Method for enhancing citrus canker resistance through citrus CsKCS6 gene

By cloning the citrus CsKCS6 gene and constructing the VIGS vector to silence its transcription, the problems of environmental hazards and gene scarcity in the prevention and control of citrus canker were solved, realizing the efficient enhancement of citrus resistance to canker and its molecular breeding potential.

CN120888593APending Publication Date: 2025-11-04GERMPLASM INNOVATION GRAND SCIENCE CENTER OF WESTERN CHINA (CHONGQING) SCIENCE CITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511103254.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-07
Publication Date
2025-11-04

AI Technical Summary

Technical Problem

Current technologies for controlling citrus canker, such as burning diseased trees and using pesticides, cause environmental damage and lack high-quality disease-resistant genes. There is also a lack of in-depth research on genes related to citrus canker, which affects the development of the citrus industry.

Method used

By cloning the citrus CsKCS6 gene and constructing the VIGS vector, the transcription level of the citrus CsKCS6 gene was reduced. Then, Agrobacterium-mediated transformation of citrus was used to silence the CsKCS6 gene and enhance its resistance to citrus canker.

Benefits of technology

It significantly improves the resistance of citrus to citrus canker, reduces the area of ​​lesions and the disease index, alleviates the severity of citrus canker, and does not affect the plant phenotype, providing candidate genes for molecular breeding of citrus canker resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120888593A_ABST
    Figure CN120888593A_ABST
Patent Text Reader

Abstract

The invention relates to the field of plant genetic engineering, and discloses a method for enhancing citrus canker resistance by a citrus CsKCS6 gene. The citrus CsKCS6 gene is silenced, the resistance of citrus plants to citrus canker is improved, and the method specifically comprises the following steps: (1) cloning a VIGS fragment of the citrus CsKCS6 gene; (2) constructing an expression vector of VIGS of the CsKCS6 gene; and (3) transforming the citrus by the VIGS expression vector to obtain a citrus CsKCS6 gene silenced VIGS plant. The citrus CsKCS6 gene is obtained through cloning for the first time, the transcriptional level of citrus CsKCS6 is silenced and reduced through VIGS, and the function of CsKCS6 in citrus canker susceptibility resistance is verified; the method has a significant application value for citrus canker-resistant breeding, lays a foundation for citrus canker-resistant genetic breeding, and greatly promotes the development and application of citrus canker-resistant genetic engineering.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to a method for enhancing the resistance of citrus canker disease using the CsKCS6 gene in citrus. Background Technology

[0002] Citrus bacterial canker (CBC) is caused by Xanthomonas citrus subsp. *Xanthomonas citrus* (CBC). Xanthomonas citri subsp. Citri , Xcc Citrus canker is a bacterial disease that affects most major citrus varieties. Therefore, strengthening research on the prevention and control of citrus canker is an urgent need for the development of the citrus industry.

[0003] Traditional control methods for citrus canker, such as burning diseased trees and using pesticides, require significant manpower and resources and cause substantial environmental damage. Therefore, the control of citrus canker relies more heavily on cultivating new resistant germplasm. Molecular breeding, due to its ability to selectively and efficiently cultivate new resistant germplasm, has seen rapid development and widespread application. In recent years, biotechnology has yielded some citrus resources resistant to canker, such as Jincheng, Xinhui, and navel orange lines transgenic with the antimicrobial peptide D gene from silkworms; late-maturing Jincheng orange lines overexpressing CsBZIP40; and plants with enhanced resistance to citrus canker obtained through site-specific editing of the CsLOB1 promoter, a citrus canker susceptibility gene. However, high-quality candidate genes remain scarce, and their functions and mechanisms of action are not well understood. Therefore, there is an urgent need to specifically identify more genes closely related to citrus canker, deeply analyze their functions and mechanisms, and use them for molecular breeding to combat canker.

