Application of rice gene OsbZIP21 in regulation and control of cold resistance

By knocking out the expression or activity of the rice gene OsbZIP21, gene editing technology was used to improve the cold tolerance of rice, solving the problems of growth adaptability and yield of rice in low-temperature environments, and achieving higher growth adaptability and resistance.

CN120888596APending Publication Date: 2025-11-04NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202511233746.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-29
Publication Date
2025-11-04

AI Technical Summary

Technical Problem

There is a lack of effective means in the current technology to improve the adaptability and cold resistance of rice to low temperature stress, which affects its growth, development and yield.

Method used

By knocking out or inhibiting the expression or activity of the rice gene OsbZIP21, gene knockout vectors can be constructed using gene editing technology to improve the cold resistance of rice.

Benefits of technology

It significantly enhances the growth adaptability and resistance of rice in low-temperature environments, reduces mortality, and improves yield stability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120888596A_ABST
    Figure CN120888596A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of rice gene engineering, in particular to application of a rice gene OsbZIP21 in regulation and control of cold resistance. The invention discloses an application of a rice gene OsbZIP21 in regulation and control of cold resistance. The nucleotide sequence of the OsbZIP21 gene is as shown in a sequence table SEQ ID NO: 1, and the coded amino acid sequence is as shown in a sequence table SEQ ID NO: 2. According to the invention, the rice OsbZIP21 gene is edited by adopting a CRISPR / Cas9 gene editing technology, the expression of the encoding protein of the rice OsbZIP21 gene is silenced, and two forms of cold-resistant rice mutants are obtained. Experimental results show that under the condition of cold stress, the survival rate of the two obtained rice mutants is obviously higher than that of wild rice mutants, and it is indicated that the OsbZIP21 gene plays an important role in regulation of the cold tolerance of rice. The invention provides new resources and technical means for cold-resistant breeding of rice and other plants.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant transgenic technology and the field of crop genetic breeding, and in particular to the application of rice gene OsbZIP21 in regulating cold tolerance. BACKGROUND

[0002] Temperature is one of the key environmental factors affecting plant growth and development. In recent years, the number of global extreme climate events has increased, and low temperature stress has become an important factor restricting agricultural production. Rice, as one of the world's major food crops, is highly sensitive to environmental conditions, especially low temperature. Low temperature can significantly inhibit its growth and development and reduce yield. Therefore, improving the adaptability of rice to low temperature stress and enhancing cold tolerance have become the focus of current rice genetic improvement and breeding research. Plants will undergo significant morphological and physiological and biochemical changes under low temperature conditions, and the molecular basis is mainly driven by the transcriptional regulatory network. Transcription factors (TFs) recognize and bind to cis-acting elements in the promoter of target genes, or interact with other TFs / regulatory proteins, thereby activating or inhibiting the transcriptional activity of RNA polymerase, precisely regulating specific physiological and metabolic processes, and determining the strength and outcome of low temperature response.

[0003] Basic leucine zipper (bZIP) transcription factors are widely present in plants and play a core role in stress response and secondary metabolism regulation, including the regulation of terpenoid, alkaloid, flavonoid and other metabolic pathways; and are involved in seed maturation and dormancy, individual development and aging, and other biological processes. In the non-biological stress (salt, drought, low temperature, osmotic and mechanical damage) and salicylic acid, jasmonic acid and ABA hormone signaling pathways, bZIPs have key functions. With further research, bZIP family has been systematically identified at the whole genome level in Arabidopsis, rice, soybean, sorghum, grape and other species; a variety of low temperature-induced bZIP genes (such as maize mlip15, rice LIP19 / ABI5 homologous genes, tomato LebZIP1, etc.) have been confirmed to be related to cold resistance.

