockout vectors T2(2)-ΔnagAnagB and T2(2)-ΔnagP

[0023] Using *Bacillus amyloliquefaciens* HZ-12 as the starting strain, the inventors identified key genes involved in GlcNAc degradation: the N-acetylglucosamine-6-phosphate deacetylase gene *nagA*, the N-acetylglucosamine-6-phosphate deaminase gene *nagB*, and the N-acetylglucosamine-6-phosphate specific transferase gene *nagP*. Based on the gene sequence of the *nagAnagB* gene in the HZ-12 genomic DNA sequence, primers for the upstream homologous arm of the *nagAnagB* gene, *nagAnagB-AF* and *nagAnagB-AR*, and primers for the downstream homologous arm, *nagAnagB-BF* and *nagAnagB-BR*, were designed. Using the HZ-12 genomic DNA as a template, PCR amplification was performed using the upstream and downstream homologous arm primers of the *nagAnagB* gene to obtain the upstream and downstream homologous arm fragments of the *nagAnagB* gene. The upstream homologous arm fragment of the *nagAnagB* gene is 561 bp, and its nucleotide sequence is shown in SEQ ID NO. As shown in NO.6, the downstream homologous arm of the nagAnagB gene is 529 bp, and its nucleotide sequence is shown in SEQ ID NO.7. The primer sequences are as follows:

[0024] nagAnagB-AF: CGGGATCCAGACGGGCTTTCAAGAAA;

[0025] nagAnagB-AR: AATCTGCATAGGTCAAATCCTTGTTATGCCGGAATTGTATAAATC; nagAnagB-BF: GATTTATACAATTCCGGCATAACAAGGATTTGACCTATGCAGATT; nagAnagB-BR: GCTCTAGACGCTTCAATATGCTCATACATG.

[0026] The upstream and downstream homologous arms were ligated together using overlap extension PCR to form a 1090 bp homologous arm fusion fragment. Based on the nagP gene sequence in the HZ-12 genomic DNA sequence, primers nagP-AF and nagP-AR for the upstream homologous arm and nagP-BF and nagP-BR for the downstream homologous arm were designed. Using HZ-12 genomic DNA as a template, PCR amplification was performed using the upstream and downstream homologous arm primers to obtain the upstream and downstream homologous arm fragments of the nagP gene. The upstream homologous arm fragment of the nagP gene is 567 bp, and its nucleotide sequence is shown in SEQ ID NO. 8. The downstream homologous arm fragment of the nagP gene is 451 bp, and its nucleotide sequence is shown in SEQ ID NO. 9. The primer sequences are as follows:

[0027] nagP-AF: CGGGATCCCCAATCCTTTCTTGAAATGC;

[0028] nagP-AR:GGGTTTCAAACTTGCGGATTTACCCATCCCCCTTCTT;

[0029] nagP-BF: AAGAAGGGGGATGGGTAAATCCGCAAGTTTGAAACCC;

[0030] nagP-BR:GCTCTAGAGTCACAATTCGATTATACGAAGC.

[0031] The upstream and downstream homologous arms were ligated together using overlap extension PCR to form a 1018 bp homologous arm fusion fragment. The homologous arm fusion fragment and plasmid T2(2)-ori were double-digested with Xba I and BamH I restriction endonucleases to obtain the digested gene fragment and linear plasmid fragment. The digested gene fragment and linear plasmid fragment were ligated using T4 DNA ligase to obtain the ligation product. This ligation product was transformed into *E. coli* DH5α using calcium chloride conversion. Transformants were selected using LB medium containing 20 μg / mL kanamycin at 37°C. Colony PCR and plasmid PCR were then performed on the transformants. The primers used for colony and plasmid PCR were T2-F and T2-R, respectively, to obtain the gene knockout vectors T2(2)-ΔnagAnagB and T2(2)-ΔnagP. The primer sequences are as follows:

[0032] T2-F: ATGTGATAACTCGGCGTA;

[0033] T2-R: GCAGAGCAGCAGATTACGC.

[0034] 2. Construction of engineered strains HZ-12ΔnagAnagB and HZ-12ΔnagAnagBΔnagP

[0035] The knockout vector T2(2)-ΔnagAnagB was transformed into Bacillus amyloliquefaciens HZ-12. The bacteria were screened in LB medium containing 20 μg / mL kanamycin at 37°C. Transformants were obtained and colony PCR was performed to verify the transformants. The primer pairs used were T2-F and T2-R. Positive transformants were obtained, which were Bacillus amyloliquefaciens HZ-12 transformed with the knockout vector T2(2)-ΔnagAnagB.

