Application of soybean GmGLP5 gene in changing protein content

Abstract

The invention discloses an application of soybean GmGLP5 in changing protein content. The nucleotide sequence of the soybean Germin-Like Protein 5 protein coding gene GmGLP5 is shown as SEQ ID NO. 1, and the nucleotide sequence of the soybean Germin-Like Protein 5 protein coding gene The constructed plant overexpression vector pBA002-GmGLP5 is subjected to genetic transformation of Arabidopsis thaliana wild type Col-0 through Agrobacterium tumefaciens-mediated Arabidopsis thaliana, and it is found that the seed protein content of an overexpressed transgenic Arabidopsis thaliana plant is increased compared with a receptor control group, which indicates that the GmGLP5 has a potential promotion effect on seed protein accumulation. Therefore, the invention discovers that the soybean Germin-Like Protein 5 protein coding gene GmGLP5 can be applied to the aspect of adjusting the protein content through genetic engineering.

Description

TECHNICAL FIELD

[0001] The present application relates to the application of soybean Germin-Like Protein 5 protein coding gene GmGLP5, belongs to the field of genetic engineering, and in particular to the application of GmGLP5 gene derived from soybean Germin-Like Protein 5 in regulating protein content. BACKGROUND

[0002] Soybean [Glycine max (L.) Merr] is the main plant protein source for humans, livestock and poultry due to its high protein content, contributing about 70% of total edible protein. Limited by factors such as poor quality of domestic soybeans, lagging behind in the selection and breeding process of special varieties, and insufficient competitiveness in the domestic soybean market, a large amount of soybeans are relied on imports (Zhang Yannan, 2017). The per capita intake of soybeans in China has been at a low level, and the utilization level of soybean protein is also relatively low (Gai Junyi, 2008). Therefore, more high-protein soybean new varieties need to be selected and bred by scientific researchers to meet people's demand for excellent soybean products (Li Wenxia et al., 2024). On a dry weight basis, soybean seeds contain an average of 40% protein, and the current mainstream soybean varieties generally contain 38-42% protein (Kumar et al., 2021).

[0003] Soybean seed protein content is a quantitative trait controlled by multiple genes, which makes the protein have a complex genetic mechanism (Chung et al., 2003; Mckendry et al., 1985). Currently, there have been some reports of genes related to grain protein content in soybeans, such as knocking out sugar transporters GmSWEET10a or GmSWEET10b can significantly increase protein content (P < 0.05) (Wang et al., 2020); overexpression of the gene POWR1 (Protein, Oil, Weight Regulator 1) encoding the CCT domain significantly increases soybean seed protein content (P < 0.01) (Goettel et al., 2022). However, the understanding of the regulation network of soybean seed protein synthesis and storage is still not perfect. The germin-like protein (GLP) family exists in all organs and developmental stages of plants and is widely involved in plant development and defense responses (Bernier and Berna, 2001). The soybean genome contains 21 GLP genes, which play an important role in disease resistance, stress resistance and growth and development (Lu et al., 2010). Overexpression of GmGLP7 transgenic Arabidopsis plants showed enhanced tolerance to salt, drought and oxidative stress (Li et al., 2016); overexpression of GmGLP9 in tobacco significantly improved its salt tolerance (Lu et al., 2010); overexpression of GmGLP10 in transgenic tobacco significantly enhanced its tolerance to oxalic acid and Sclerotinia infection (Zhang et al., 2018); under low nitrogen conditions, overexpression of GmGLP20.4 increased soybean root biomass by optimizing root architecture, while the gmglp20.4 knockout mutant showed significantly reduced root biomass (Wang et al., 2022). Although the GLP family has been reported to be involved in plant stress response, no report has been found in soybeans on the effect of GLP genes on protein content. We found that the expression of soybean GmGLP5 gradually increased with seed development, and using molecular methods, we constructed a GmGLP5 overexpression PBA002 vector and performed Arabidopsis genetic transformation, and found that the seed protein content of the overexpression material was significantly increased. SUMMARY

[0004] The purpose of the present application is to disclose the genetic engineering application of soybean Germin-Like Protein 5 protein coding gene GmGLP5 in improving protein content, and the expression of the gene gradually increases with seed development. GmGLP5 can be used as a target gene to create overexpression transgenic Arabidopsis to improve seed protein content.