[0004] In rice, the bZIP family contains at least 89 genes, of which OsbZIP73 and OsbZIP71 mediate cold stress response by forming heterodimers. Related research shows that the co-expression of the two can not only significantly increase the grain filling rate and seed setting rate, but also enhance cold resistance through a "double-pathway": on the one hand, it reduces the ABA content in anthers, and on the other hand, it promotes the transport of sugar to pollen, thereby improving pollen fertility and increasing yield. In contrast, although OsbZIP52 (RISBZ5) is strongly induced under low temperature, its overexpression increases cold sensitivity, suggesting that it has regulatory characteristics. The above evidence collectively shows that exploiting and utilizing the fine functional differences of bZIP family members is an effective strategy to improve rice cold tolerance.

[0005] Based on this, the application proposes to apply a new member of the bZIP family, OsbZIP21, in the improvement of rice cold tolerance. There is no report in the existing public literature that uses OsbZIP21 to improve the cold tolerance of crops. The application uses edited OsbZIP21 to enhance the tolerance of rice to low temperature, provides a new and operable target for rice molecular breeding, and has clear novelty and application value. With the increasing frequency of extreme low temperature events, the application is expected to be widely used in cold and high latitude / high altitude rice growing areas, and to provide strong technical support for ensuring food security and sustainable agricultural development. SUMMARY

[0006] The application identifies and verifies the OsbZIP21 gene closely related to rice cold tolerance. The gene is located on chromosome 2, and the MSU_Locus number is LOC_Os02g33560. The full-length of the genomic sequence is 5327 bp, the length of the coding region is 981 bp, and the length of the encoded protein is 326 amino acid residues. Through gene knockout, we verified the function of the OsbZIP21 gene under low temperature stress. After knocking out the gene, the cold tolerance of rice seedlings is significantly enhanced, and the mortality is reduced.

[0007] The technical solution adopted by the application to solve its technical problems is:

[0008] In a first aspect, the application protects the application of rice gene OsbZIP21 in regulating the cold tolerance of rice. The nucleotide sequence of the rice gene OsbZIP21 is shown in SEQ ID NO. 1.

[0009] In a specific embodiment, knocking out the rice gene OsbZIP21 can improve the cold tolerance of rice.

[0010] In a second aspect, the application also protects the application of the protein encoded by the rice gene OsbZIP21 in regulating the cold tolerance of rice. The amino acid sequence of the protein encoded by the rice gene OsbZIP21 is shown in SEQ ID NO. 2.

[0011] The above protein is named OsbZIP21.

[0012] In a specific embodiment, knocking out the rice gene OsbZIP21 leads to the non-expression or inactivation of the protein encoded by the gene, which can improve the cold tolerance of rice.

[0013] In a third aspect, the application also protects the gene knockout vector for the rice gene OsbZIP21 shown in SEQ ID NO. 1.

[0014] In specific embodiments, the gene knockout vector is obtained by cloning the target sequence of gene OsbZIP21 into a TKC vector, wherein the target sequence of gene OsbZIP21 is obtained by annealing the primers shown in SEQ ID NO. 3 and SEQ ID NO. 4.

[0015] Preferably, the OsbZIP21 gene knockout vector of the target sequence is obtained by performing enzyme digestion and ligation reaction on the obtained target sequence and the vector, and then transforming into E. coli and verifying by screening and sequencing.

[0016] In a fourth aspect, the application also protects the use of the gene knockout vector described above in improving the cold tolerance of rice.

[0017] In a fifth aspect, the application also protects the use of the gene knockout vector described above in constructing a rice variety with improved cold tolerance.

[0018] In a sixth aspect, the application also protects a method for breeding cold-tolerant rice by inhibiting or reducing or silencing the expression amount of the rice gene OsbZIP21 described in claim 1, or by inhibiting or reducing or silencing the activity and / or content of the protein described in claim 3, to obtain cold-tolerant rice.