[0036] The positive transformants were cultured three times at 45℃ on medium containing 20 μg / mL kanamycin, each time for 12 h. Colony PCR was performed to detect single-exchange strains using either T2-F and nagAnagB-BR or T2-R and nagAnagB-AF primers. The single-exchange strains were inoculated and cultured several times at 37℃ on medium without kanamycin. Transformants were then picked for colony PCR detection using nagAnagB-AF and nagAnagB-BR primers. Results are as follows: Figure 1 As shown in the figure. Subsequent DNA sequencing of the positive transformants further validated the results, yielding a successfully double-crossovered nagAnagB knockout strain, namely the engineered strain HZ-12ΔnagAnagB.

[0037] Following the above method, T2(2)-ΔnagP was transferred into Bacillus amyloliquefaciens HZ-12ΔnagAnagB to obtain the engineered strain HZ-12ΔnagAnagBΔnagP. The results are as follows: Figure 2 As shown.

[0038] Example 2: Construction of strain HZ-12ΔnagAnagBΔnagPΔydaP

[0039] 1. Construction of gene knockout vector T2(2)-ΔydaP

[0040] Using *Bacillus amyloliquefaciens* HZ-12 as the starting strain, the inventors identified the key pyruvate oxidase gene ydaP, a gene responsible for pyruvate degradation, through analysis. Based on the gene sequence of ydaP in the HZ-12 genomic DNA sequence, primers ydaP-AF and ydaP-AR for the upstream homologous arm and ydaP-BF and ydaP-BR for the downstream homologous arm were designed. Using the HZ-12 genomic DNA as a template, PCR amplification was performed using the upstream and downstream homologous arm primers to obtain the upstream and downstream homologous arm fragments of the ydaP gene. The upstream homologous arm fragment of the ydaP gene is 488 bp, and its nucleotide sequence is shown in SEQ ID NO.10; the downstream homologous arm fragment of the ydaP gene is 496 bp, and its nucleotide sequence is shown in SEQ ID NO.11. The primer sequences are as follows:

[0041] ydaP-AF:CGGGATCCTTGTCATCATACAAAATGAGGGGC;

[0042] ydaP-AR:ATAACCACCGGCTTCACTGCATCCTCCTTTTTACCTG;

[0043] ydaP-BF:AAAGGAGGATGCAGTGAAGCCGGTGGTTATAAAAAAAATT;

[0044] ydaP-BR:GCTCTAGAAAACATGATATTGTTTATTGGCAAGTTCA.

[0045] The upstream and downstream homologous arms were ligated together using overlap extension PCR to form a 984 bp homologous arm fusion fragment. The homologous arm fusion fragment and plasmid T2(2)-ori were double-digested with Xba I and BamH I restriction endonucleases to obtain the digested gene fragment and linear plasmid fragment. The digested gene fragment and linear plasmid fragment were ligated using T4 DNA ligase to obtain the ligation product. This ligation product was transformed into *E. coli* DH5α using calcium chloride conversion. Transformants were selected at 37°C using LB medium containing 20 μg / mL kanamycin. Colony PCR and plasmid PCR were then performed on the transformants. The primers used for colony and plasmid PCR were T2-F and T2-R, respectively, to obtain the gene knockout vector T2(2)-ΔydaP.

[0046] 2. Construction of engineered strain HZ-12ΔnagAnagBΔnagPΔydaP

[0047] The knockout vector T2(2)-ΔydaP was transformed into Bacillus amyloliquefaciens HZ-12ΔnagAnagBΔnagP. Transformants were screened at 37°C using a medium containing 20 μg / mL kanamycin. Colony PCR was performed to verify the transformants using primer pairs T2-F and T2-R, yielding positive transformants. These positive transformants were then cultured three times at 45°C on a medium containing 20 μg / mL kanamycin, each time for 12 h. Colony PCR was performed using primer pairs T2-F and ydaP-BR or T2-R and ydaP-AF to detect single-exchange strains. The single-exchange strains were inoculated and cultured at 37°C in a medium without kanamycin for several transfections. Transformants were then selected for colony PCR detection using primer pairs ydaP-AF and ydaP-BR. The results are as follows: Figure 3 As shown in the figure. Subsequent DNA sequencing of the positive transformants further validated the results, yielding a successfully double-crossovered ydaP knockout strain, namely the engineered strain HZ-12ΔnagAnagBΔnagPΔydaP.