[0005] The object of the present application can be achieved by the following technical solutions.

[0006] The application of the soybean Germin-Like Protein 5 protein coding gene GmGLP5 in genetically engineering protein content improvement, wherein the coding region sequence of the soybean GmGLP5 gene is SEQ ID NO. 1.

[0007] The soybean GmGLP5 protein, wherein the amino acid sequence is SEQ ID NO. 2.

[0008] The recombinant expression vector containing the soybean Germin-Like Protein 5 protein coding gene GmGLP5.

[0009] The recombinant expression vector containing the soybean Germin-Like Protein 5 protein coding gene GmGLP5 is obtained by inserting the gene GmGLP5 into the restriction sites MluI and SacI of the pBA002 vector.

[0010] When the plant expression vector is constructed using GmGLP5, any enhanced promoter or inducible promoter can be added before the transcription initiation nucleotide. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding a selective marker gene (GUS gene, luciferase gene, etc.) in plants. For the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened by phenotypic traits.

[0011] The application of the soybean GmGLP5 in genetically engineering protein content improvement of Arabidopsis thaliana seeds.

[0012] The application of the recombinant expression vector of the soybean GmGLP5 in genetically engineering protein content improvement of Arabidopsis thaliana seeds.

[0013] Beneficial effects

[0014] Real-time fluorescent quantitative polymerase chain reaction analysis of different tissues of soybean showed that GmGLP5 was expressed in roots, stems, leaves, flowers, pods and developing seeds, and the expression amount gradually increased with the growth and development of seeds Figure 2 ). The plant overexpression vector pBA002-GmGLP5 was constructed, and overexpression was carried out in wild-type Arabidopsis thaliana Col-0. The protein content of T2 generation of transgenic Arabidopsis thaliana was determined by using a plant protein quantitative determination kit, and the seed protein content was significantly improved (Table 1), indicating that the heterologous expression of GmGLP5 has a potential promoting effect on seed protein accumulation. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 PCR cloning GmGLP5 agarose gel electrophoresis map. M is Marker DNA Marker); lane 2 is the target band of GmGLP5, about 657bp in size. Marker band size from top to bottom: 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp.

[0016] Figure 2 Tissue expression analysis of GmGLP5. Root: root tissue, Stem: stem tissue, Leaf: leaf tissue, Flower buds: flower tissue, Pod wall: pod, Seed 20d: 20 days after flowering seed, Seed 35d: 35 days after flowering seed, Seed 50d: 50 days after flowering seed. Error bars represent ± SD, *: P < 0.05, **: P < 0.01, ns represents no significant difference.

[0017] Figure 3 Gene relative expression of GmGLP5 in overexpression transgenic Arabidopsis (OE-GmGLP5) and wild type (WT). Table 1 Protein content determination of T2 generation GmGLP5 overexpression transgenic Arabidopsis. WT and OE-GmGLP5 represent control and overexpression GmGLP5 Arabidopsis, respectively. DETAILED DESCRIPTION

[0018] The application will be further described below in conjunction with the drawings and examples.

[0019] The methods used in the following examples are conventional methods unless otherwise specified.

[0020] Example 1 Cloning and expression characteristics analysis of soybean GmGLP5 gene

[0021] 1) Cloning of soybean Germin-Like Protein 5 protein coding gene GmGLP5

[0022] Soybean variety NJAU_C173 (high protein content) as the material, take its leaves, mortar and pestle, add to the 1.5 mL EP tube containing lysis solution, shake well, then move to 1.5 mL EP tube, total RNA was extracted using RNA extraction kit (Shanghai Pudui). The quality of total RNA was identified by gel electrophoresis, and the RNA content was determined by spectrophotometer. The obtained total RNA was used as a template, and reverse transcription was performed according to the instructions of Novozyme reverse transcription kit (HiScriptIII 1st Strand cDNA Synthesis Kit, Nanjing). After obtaining the first strand of cDNA, PCR amplification was performed. The PCR program was as follows: 95℃ pre-denaturation for 3 minutes, 95℃ denaturation for 15 seconds, 60℃ annealing for 15 seconds, 72℃ extension for 90 seconds, a total of 35 cycles, finally 72℃ for 5 minutes, then 4℃ constant temperature, to obtain NJAU_173 cDNA.