[0019] The vectors described herein are well known to those skilled in the art, including but not limited to: plasmids, bacteriophages (such as lambda phage or M13 filamentous phage, etc.), cosmids (i.e., cosmids), Ti plasmids or viral vectors. Specifically, it can be a TKC vector.

[0020] Compared with the prior art, the application has the following beneficial effects:

[0021] The application provides a strategy for improving the cold tolerance of rice by regulating the expression of OsbZIP21 gene, which can effectively improve the growth adaptability of rice in cold environments and provide a new idea for rice breeding. In addition, the cold-tolerant gene and its application technology provided by the application not only can enhance the resistance of rice under low temperature conditions, but also provide a reference for the improvement of cold tolerance of other crops. With the increasingly severe low temperature environment caused by global climate change, this technology has a wide application prospect and can help agricultural production better cope with the challenges brought by cold weather. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 TKC vector map for CRISPR-Cas9

[0023] Figure 2 CRISPR-Cas9 knockout target and mutation site map

[0024] Figure 3Schematic diagram of cold tolerance identification of wild-type (WT) and mutant (bzip21-1, bzip21-2) plants.

[0025] Figure 4 Phenotypic quantification data of various materials related to the OsbZIP21 gene under cold treatment Detailed Implementation

[0026] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0027] Example 1: Cloning of the rice cold tolerance gene OsbZIP21

[0028] (1) Rice RNA extraction

[0029] 0.2 g of young rice leaves were used to extract total RNA using the Trizol method. The purity of RNA was assessed by measuring its concentration and A260 / A280 ratio; the integrity of RNA was verified by agarose gel electrophoresis.

[0030] (2) Obtaining rice cDNA by reverse transcription

[0031] Residual genomic DNA was removed from the RNA and cDNA was obtained by reverse transcription, following the instructions of TaKaRa's PrimeScript™ RTreagent Kit with gDNAeraser (Perfect Real Time).

[0032] The reaction conditions were: incubation at 42°C for 30 min in a PCR instrument, followed by heating at 85°C for 5 sec to inactivate Prime Script RTEnzyme Mix and gDNAEraser.

[0033] (3) Obtaining the OsbZIP21 gene

[0034] Primers were designed using Primer3 Plus software, controlling the GC content between 40% and 60%. Cloning primers OsbZIP21-F and OsbZIP21-R were designed for PCR amplification to obtain the full-length coding region of OsbZIP21. The primer sequences were: OsbZIP21-F: 5'ATGTCTCGGTCGCCGCACCT 3'; OsbZIP21-R: 5'TCACATGCCGTAGCCGCCTC 3'. The success of the amplification was verified using 1% agarose gel electrophoresis. Finally, sequencing results showed that the OsbZIP21 coding region sequence is consistent with the OsbZIP21 coding region sequence annotated in the rice genome data.

[0035] Example 2: Construction of OsbZIP21 gene knockout expression vector

[0036] The CRISPR website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR / CRISPR) was used to screen for highly specific exon sequences of the OsbZIP21 gene as targets. The target sequences were then cloned into a TKC vector (see vector map). Figure 1 In A), the TKC vector is disclosed in the following literature: He Y, Zhu M, Wang L, Wu J, Wang Q, Wang R, Zhao Y. Programmed Self-Elimination of the CRISPR / Cas9 Construct Greatly Accelerates the Isolation of Edited and Transgene-Free RicePlants. Mol Plant, 2018, 11(9): 1210-1213. The OsbZIP21 knockout vector was obtained by sequencing. The process is as follows:

[0037] (1) Primers were synthesized based on the target sequence. The sequence information is as follows:

[0038] Primer1: SEQ ID NO.3: 5'GATAGCATCAGAATCGCTGCAGG 3';

[0039] Primer2: SEQ ID NO.4: 5'CCTGCAGCGATTCTGATGCTATC 3'.

[0040] (2) Dissolve the above primer sequences in 1×TE to prepare a 100μM stock solution. Use primer1 and primer2 as the front and back primers respectively, and add 1μL of each to 98μL of 0.5×TE solution to mix and dilute to 1μM.