[0004] Plant waxes are an important component covering the plant epidermis and play a crucial role in protecting plants from external biotic stresses. Waxes are mainly composed of very long-chain fatty acids (VLCFAs) and their derivatives, such as aldehydes, alcohols, alkanes, and esters. The β-ketoacyl-CoA synthase (KCS) gene family plays a key role in wax synthesis, encoding enzymes that catalyze the initiation step of VLCFA synthesis and are the rate-limiting enzymes in VLCFA synthesis. The expression and function of KCS genes directly affect the composition and content of plant waxes, thus influencing plant stress resistance. In recent years, with the continuous development of molecular biology techniques, the mechanism of action of KCS genes in plant disease resistance has been studied in greater depth. KCS genes belong to the fatty acid synthase family, and the proteins they encode have multiple conserved domains. KCS proteins typically contain an N-terminal plasma membrane localization domain, a central catalytic domain, and a C-terminal regulatory domain. The catalytic domain contains multiple conserved amino acid residues, which are essential for enzyme activity.

[0005] The plant wax layer, as the first line of defense against pathogen infection, plays a crucial role in plant disease resistance through its physical barrier function. The KCS gene, by participating in wax synthesis, influences the composition and structure of the wax layer, thereby regulating the plant's physical barrier function. When plants are infected by pathogens, the expression of the KCS gene may be induced and upregulated, increasing the synthesis of VLCFAs and causing the wax layer to thicken or become denser. The thickened wax layer can prevent pathogen invasion, reduce the contact area between pathogens and plant cells, and thus reduce the infection efficiency of pathogens. Studies have shown that in passion fruit (… Passiflora edulis ) affected by Fusarium oxysporum in Kyushu ( Fusarium kyushuense During infection, most PeKCS genes were upregulated, suggesting that KCS plays a positive regulatory role in disease resistance. Overexpression of HvKCS1 in barley improved leaf wax and resistance to barley powdery mildew fungus. Overexpression of KCS3 in Arabidopsis significantly inhibited wax synthesis, and KCS12 overexpression lines exhibited floral organ fusion due to abnormal cuticle biosynthesis. Furthermore, compared to single mutants, double mutants showed… kcs3 kcs12 The wax and cutin content increased significantly. Although KCS regulation has been applied to some aspects of plant disease resistance, there are no related research reports in the field of citrus canker.

[0006] In view of the above, this application is hereby submitted. Summary of the Invention

[0007] This invention aims to improve the resistance of citrus to citrus canker by providing a method for enhancing the resistance of citrus to citrus canker using the citrus CsKCS6 gene. The citrus CsKCS6 gene was cloned for the first time, and by transferring the citrus CsKCS6 gene into citrus through the VIGS vector, the transcription level of the citrus CsKCS6 gene was reduced, which significantly improved the resistance of citrus to citrus canker, reduced the severity of citrus canker, and did not affect the phenotype of the transgenic plants.

[0008] This invention is achieved through the following technical solution: This invention provides a method for enhancing the resistance of citrus canker by silencing the citrus CsKCS6 gene, wherein the nucleotide sequence of the citrus CsKCS6 gene is shown in SEQ ID NO: 1.

[0009] In one specific implementation, the method for silencing the citrus CsKCS6 gene is to reduce the transcription level of the citrus CsKCS6 gene and improve the resistance of citrus plants to citrus canker.

[0010] In one specific implementation, VIGS silencing was used to reduce the transcriptional level of the CsKCS6 gene in citrus.

[0011] In a specific embodiment, the method for improving citrus canker resistance of citrus CsKCS6 gene comprises the following steps: (1) cloning a VIGS fragment of citrus CsKCS6 gene; (2) constructing a VIGS expression vector of CsKCS6 gene; (3) transforming the VIGS expression vector into citrus to obtain a VIGS plant in which the citrus CsKCS6 gene is silenced.

[0012] In a specific embodiment, in step (1), the cloning method of the VIGS fragment of the citrus CsKCS6 gene is as follows: total RNA of citrus is extracted, reverse transcribed into cDNA, and the VIGS fragment of the citrus CsKCS6 gene is amplified by PCR using the cDNA as a template and a high-fidelity enzyme.