[0023] Glycine max Wm82.a2.v1 as the reference genome, the gene sequence of GmGLP5 in the soybean database Phytozome v13 as the template to design specific primers, and the gene was amplified from the leaf cDNA of soybean variety NJAU_173 by PCR reaction. After sequencing the PCR product, the complete CDS sequence of soybean GmGLP5 gene was obtained, with a full length of 657 bp. Figure 1 )The sequence of GmGLP5 gene is SEQ ID NO. 1, and the amino acid sequence is SEQ ID NO. 2. The specific primer sequences required for PCR reaction are F1: TCCTTCCAACTCATACAAAC and R1: GAGGAAAGTGTATCTCCATTC, which were synthesized by commissioning Genescript Biotech Co., Ltd. 2) Tissue expression analysis of GmGLP5

[0024] The roots, stems, leaves, flowers, pods, seeds 20 days, 35 days and 50 days after flowering of soybean varieties NJAU_C173 (high protein content) and NJAU_C126 (low protein content) were collected to identify the expression level of GmGLP5 in different tissues. The roots, stems and leaves were sampled after the first pair of trifoliates fully expanded (V3), the flowers and pods were sampled at the full bloom stage (R2), and the seeds 20 days (R5), 35 days (R6.5) and 50 days (R7) after flowering were sampled. Three independent biological replicates were collected at the above-mentioned stages for each material, and the samples were stored at -80°C after being quickly frozen in liquid nitrogen. The total RNA was extracted as in 1) of Example 1. The total RNA of each tissue was used as a template to reverse to cDNA. The GmGLP5 fluorescent quantitative primer sequences were F2: TTGCTTTGGTGTTAGCCACCGT and R2: AGTCACTAGGGAGCCATAGG, and the relative expression amount of the gene in each tissue was detected by performing a real-time fluorescent quantitative PCR reaction (Real-time RT-PCR), with the soybean Tubulin (GenBank: AY907703.1) gene as an internal reference, and the primer sequences were F3: GGAGTTCACAGAGGCAGAG and R3: CACTTACGCATCACATAGC. The expression amount of GmGLP5 in the leaves was the highest, and the expression amount in the seeds 20 days after flowering was the lowest, and the expression amount of the gene gradually increased with the development of the seeds. Figure 2

[0025] Example 2 Genetic engineering application of soybean gene GmGLP5

[0026] 1) Construction of plant overexpression vector of soybean Germin-Like Protein 5 protein coding gene GmGLP5

[0027] The overexpression vector was constructed by enzyme digestion and recombination. First, the pBA002 vector was cut with restriction enzymes MluI and SacI, and the gel was recovered and purified after measuring the concentration.

[0028] ​PCR amplification was performed using the GmGLP5 gene sequence shown in SEQ ID NO.1 synthesized by a commissioned biotechnology company as a template. The amplification primer sequences with pBA002 vector restriction enzyme adapters are shown in F4: CGCGCCGGGCCCAGGCCTACGCGTATGAAGCTCACAGGTTTCCT and R4: ATCGGGGAAATTCGAGCTCTTATTTCTTAGGAGCAAGCC. The PCR program was as follows: 95℃ pre-denaturation for 3 minutes, 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 60 seconds, for a total of 35 cycles, and finally incubation at 72℃ for 5 minutes, followed by isothermal incubation at 4℃. After gel electrophoresis, the gel was recovered to obtain the complete CDS sequence of the GmGLP5 gene with MluI and SacI restriction enzyme adapters.

[0029] The target gene fragment amplified with enzyme digestion linkers using F4 and R4 primers was then used with the cleaved pBA002 vector via Vazyme's [technology / component - context needed for accurate translation]. The Entry One Step Cloning Kit (C115) was used for ligation, transformation, plating, single clone selection, and sequencing verification. The pBA002-GmGLP5 plant overexpression plasmid was finally obtained and stored at -20 degrees Celsius for later use.

[0030] 2) Creation of Arabidopsis overexpression lines

[0031] The pBA002-GmGLP5 vector obtained in step 1) was transformed into Agrobacterium EHA105 and plant tissue culture was performed. The specific experimental procedure is as follows:

[0032] 1. Bacterial culture preparation: Streak the pBA002-GmGLP5 Agrobacterium tumefaciens culture (EHA105) onto a YEB plate containing rifampicin and spectinomycin resistance. Invert the plate and shake at 28°C until single colonies appear. Pick a single colony and transfer it to a 2ml centrifuge tube containing 1ml of liquid culture medium. Incubate overnight at 28°C. Then transfer the culture to a 150ml Erlenmeyer flask containing 120ml of liquid culture medium containing antibiotics. Incubate overnight at 28°C and 100rpm. The OD600 should be between 0.8 and 0.9.