[0041] (3) Hold at 95℃ for 3 minutes, then move to room temperature to cool and complete the annealing.

[0042] (4) The enzyme digestion and ligation system (Thermo Scientific) is as follows:

[0043]

[0044]

[0045] The reaction program was as follows: incubation at 37℃ for 5 min, followed by incubation at 20℃ for 5 min. These two conditions were maintained for 10 cycles. The amplification reaction was performed using a BIO-RAD T100 thermal cycler. The product was transformed into *E. coli* DH5α competent cells (Beijing Tiangen CB101), and positive clones were selected for sequencing. Sequencing results showed that the obtained fragment was an OsbZIP21 knockout vector containing the target sequence, named pTKC-OsbZIP21.

[0046] Example 3: Genetic transformation of rice

[0047] All rice transformations were performed using Agrobacterium-mediated genetic transformation (Agb. EHA105). The specific steps of the Agrobacterium-mediated genetic transformation method are as follows:

[0048] (1) Obtaining recombinant Agrobacterium

[0049] The Agrobacterium tumefaciens strain EHA105 (purchased from Ingenium Biotech, USA) was transformed using the freeze-thaw method and named pTKC-OsbZIP21 to obtain a recombinant strain. Plasmids were extracted and identified by PCR. The correctly identified recombinant strain was named EH-pTKC-OsbZIP21.

[0050] (2) Transformation of Agrobacterium

[0051] Seed treatment: Select mature and plump rice seeds, remove the husks, disinfect with 75% alcohol for 1-2 minutes, and discard the alcohol; add 0.15% mercuric chloride (containing 0.1% Tween 20) for 10 minutes and then discard the mercuric chloride; rinse 6 times with sterile distilled water. Inoculate the seeds into callus induction medium and culture at 28℃ under light for 20 days.

[0052] Agrobacterium preparation: Agrobacterium EHA105 transformed with pTKC-OsbZIP21 vector was streaked onto LB agar plates containing 20 mg / L Rif and 50 mg / L Kan, and incubated at 28°C for 2 days; single colonies were picked and cultured in LB liquid medium at 28°C and 200 rpm for 2 days; before infection, the bacterial culture was scraped into suspension medium and shaken at 28°C and 180 rpm for 3-3.5 hours, and adjusted to OD600 = 0.1-0.15.

[0053] Callus infection: Rice callus with a diameter of 2-4 mm was immersed in bacterial solution for 20 min, the surface bacterial solution was blotted dry and covered with sterile filter paper, dried in a clean bench for 30 min, and then transferred to co-culture medium covered with sterile filter paper. It was incubated in the dark at 20℃ overnight, and then incubated in the dark at 25℃ for 2 days.

[0054] Cleaning and screening: After co-culturing, the callus was washed 7-8 times with sterile distilled water, and finally soaked in sterile water containing 500 mg / L carbenicillin for 30 min. The solution was discarded, and the surface moisture was blotted dry. The callus was then dried in a clean bench for 1 h. The cleaned callus was placed in a screening medium containing hygromycin and cultured at 32°C under light for 14 days.

[0055] (3) Differentiation and regeneration of callus tissue

[0056] After 14 days of selection, the resistant callus was transferred to differentiation medium and cultured at 28°C (photoperiod of 14h light / 10h dark). Once the resistant callus formed 3-4cm tall regenerated seedlings on the differentiation medium, it was transferred to rooting medium and cultured until complete transgenic rice plants were formed. Hygromycin can be used to screen homozygous transgenic plants from the self-pollinated progeny of the transgenic rice.