[0013] In a specific embodiment, the nucleotide sequence of the VIGS fragment of the citrus CsKCS6 gene is shown in SEQ ID NO: 2.

[0014] In a specific embodiment, in step (1), the primers used for PCR amplification are CsKCS6-VIGS-F and CsKCS6-VIGS-R, wherein the nucleotide sequence of CsKCS6-VIGS-F is SEQ ID NO: 3, and the nucleotide sequence of CsKCS6-VIGS-R is SEQ ID NO: 4.

[0015] In a specific embodiment, in step (2), the construction method of the VIGS gene fragment expression vector is as follows: the PCR product, the VIGS fragment of the citrus CsKCS6 gene obtained in step (1), is digested by Xba I and Sma I, recovered, and then connected with a TRV2 vector digested by the same enzymes and transformed into E. coli competent cells, and a plasmid is extracted to obtain the VIGS expression vector of the CsKCS6 gene.

[0016] In a specific embodiment, in step (3), the method for transforming the VIGS expression vector into citrus is as follows: the VIGS expression vector obtained in step (2) is transformed into Agrobacterium to prepare an Agrobacterium bacterial solution containing the VIGS expression vector, the citrus sterile seedlings are infected, and the VIGS plant in which the citrus CsKCS6 gene is silenced is obtained after fluorescence observation, PCR and qRT-PCR verification.

[0017] In a specific embodiment, after obtaining the VIGS plant in step (3), the VIGS plant is evaluated for citrus canker resistance to determine whether silencing of the citrus CsKCS6 gene can enhance the citrus canker resistance.

[0018] Compared with the prior art, the present application has the following advantages and beneficial effects: 1. The method for enhancing the citrus canker resistance of citrus by the citrus CsKCS6 gene provided in the embodiment of the present application, the VIGS vector of the citrus CsKCS6 gene is constructed, the citrus is transformed by the agrobacterium, and the obtained citrus plant can obviously resist the canker, the lesion area is reduced by 24.9%-35.5%, the disease index is reduced by 26.4%-38%, and the disease degree of the canker is significantly reduced; 2. The method for enhancing the citrus canker resistance of citrus by the citrus CsKCS6 gene provided in the embodiment of the present application, the VIGS silencing of the citrus CsKCS6 gene can significantly reduce the disease degree of the canker, and the VIGS silencing of the citrus CsKCS6 gene does not affect the phenotype of the citrus plant; 3. The method for enhancing the citrus canker resistance of citrus by the citrus CsKCS6 gene provided in the embodiment of the present application, the citrus CsKCS6 gene can also be used as a candidate gene to be used in the canker resistance breeding by the VIGS silencing, RNA interference and gene editing technologies, and has great application value in the canker resistance breeding of citrus. BRIEF DESCRIPTION OF DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the example embodiments of the present application, the following will briefly introduce the drawings needed to be used in the embodiments, and it should be understood that the following drawings only show some embodiments of the present application, and therefore should not be regarded as a limitation on the scope, and other related drawings can also be obtained by those skilled in the art without paying creative labor on the premise of not paying creative labor. In the drawings: Figure 1 The bioinformatics feature map of the citrus CsKCS6 in the embodiment of the present application: A is the chromosome localization of the citrus CsKCS6 gene; B is the gene structure of the citrus CsKCS6; C is the conserved domain of the citrus CsKCS6; Figure 2 The PCR amplification electrophoretogram of the VIGS fragment of the CsKCS6 coding gene in the embodiment of the present application: VIGS represents the RNAi fragment of the CsKCS6 coding gene; M represents the DNA molecular weight marker, and the same below; Figure 3 The VIGS vector structure diagram of the CsKCS6 in the present application: GFP represents the green fluorescent protein; RdRp represents the NA-dependent RNA polymerase; CP represents the coat protein; 35S represents the plant constitutive promoter derived from the cauliflower mosaic virus; NOS represents the nopaline synthase gene terminator; LB represents the left homologous arm; and RB represents the right homologous arm; Figure 4PCR identification map of transgenic plant of the present application. VIGS plant PCR detection map: + represents positive control; - represents negative control; M represents molecular weight marker, left map is identification result of primer pair CsKCS6-ID1-F / CsKCS6-ID1-R1, middle map is identification result of primer pair CsKCS6-ID2-F / CsKCS6-ID2-R, right map is identification result of primer pair CsKCS6-ID2-F / CsKCS6-VIGS-R; Figure 5 qRT-PCR detection map of CsKCS6 expression in VIGS plant of the present application: * indicates significant difference (P<0.05) (same below); TRV2 indicates plant of empty vector (same below); TRV2-KCS6 indicates plant of CsKCS6-transferred VIGS vector (same below); P Figure 6 Phenotype map of VIGS plant of the present application: WT indicates non-transgenic plant; Figure 7 Disease incidence of VIGS plant leaf of the present application after inoculation with Xanthomonas campestris for 10 days; Figure 8 Statistical diagram of lesion size of VIGS plant leaf of the present application after inoculation with Xanthomonas campestris for 10 days; Figure 9 Statistical diagram of disease index of VIGS plant leaf of the present application after inoculation with Xanthomonas campestris for 10 days. DETAILED DESCRIPTION

