SNP molecular genetic marker of SKAP1 gene related to chicken feed conversion rate and application of SNP molecular genetic marker

By using high-throughput sequencing technology, the SNP molecular genetic marker of the SKAP1 gene at locus 6404453 on chicken chromosome 27 was screened, which solved the problem of difficulty in analyzing the genetic mechanism of chicken feed conversion ratio in traditional methods. This enabled efficient screening and breeding of chickens with low FCR, reducing feed consumption and improving economic benefits.

CN120888674APending Publication Date: 2025-11-04SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511346501.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-19
Publication Date
2025-11-04

AI Technical Summary

Technical Problem

Traditional methods are insufficient to efficiently analyze the genetic mechanism of chicken feed conversion ratio (FCR), resulting in low efficiency of genetic improvement in animal husbandry and difficulty in screening and breeding superior genotypes with high FCR.

Method used

The SNP molecular genetic marker of the SKAP1 gene at locus 6404453 on chromosome 27 of chicken was screened using high-throughput sequencing technology. The SNP molecular genetic marker chr-6404453 related to feed conversion ratio was provided. PCR amplification and sequencing were performed using primers and kits, and homozygous AA individuals were screened as low FCR chickens.

Benefits of technology

It effectively reduces feed consumption for yellow-feathered broilers, improves economic efficiency and competitiveness, enables efficient screening and breeding of low-FCR chickens, and enhances enterprise benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120888674A_ABST
    Figure CN120888674A_ABST
Patent Text Reader

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular genetic marker of an SKAP1 gene related to a chicken feed conversion rate and application of the SNP molecular genetic marker, and belongs to the technical field of animal genetic breeding and molecular biology. The SNP molecular genetic marker is located at the 6404453 site of the chicken chromosome 27, and the polymorphism is G / A. The invention provides the SNP molecular genetic marker chr27-6404453 remarkably related to the feed conversion rate character of the yellow-feathered broiler chicken, the SNP molecular genetic marker can be applied to breeding of the yellow-feathered broiler chicken, and the yellow-feathered broiler chicken with low feed conversion rate is selected and reserved in the breeding process, so that the feed consumption in the production process can be effectively reduced, and the economic benefits and competitiveness of enterprises are improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of animal genetics and breeding and molecular biology, specifically to a SNP molecular genetic marker of the SKAP1 gene related to chicken feed conversion rate and its application. Background Technology

[0002] Feed conversion ratio (FCR) is an important indicator for measuring animal production efficiency, defined as the ratio of feed intake to body weight gain (e.g., weight gain or egg production). A lower FCR indicates higher feed utilization efficiency, leading to greater economic benefits and sustainability in animal husbandry. However, FCR is influenced by multiple factors, including genetics, nutrition, environment, and management, with genetic factors playing a particularly crucial role. Therefore, screening and breeding superior genotypes with low FCR is of great significance for genetic improvement in animal husbandry.

[0003] Traditionally, genetic assessment of feed conversion ratio (FCR) has relied on phenotypic recordings and quantitative genetics methods, but these methods are inefficient and struggle to elucidate its molecular mechanisms. With the development of high-throughput sequencing (HTS) technologies, genomics methods have provided powerful tools for screening FCR-related genes. HTS technologies (such as whole-genome resequencing, transcriptome sequencing, and epigenome sequencing) can rapidly and comprehensively detect genomic variations, gene expression differences, and regulatory mechanisms, thereby revealing key genes and pathways affecting FCR. Using HTS technology, researchers can perform genome-wide association studies (GWAS), selective clearance analyses, or differentially expressed gene screening in high- and low-FCR populations to identify candidate genes related to feed efficiency (such as genes related to energy metabolism, intestinal absorption, or microbial interactions).

[0004] In conclusion, using high-throughput sequencing technology to screen for low-FCR genotypes for breeding low-FCR yellow-feathered broilers is one of the effective ways to broaden the breeding direction of low-FCR yellow-feathered broilers and accelerate the genetic selection process. Summary of the Invention

[0005] To address the aforementioned technical problems, the present invention aims to provide an SNP molecular genetic marker for the SKAP1 gene related to chicken feed conversion rate and its application.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: In a first aspect, the present invention provides a SNP molecular genetic marker for the SKAP1 gene, which is related to chicken feed conversion ratio. The SNP molecular marker is located at position 6404453 on chicken chromosome 27 and has a polymorphism of G / A.

[0007] The beneficial effects of this invention are as follows: Through association analysis of feed conversion ratio and whole-genome SNP genetic markers in yellow-feathered broilers, this invention obtained the SNP molecular genetic marker chr-6404453 associated with feed conversion ratio in yellow-feathered broilers, which represents position 6404453 on chromosome 27 of chicken. This marker indicates that there are differences in feed conversion ratio among different genotypes of yellow-feathered broilers. Applying it to the breeding of yellow-feathered broilers can effectively select individuals with low feed conversion ratio, effectively reduce feed consumption during production, and improve the economic benefits and competitiveness of enterprises. The genetic marker chr27-6404453 involved is the mutation site with SNP number chr27-6404453, which can be found in the NCBI Chicken Genome Database (bGalGal1.mat.broiler.GRCg6a).