[0057] Example 4: Cold tolerance assessment of wild-type and OsbZIP21 gene mutant plants

[0058] Wild-type and OsbZIP21 mutant rice seeds were disinfected in a 2.5% sodium hypochlorite solution for 20 minutes (do not over-sterilize), followed by rinsing five times with sterile deionized water. After rinsing, the seeds were evenly spread on filter paper, an appropriate amount of sterile water was added, and the seeds were placed in an incubator at 28°C for germination. Three days later, the germinated seeds were transferred to 96-well hydroponic boxes, with 40 seeds of each variety (wild-type, OsbZIP21 mutants: osbzip21-1 and osbzip21-2) planted, and three biological replicates were set up. The growth conditions were: 13 hours of light, 11 hours of darkness, light intensity of 40,000 LUX, temperature of 28°C during light, temperature of 25°C during darkness, and relative humidity of 75%.

[0059] Two weeks after the seedlings reached maturity, they were transferred to an artificial climate chamber for cold tolerance assessment. The cold treatment conditions were: 13 hours of light followed by 11 hours of darkness, light intensity of 40,000 LUX, temperature of 4°C during light exposure and 4°C during darkness, and relative humidity of 70%. After 5 days of cold treatment, the seedlings were removed and restored to normal growth conditions: 13 hours of light followed by 11 hours of darkness, light intensity of 40,000 LUX, temperature of 28°C during light exposure and 25°C during darkness, and relative humidity of 70%. After 7 days of recovery, the survival rate was calculated by the ratio of surviving seedlings to the total number of seedlings, and the ion leakage rate was measured.

[0060] Studies have shown that under normal growth conditions, the mutants osbzip21-1 and osbzip21-2 exhibit growth characteristics largely consistent with wild-type rice. Figure 3 A, C). However, after 5 days of cold treatment, the mutant showed significantly better growth performance than the wild type ( Figure 3 (B, D). After 5 days of cold stress, the survival rates of bzip21-1 and bzip21-2 were 59.65% and 76.38%, respectively, significantly higher than the wild-type's 41.58% and 40.36%. Furthermore, Figure 4 Further AD analysis showed that the ion leakage rates of mutants bzip21-1 and bzip21-2 were 40.25% and 33.66%, respectively, significantly lower than the wild-type's 64.36% and 61.16%. These results indicate that the OsbZIP21 gene plays a crucial role in regulating cold tolerance in rice.

[0061] The cold-resistant gene and its application technology provided by this invention can significantly enhance the adaptability and resistance of rice to low-temperature environments, and are expected to improve rice yield and stability in the context of global climate change. Through gene editing technology, precision breeding can be achieved, thereby reducing reliance on traditional breeding methods and improving the sustainability of rice production. This innovative approach not only enhances rice's ability to cope with cold environments but also provides a more feasible solution for future agricultural production.

[0062] The present invention has been described in detail above with general descriptions and specific embodiments. However, modifications or improvements can be made to the present invention, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed by the present invention.