[0020] In order to make the objects, technical solutions and advantages of the present application clearer, further detailed description will be made to the present application in combination with embodiments and drawings, and the schematic embodiments of the present application and the description thereof are only used for explaining the present application, and not as limitation to the present application.

[0021] In the following description, a large number of specific details are set forth in order to provide a thorough understanding of the present application. However, it will be apparent to one of ordinary skill in the art that the present application can be practiced without these specific details. In other instances, well-known structures, materials or methods have not been described in detail in order to avoid obscuring the present application.

[0022] Example 1 Bioinformatics analysis of citrus CsKCS6 gene As shown in the following table, the citrus CsKCS6 gene is located between 23,216,813 bp and 23,219,782 bp of chromosome 7 of citrus, contains 1 exon, encodes 497 amino acids, and contains a 3-ketoacyl-CoA synthase functional domain. Figure 1

[0023] ​​The nucleotide sequence of the CsKCS6 gene, SEQ ID NO: 1, is as follows (ATG to stop codon): Example 2 Cloning of VIGS fragment of citrus CsKCS6 gene 1. RNA extraction and cDNA synthesisTotal RNA was extracted from citrus (latekumquat) leaves using a plant total RNA extraction kit (Aidlab, CAT: RN09), and the quality of the RNA was verified by agarose gel electrophoresis, and the concentration was measured by a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A), and the cDNA was stored at -20°C for later use.

[0024] 2. VIGS fragment PCR amplification As shown in Table 1, the VIGS fragment of the CsKCS6 gene was cloned from the cDNA of citrus using the primers CsKCS6-VIGS-F (SEQ ID NO: 3) and CsKCS6-VIGS-R (SEQ ID NO: 4) and using the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q), and the length of the VIGS fragment was 326 bp (SEQ ID NO: 2). Under the ultraviolet lamp, the agarose gel block containing the target fragment was cut off with a clean blade, and the DNA fragment was recovered using a kit (BioFlux, CAT: BSC02M1). Figure 2 PCR amplification procedure: 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; 72°C extension for 10 min.

[0025] The nucleotide sequence of the VIGS fragment of the citrus CsKCS6 gene SEQ ID NO: 2 is shown below:

[0026] ​GAGGCGAGGCCGAGCTCGTAATCTTCTCCGCCATGGATTCTCTGTTACAAAAGACAGGACTTAAACCTAAAGACATCGATATTCTTATCGTGAATTGCAGCTTGTTCTCGCCGACGCCGTCGCTATCGGCCATGTTGATTAACCAGTACAAGCTGAGGAGTAA CATCAAGAGCTTCAATCTTTCGGGTATGGGCTGCAGTGCCGGGCTTATATCCATCGACTTAGCTCGGGATCTTCTACAAGTGCATCCGAATTCAAACGCTGTCGTTGTGAGCACGGAGATCATTACACCGAACTACTACCAAGGGAATGAACGAGCCATGCTC The nucleotide sequence of primer CsKCS6-VIGS-F, SEQ ID NO: 3 (containing restriction enzyme sites), is shown below: TCTAGAGAGGCGAGGCCGAGCTCG The nucleotide sequence of primer CsKCS6-VIGS-R, SEQ ID NO: 4 (containing restriction enzyme sites), is shown below: CCCGGGGAGCATGGCTCGTTCATTCCCT Example 3 Constructing a VIGS expression vector for the CsKCS6 gene like Figure 3 As shown, the VIGS fragments of the TRV2 and CsKCS6 genes in the VIGS vector were digested with Xba I and Sma I, recovered by gel electrophoresis, and then the two fragments were ligated and transformed into competent E. coli cells. Plasmids were extracted to obtain the VIGS expression vector TRV2-CsKCS6. In the diagram, GFP represents green fluorescent protein; RdRpA represents RNA polymerase-dependent protein; CP represents coat protein; 35S represents a plant constitutive promoter derived from cauliflower mosaic virus; NOS represents the terminator of the crown gall synthase gene; LB represents the left homologous arm; and RB represents the right homologous arm. The TRV2-CsKCS6 vector was transformed into Agrobacterium using electroporation to prepare Agrobacterium bacterial culture containing the CsKCS6 gene VIGS expression vector.

[0027] Example 4 VIGS expression vector was transformed into citrus to obtain VIGS plants in which the citrus CsKCS6 gene was silenced. 1. Activation of Agrobacterium tumefaciens Take 500 μL of Agrobacterium tumefaciens culture of TRV1, TRV2, and TRV2-KCS6 respectively and add them to 50 mL of liquid LB medium (containing kanamycin: 50 mg / L). Incubate at 28℃ and 200 r / min until OD. 600 = 1; Collect bacterial cells, resuspend in MMA (10 mM MgCl2, 10 nM MES, 100 μM acetylsuccinone) solution, and adjust OD. 600 = 1; Mix TRV1 with TRV2 and TRV2-KCS6 vectors at a volume ratio of 1:1 and incubate at room temperature for 3 h.

[0028] 2. Agrobacterium infection Sterile seedlings with radicles reaching 3 cm in length were immersed in Agrobacterium tumefaciens solution and vacuumed for 1 minute. They were then rinsed 3-5 times with sterile water and cultured in seed culture medium at room temperature in the dark for 2-3 days. If green fluorescence was observed, the seedlings were considered positive. They were then transferred to soil for further cultivation at 25°C under light / dark conditions for 16 h / 8 h, with regular watering.

[0029] Example 5 Identification and phenotypic observation of VIGS plants 1. PCR identification Seedlings showing green fluorescence under ultraviolet light were considered positive. These seedlings were then transferred to nutrient soil culture medium. One month later, tissue samples were collected for DNA and total RNA extraction. PCR verification was performed using two primer pairs: CsKCS6-ID1-F (SEQ ID NO: 5) / CsKCS6-ID1-R (SEQ ID NO: 6), CsKCS6-ID2-F (SEQ ID NO: 7) / CsKCS6-ID2-R (SEQ ID NO: 8), and CsKCS6-ID2-F (SEQ ID NO: 7) / CsKCS6-VIGS-R (SEQ ID NO: 4). Figure 4 As shown, primer pair CsKCS6-ID1-F / R can amplify a 150 bp band in TRV2 and TRV2-CsKCS6 plants; primer pair CsKCS6-ID2-F / R can amplify 255 bp and 526 bp bands in TRV2 and TRV2-CsKCS6 plants, respectively; primer pair CsKCS6-ID2-F / CsKCS6-VIGS-R does not amplify a band in TRV2 plants, but amplifies a 505 bp band in TRV2-CsKCS6 plants.

[0030] PCR reaction conditions: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 10 min.