[0033] 2. Bacterial suspension collection: Aliquot the bacterial suspension from the conical flask into two 50ml centrifuge tubes, centrifuge at 5000rpm for 10min, and discard the supernatant. Resuspend the bottom precipitate in 40mL of 5% sucrose solution and 15μL of 0.03% surfactant, and pour the suspension into a collection container for later use.

[0034] 3. Arabidopsis thaliana genetic transformation: Select the wild type Col-0 seeds of Arabidopsis thaliana with uniform color and fullness, and sterilize them. Use the chlorine gas generated by the chemical reaction HCl (concentrated) + NaClO → Cl2↑ + NaOH (concentrated hydrochloric acid and sodium hypochlorite in a volume ratio of about 1:10) for disinfection. This step is carried out in a fume hood for 3 hours. After sterilization is completed, place the seeds on a clean bench to allow the residual chlorine gas to disperse, and then plant them in mixed substrate (soil: vermiculite 1:1) in a 25°C incubator under 16h light / 8h dark conditions to grow to the flowering stage. When the wild type Arabidopsis thaliana is in the flowering stage, place the inflorescences in the above-mentioned bacterial suspension for 30s of infection, cut off the opened flowers and siliques before infection, and place them in the dark for one day after infection and then normal cultivation. The whole flowering stage is infected for 3 times.

[0035] 4. After harvesting, dry in an oven at 28°C for one week, and place in a refrigerator at 4°C for 3 days; use chlorine gas for 3h of disinfection, and plant the seeds in MS medium containing glufosinate, and cultivate in a 25°C incubator under 16h light / 8h dark conditions for 2 weeks; transplant the well-grown green plants to mixed substrate (soil: vermiculite 1:1), and sample the leaves after 15 days for DNA extraction and positive identification.

[0036] 3) Transgenic Arabidopsis thaliana seed protein content determination

[0037] Collect mature seeds of wild type and identified overexpression lines of Arabidopsis thaliana, dry for 2 weeks, grind into powder under liquid nitrogen, and accurately weigh 0.020g for determination of seed protein content. Set 4 biological replicates for each sample, and use the plant protein quantitative determination kit (A045-2) of Nanjing Jiancheng Biological Engineering Institute to determine the seed protein content. The determination results show that the overexpression of transgenic Arabidopsis thaliana significantly improves the seed protein content (Table 1).

[0038] Table 1: Overexpression of GmGLP5 Arabidopsis thaliana significantly improves protein content compared with control

[0039]

[0040] The Germin-Like Protein 5 protein coding gene GmGLP5 is as follows:

[0041]

[0042] The Germin-Like Protein 5 protein amino acid sequence is as follows:

[0043]

Claims

1. Use of a soybean Germin-Like Protein 5 protein-encoding gene GmGLP5 in increasing the protein content of seeds of crops by genetic engineering; wherein the Germin-Like Protein 5 protein-encoding gene GmGLP5 has the nucleotide sequence of SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, The crop is Arabidopsis thaliana or soybean.

3. Use of a recombinant expression vector containing a soybean GmGLP5 gene in increasing the protein content of seeds of crops by genetic engineering; wherein the soybean GmGLP5 gene has the nucleotide sequence of SEQ ID NO.

1.

4. Use according to claim 3, characterized in that, The recombinant expression vector containing the soybean GmGLP5 gene is obtained by inserting the soybean GmGLP5 gene into the restriction sites MluI and SacI of the pBA002 vector.

5. Use according to claim 4, characterized in that, The crop is Arabidopsis thaliana or soybean.

4. A recombinant expression vector containing a soybean GmGLP5 gene, wherein the soybean GmGLP5 gene has the nucleotide sequence of SEQ ID NO.

1. The recombinant expression vector containing the soybean GmGLP5 gene is obtained by inserting the soybean GmGLP5 gene into the restriction sites MluI and SacI of the pBA002 vector. The crop is Arabidopsis thaliana or soybean.

Images