[0063] Serial Number

[0064] SEQ ID NO: 1

[0065] CDS

[0066] >LOC_Os02g33560

[0067] ATGTCTCGGTCGCCGCACCTCCCTCCCCGCTGCCCGCCGCTGGGTCCTCAGATCACAAGGAGGGACGACAGCTTGTTCACGCAGAGCTGCAGGTTTCCGTCGGAGGATCCATTCGTCGGTGAGCCGCCGTGCTGGCTCGATGATCTCCTCGCGGACTCCGGGAAGAGCCACACCCTTCCTCCTCTCAGGAGAGCCTGCAGCGATTCTGATGCTATCTTGGATGTGCTGACGTCGTTCCAGAGCCCAATCTACCCTATCGATGAAGGGGATCCGCAGCCGGTTGGCGAAGCTGGGGAGTCGTTCAATGCTGCGGCTGAAGGGGGTGGAAGTGGTGCTGGCATCGAAGGTAGCTGTGTTTATGGACCAAATTCGCCGAGACAGAAGACTAGGCTGACCAGTTCAGAGAGTTCCATGGTTAACGCTGTCTTGGAGAATGTCCCTAGCAACCCATTGCAGTACCTGATGATTGATGCCACAAGTGGTGTGAACTGTAATGTTGGTGCAGCCAATGGAACTGGAGACACAGGTGATGCTGTATGCCACGCTGATCAAGAGAAGTCACTTAAAAGGCGCTCAGGCCAAAGATCAAGGGTCAGAAAACTTCAATACATTGCTGATCTTGAGAGAACTGTTGACTCACTTCAGAACATAGGGGCTGATTTGGCTGTGAGGGTGGCATCTCTTTTCCAGCTTCGTAATGCTCTATCAATGGAAAACAAGCAACTGAGGAGGCAGATCACTAGTCTTCAGCAGGCAAAACTAATTAAGGATGGCCAAACGCAGATGCTGAAGAAGGAAACCGAGAGGCTGAAGCAGCTCTCAGTGCGCCACCGCAGGAGCAGGAGCGTCACCTCTTGCTTTGAGGCCAACTCATTTGGAGGAGGAGACCCATCTGCGATCAACTGGCAGATGCTCGACATGTCAAAGCTCAGCTTGAACGGCGGCGCTGTTGTTCCTCCTAGAGGCGGCTACGGCATGTGA

[0068] SEQ ID NO:2

[0069] Protein

[0070] >LOC_Os02g33560

[0071] MSRSPHLPPRCPPLGPQITRRDDSLFTQSCRFPSEDPFVGEPPCWLDDLLADSGKSHTLPPLRRACSDSDAILDVLTSFQSPIYPIDEGDPQPVGEAGESFNAAAEGGGSGAGIEGSCVYGPNSPRQKTRLTSSESSMVNAVLENVPSNPLQYLMIDATSGVNCNVGAANGTGDTGDAVCHADQEKSLKRRSGQRSRVRKLQYIADLERTVDSLQNIGADLAVRVASLFQLRNALSMENKQLRRQITSLQQAKLIKDGQTQMLKKETERLKQLSVRHRRSRSVTSCFEANSFGGGDPSAINWQMLDMSKLSLNGGAVVPPRGGYGM*

Claims

1. The application of the rice gene OsbZIP21 in regulating cold tolerance in rice, characterized in that, The nucleotide sequence of the rice gene OsMATL2 is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, Knocking out the rice gene OsbZIP21 can improve the cold resistance of rice.

3. The application of the protein encoded by the rice gene OsbZIP21 in regulating cold tolerance in rice, characterized by: The amino acid sequence of the protein encoded by the rice gene OsbZIP21 is shown in SEQ ID NO.

2.

4. The application according to claim 3, characterized in that, Knocking out the rice gene OsbZIP21, causing its encoded protein to be unexpressed or inactivated, can improve the cold tolerance of rice.

5. Gene knockout vector targeting the rice gene OsbZIP21 shown in SEQ ID NO.

1.

6. The gene knockout vector according to claim 5, characterized in that, The gene knockout vector is obtained by cloning the target sequence of the gene OsbZIP21 into the TKC vector. The target sequence of the gene OsbZIP21 is obtained by annealing the primers shown in SEQ ID NO.3 and SEQ ID NO.

4.

7. The application of the gene knockout vector according to claim 5 or 6 in improving the cold resistance of rice.

8. The application of the gene knockout vector according to claim 5 or 6 in the construction of rice varieties with improved cold resistance.

9. A method for cultivating cold-resistant rice, characterized in that, Cold-resistant rice is obtained by inhibiting, reducing, or silencing the expression level of the rice gene OsbZIP21 as described in claim 1 in the target rice, or by inhibiting, reducing, or silencing the activity and / or content of the protein as described in claim 3.

Citation Information

Cited By

  • Application of bZIP transcription factor OsbZIP65 related to low temperature resistance of rice in cultivation of stress-tolerant plants

    CN121227787A