[0048] Example 3: Construction of strains HZ-12ΔnagAnagBΔnagPΔydaP / pHY-RBS3-age and HZ-12ΔnagAnagBΔnagPΔydaP / pHY-RBS3-shnanA

[0049] 1. Construction of gene expression vector pHY-RBS3-age

[0050] Using the laboratory-preserved plasmid pHY-RBS3-shnanA (construction method according to CN118638710A) as a template, the vector fragment pHY-RBS3 was obtained by reverse amplification using primers pHY-RBS3-F and pHY-RBS3-R. The pHY-RBS3 fragment was then treated with the restriction endonuclease Dpn I at 37℃ for 45 min, and the age fragment was amplified using primers age-F and age-R. The pHY-RBS3 and age fragments were recovered using a gel extraction kit. The pHY-RBS3 backbone fragment was then recombined with the age fragment using recombinase. The primer sequences are as follows:

[0051] pHY-RBS3-F: GGATCCCCGGGAAGAG;

[0052] pHY-RBS3-R: TGATAATTCCTCCTTTCTAGATCTGCTA;

[0053] age-F: AAGGAGGAATTATCAATGGGAAAAAATCTGCAGGC;

[0054] age-R:CTCTTCCCGGGGATCCTTAGCTCAGCGCTTCAAACT.

[0055] The recombinant product was transformed into *Escherichia coli* DH5α and plated on LB agar plates containing a tetracycline antibiotic (20 μg / mL). After overnight incubation, single colonies were streaked onto plates with the same antibiotic and incubated for approximately 12 hours. Colony PCR was performed using universal plasmid primers for verification. After electrophoresis verification, positive clones were selected, cultured, and the plasmid was extracted and sequenced by a company. The results were compared with those on NCBI, confirming the correct insertion sequence, thus successfully constructing the free expression plasmid pHY-RBS3-age.

[0056] 2. Construction of free expression strains

[0057] Free plasmid vectors pHY-RBS3-age and pHY-RBS3-shnanA (obtained according to CN118638710A) were electroporated into HZ-12ΔnagAnagBΔnagPΔydaP competent cells, respectively. The cells were plated on plates containing tetracycline resistance (20 μg / mL) and cultured at 37℃ for 16-24 h to obtain the corresponding transformants. A certain number of transformants were picked and streaked on the corresponding plates for about 8 h for colony PCR verification. The verified colonies were picked and cultured in 5 mL of liquid LB medium (containing 20 μg / mL tetracycline) at 37℃ and 180 r / min for 12 h. 800 μL of the culture was then stored in a glycerol tube and stored at -80℃. The engineered bacteria HZ-12ΔnagAnagBΔnagPΔydaP / pHY-RBS3-age and HZ-12ΔnagAnagBΔnagPΔydaP / pHY-RBS3-shnanA were obtained through genetic engineering.

[0058] Example 3: Whole-cell catalysis of NeuAc synthesis by a mixture of Bacillus amyloliquefaciens HZ-12ΔnagAnagBΔnagPΔydaP / pHY-RBS3-age and HZ-12ΔnagAnagBΔnagPΔydaP / pHY-RBS3-shnanA