[0031] The nucleotide sequence of primer CsKCS6-ID1-F, SEQ ID NO: 5, is shown below: TTGGGTTGCTACTGATTCGACT The nucleotide sequence of primer CsKCS6-ID1-R, SEQ ID NO: 6, is shown below: CTGTAAGGACCATCATACTTCGC The nucleotide sequence SEQ ID NO: 7 of primer CsKCS6-ID2-F is shown below: CAAAGATGGACATTGTTACTCAAGGAAG The nucleotide sequence of primer CsKCS6-ID2-R, SEQ ID NO: 8, is shown below: CGATCAATCAAGATCAGTCGAGAATG 2. qRT-PCR analysis like Figure 5 As shown, qRT-PCR was performed using primers CsKCS6-RT-F (SEQ ID NO: 9) and CsKCS6-RT-R (SEQ ID NO: 10) to verify whether CsKCS6 was successfully silenced. The gene expression level of plants transfected with empty TRV1 and TRV2 vectors was set to 1. If the CsKCS6 gene expression level in plants containing the target fragment vector was less than 1, gene silencing occurred. Identification showed that the CsKCS6 transcription level decreased by 41.14%.

[0032] qRT-PCR reaction conditions: 95℃ for 3 min, 94℃ for 10 s; 56℃ for 10 s, 72℃ for 10 s, 40 cycles; 72℃ for 10 min.

[0033] The nucleotide sequence of primer CsKCS6-RT-F, SEQ ID NO: 9, is shown below (designed within CDS): TGACACTCATCGGTCGCAAA The nucleotide sequence of primer CsKCS6-RT-R, SEQ ID NO: 10, is shown below (designed within CDS): TCAATCACCGCTCTTCCACC 3. Phenotypic observation like Figure 6 As shown, observation of the phenotypes of various VIGS plants with the CsKCS6 gene revealed no obvious abnormalities in appearance or growth. This indicates that silencing CsKCS6 did not significantly affect the plant's phenotype or development.

[0034] Example 6 Resistance evaluation of VIGS plants The mature leaves of transgenic plants were washed, disinfected with 75% alcohol and washed with sterile water, and placed on a clean bench. The leaves were pricked with a needle, and 1 μL (1 X 10 5 CFU / mL) of X. axonopodis pv. citri bacterial solution was spotted on each pricked hole using a pipette. The leaves were cultured in a constant temperature and light incubator (16 h light / 8 h dark) at 28°C. After 10 days of culture, the leaves were photographed, and the lesion area was calculated using Image J V1.47 software.

[0035] The disease was classified as 0-7 levels according to the lesion area, and the lesion area was represented by the letter R. Level 0 (R≤0.25 mm 2 ), level 1 (0.25 mm 2 <R≤0.5 mm 2 ), level 2 (0.5 mm 2 <R≤0.75 mm 2 ), level 3 (0.75 mm 2 <R≤1 mm 2 ), level 4 (1.0 mm 2 <R≤1.25 mm 2 ), level 5 (1.25 mm 2 <R≤1.5 mm 2 ), level 6 (1.5 mm 2 <R≤ 1.75 mm 2 ), and level 7 (R>1.75 mm 2 ). The disease index was calculated according to the formula: DI = 100 X Σ

number of lesions at each level X corresponding level value

[0036] The results are shown in Figure 7 , where TRV2 is the control group, and TRV2-CsKCS6-1, TRV2-CsKCS6-2 and TRV2-CsKCS6-3 are the experimental groups. After 10 days of inoculation with X. axonopodis pv. citri, the symptoms of CsKCS6-silenced VIGS plants were significantly reduced. As shown in Figure 8 , the lesion area was reduced by 24.9%-35.5%; as shown in Figure 9 , the disease index was reduced by 26.4%-38%. Therefore, CsKCS6 gene silencing can enhance the resistance of citrus to X. axonopodis pv. citri.