[0059] Colonies of engineered Bacillus amyloliquefaciens strains HZ-12ΔnagAnagBΔnagPΔydaP / pHY-RBS3-age and HZ-12ΔnagAnagBΔnagPΔydaP / pHY-RBS3-shnanA were picked and inoculated into 5 mL of LB medium and cultured overnight at 37°C with shaking at 180 rpm. Then, 3% of the inoculum was transferred to 50 mL of LB medium and cultured until OD...600 When the pH reached approximately 3.0-4.0, the cells were co-inoculated at a rate of 1.5% into 50 mL of NeuAc high-yield medium (xylose 40 g / L, yeast extract 12 g / L, tryptone 6 g / L, (NH4)2SO4 6 g / L, KH2PO4 2.5 g / L, K2HPO4·3H2O 12.5 g / L, MgSO4·7H2O 3 g / L, pH 6.5). The medium was incubated at 37°C with shaking at 180 rpm for 24 h, centrifuged at 7000 rpm for 10 min, the supernatant was discarded, and the cells were collected. The cells were washed with 0.01 mol / L PBS buffer (pH 7.5) and then resuspended in whole-cell catalytic buffer (10 g / L MgCl2, 0.8 mol / L N-acetylglucosamine, 1.0 mol / L sodium pyruvate, and 1.33 mL / L Triton). X-100 was brought to a final volume with 0.01 mol / L pH 7.5 PBS buffer (pH 7.5) to form OD. 600 A cell suspension with a concentration of 25 was reacted in a 250 mL shake flask at 50 °C and 180 rpm for 96 h. The supernatant was collected, diluted with 5 mM H₂SO₄, and the NeuAc content was determined by high-performance liquid chromatography (HPLC). NeuAc yield was as follows: Figure 4 As shown, the metabolically engineered Bacillus amyloliquefaciens strains HZ-12ΔnagAnagBΔnagPΔydaP / pHY-RBS3-age and HZ-12ΔnagAnagBΔnagPΔydaP / pHY-RBS3-shnanA, after whole-cell catalysis, produced NeuAc yields as high as 134.68 g / L, with a GlcNAc molar conversion rate of 77%. The GlcNAc conversion rate was 96% higher than that of the HZ-12 / pHY-RBS3-age and HZ-12 / pHY-RBS3-shnanA (starting from HZ-12 strain, transformed into free plasmid vectors pHY-RBS3-age and pHY-RBS3-shnanA, respectively).

Claims

1. A Bacillus amyloliquefaciens engineered strain combination that enhances N-acetylneuraminic acid production through metabolic pathway optimization, characterized in that, Including the following engineered bacteria: I. Simultaneous knockout of the N-acetylglucosamine-6-phosphate deacetylase gene in Bacillus amyloliquefaciens HZ-12 nagA N-acetylglucosamine-6-phosphate deaminase gene nagB N-acetylglucosamine-6-phosphate specific transferase gene nagP and pyruvate oxidase gene ydaP and overexpressed the gene encoding N-acetylglucosamine-2-epimerase. age ; II. Simultaneous knockout of the N-acetylglucosamine-6-phosphate deacetylase gene in Bacillus amyloliquefaciens HZ-12 nagA N-acetylglucosamine-6-phosphate deaminase gene nagB N-acetylglucosamine-6-phosphate specific transferase gene nagP and pyruvate oxidase gene ydaP and overexpress the gene encoding N-acetylneuraminic acid aldolase. shnanA ; The nagA and nagB The nucleotide sequence is shown in SEQ ID NO.

1. nagP The nucleotide sequence is shown in SEQ ID NO.

2. ydaP The nucleotide sequence of the gene is shown in SEQ ID NO.

3. age The nucleotide sequence of the gene is shown in SEQ ID NO.

4. shnanA The nucleotide sequence is shown in SEQ ID NO.

5.

2. The engineered Bacillus amyloliquefaciens strain combination according to claim 1, characterized in that, Free expression of the gene age or genes shnanA .

3. The engineered Bacillus amyloliquefaciens strain combination according to claim 2, characterized in that, Enhanced expression of the gene was achieved using a mutated P43 promoter. age or genes shnanA The sequence of the mutant P43 promoter is shown in SEQ ID NO.

12.

4. The fermentation culture method of the engineered Bacillus amyloliquefaciens strain combination according to any one of claims 1 to 3, characterized in that, The fermentation broth uses xylose as a carbon source and also includes yeast powder, tryptone, (NH4)2SO4, KH2PO4, K2HPO4·3H2O, and MgSO4.

5. The application of the engineered Bacillus amyloliquefaciens strain combination according to any one of claims 1 to 3 in the whole-cell catalytic synthesis of N-acetylneuraminic acid.

6. The application according to claim 5, characterized in that, Using the aforementioned engineered Bacillus amyloliquefaciens strain as a catalyst, and N-acetylglucosamine and sodium pyruvate as substrates, a whole-cell catalytic reaction was carried out.

7. The application according to claim 6, characterized in that, The catalytic reaction solution also includes polyethylene glycol octylphenyl ether and MgCl2.

8. The application according to claim 6 or 7, characterized in that, The temperature for the catalytic reaction is 30-60℃.

Images