[0037] In summary, the citrus canker disease spot area can be greatly reduced by silencing CsKCS6, and the disease degree of the canker disease is reduced. The CsKCS6 gene provided by the application can be silenced by various technologies, and is used for anti-canker disease molecular breeding, and can be used together with other disease-resistant or disease-susceptible genes to synergistically perform citrus anti-canker disease molecular breeding, and has great application value in citrus anti-canker disease breeding.

[0038] The above specific embodiments further illustrate the purposes, technical solutions and beneficial effects of the application. It should be understood that the above description is only a specific embodiment of the application and is not used to limit the protection scope of the application. Any modification, equivalent replacement, improvement, etc. within the spirit and principle of the application should be included in the protection scope of the application.

Claims

1. A method for enhancing citrus canker resistance using the CsKCS6 gene, characterized in that, The citrus CsKCS6 gene was silenced, and the nucleotide sequence of the citrus CsKCS6 gene is shown in SEQ ID NO:

1.

2. The method for enhancing citrus canker resistance using the citrus CsKCS6 gene according to claim 1, characterized in that, The specific method for silencing the citrus CsKCS6 gene is to reduce the transcription level of the citrus CsKCS6 gene and improve the resistance of citrus plants to citrus canker.

3. The method for improving resistance to citrus canker by the citrus CsKCS6 gene according to claim 2, wherein VIGS silencing is used to reduce the transcription level of the CsKCS6 gene in citrus.

4. The method for improving citrus canker resistance using the citrus CsKCS6 gene according to claim 1, characterized in that, Includes the following steps: (1) Cloning the VIGS fragment of the citrus CsKCS6 gene; (2) Construct the VIGS expression vector of the CsKCS6 gene; (3) The VIGS expression vector was transformed into citrus to obtain VIGS plants in which the citrus CsKCS6 gene was silenced.

5. The method for enhancing citrus canker resistance using the citrus CsKCS6 gene according to claim 4, characterized in that, In step (1), the cloning method of the VIGS fragment of the citrus CsKCS6 gene is as follows: extract total RNA from citrus, reverse transcribe it into cDNA, and use the cDNA as a template to amplify the VIGS fragment of the citrus CsKCS6 gene by high-fidelity enzyme PCR.

6. The method for enhancing citrus canker resistance using the citrus CsKCS6 gene according to claim 5, characterized in that, The nucleotide sequence of the VIGS fragment of the citrus CsKCS6 gene is shown in SEQ ID NO:

2.

7. The method for improving citrus canker resistance using the citrus CsKCS6 gene according to claim 4, characterized in that, In step (1), the primers used for PCR amplification are CsKCS6-VIGS-F and CsKCS6-VIGS-R, where the nucleotide sequence of CsKCS6-VIGS-F is SEQ ID NO: 3 and the nucleotide sequence of CsKCS6-VIGS-R is SEQ ID NO:

4.

8. The method for improving citrus canker resistance using the citrus CsKCS6 gene according to claim 4, characterized in that, In step (2), the VIGS gene fragment expression vector is constructed as follows: the VIGS fragment of the PCR product citrus CsKCS6 gene obtained in step (1) is digested with Xba I and Sma I enzymes, recovered and ligated with the TRV2 vector digested with the same enzymes and transformed into competent Escherichia coli cells. The plasmid is extracted to obtain the VIGS expression vector of the CsKCS6 gene.

9. The method for improving citrus canker resistance using the citrus CsKCS6 gene according to claim 4, characterized in that, In step (3), the method of transforming citrus with VIGS expression vector is as follows: transforming the VIGS expression vector obtained in step (2) into Agrobacterium, preparing Agrobacterium bacterial solution containing VIGS expression vector, infecting sterile citrus seedlings, and obtaining VIGS plants with silenced CsKCS6 gene in citrus after fluorescence observation, PCR and qRT-PCR verification.

10. The method for improving citrus canker resistance using the citrus CsKCS6 gene according to claim 4, characterized in that, After obtaining VIGS plants in step (3), the resistance of VIGS plants to citrus canker was evaluated, and it was determined that silencing the citrus CsKCS6 gene could enhance the resistance to citrus canker.