[0008] Furthermore, the mutation sites and upstream and downstream sequences of the SNP molecular genetic marker are shown in SEQ ID NO.1, where R is the mutation site, and when R is A, it indicates a chicken with low feed conversion ratio. SEQ ID NO.1: 5'-GGATCCCTTCTTGGGGGCAGTCGTGAAAAAGGGGAATAATGACGGACGAAGGGGAGTAATGATGGATAAAGGGGGAGTGATGATGGATAAAGGGGTGTAATGCTGGATAAAGGGGTTTTACCCTCAAAACTAAAGGGAGAAAGGCAGAAATGTGCCCCCACTGTGTGCTGGGAGCCCTCCGGCTCTGTTATTTATACC ACRGCGGTTCCCCCAGTTAACAGCTTAAATGAAGGGGCCGTTGCTTAAATGCTTTATTCATATTATACAGCGATTACCAGCTATAGCCATATTCCTTAATAACCTGTTATAAAGCATGTTATAAAACCCATTAGTGATGATGCTGGGGAAGGCTGTTAGGGAGCGTAATGCGGTAATCAGCGCCGTGCAACAGTGACAGAAG-3'.

[0009] Furthermore, a method for determining the above-mentioned SNP molecular genetic markers is provided, comprising the following steps: (1) Cultivate healthy yellow-feathered broiler individuals, and select yellow-feathered broilers with the lowest and highest feed conversion rates to collect and preserve blood; (2) Extract DNA and perform DNA quality determination; (3) Determine the SNP molecular genetic markers associated with the feed conversion rate trait in yellow-feathered broilers.

[0010] In a second aspect, the present invention provides primers for amplifying the above-mentioned SNP molecular genetic markers, comprising a forward primer as shown in SEQ ID NO.2 and a reverse primer as shown in SEQ ID NO.3; SEQ ID NO.2: 5'-GAAATGTGCCCCCACTGTGT-3'; SEQ ID NO. 3: 5'-ATTACCGCATTACGCTCCCT-3'.

[0011] A third aspect of the present invention provides a kit for detecting the above-mentioned SNP molecular genetic markers, comprising the above-mentioned primers.

[0012] In a fourth aspect, the present invention provides the application of the above-mentioned SNP molecular genetic markers or primers or kits in screening chicken individuals or parents with low feed conversion ratios.

[0013] In a fifth aspect, the present invention provides a method for screening chickens with low feed conversion ratio, wherein the above-mentioned SNP molecular genetic markers of the individuals to be screened are amplified and sequenced using PCR technology, and homozygous individuals with the SNP molecular genetic marker genotype AA are screened as chickens with low feed conversion ratio.

[0014] Furthermore, the specific steps include: (1) Blood was collected from the wing vein of the individual to be tested, anticoagulated with EDTA, stored at -20℃, and DNA was extracted. (2) The kit contains 2×Taq Master Mix, forward and reverse primers; (3) The PCR products were sequenced using a kit based on the Sanger sequencing method; (4) Select homozygous individuals with the AA genotype at position 6404453 on chromosome 27.

[0015] Furthermore, the PCR amplification system was as follows: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O added to a final volume of 20 μL.

[0016] Furthermore, the sequence of the forward primer is shown in SEQ ID NO.2, and the sequence of the reverse primer is shown in SEQ ID NO.3.

[0017] Furthermore, the PCR reaction conditions were as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

[0018] The present invention has the following beneficial effects: (1) The present invention provides a SNP molecular genetic marker chr27-6404453 that is significantly associated with the feed conversion rate trait of yellow-feathered broilers. This SNP molecular genetic marker can be applied to the breeding of yellow-feathered broilers. By selecting and retaining yellow-feathered broilers with low feed conversion rate during the breeding process, the amount of feed consumed in the production process can be effectively reduced, thereby improving the economic benefits and competitiveness of enterprises.

[0019] (2) This invention provides primers and kits for identifying the SNP molecular genetic marker chr27-6404453, which can be used to efficiently screen individuals or parents of yellow-feathered broilers with excellent feed conversion ratio. Attached Figure Description

[0020] Figure 1 Manhattan diagram for SNP molecular genetic markers; Figure 2 Genotype sequencing diagram for SNP molecular genetic markers. Detailed Implementation

[0021] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0022] Example 1: Screening of SNP molecular genetic markers The screening process for SNP molecular genetic markers specifically includes the following steps: 1872 healthy yellow-feathered broiler chickens were selected and fed to their maximum capacity for 49 days. The daily feed intake, initial body weight, and final body weight of each chicken were recorded. The feed conversion ratio was calculated using the following formula: ; In the formula, FCR is the feed conversion ratio; W f For feed consumption; W a To increase the weight of living organisms.

[0023] A lower FCR value, indicating a lower feed conversion ratio, means less feed is consumed for the same production capacity, thus saving feed. DNA was extracted from each sample, and the DNA samples underwent quality testing. DNA concentration was measured using a Qubit Fluorometer, and DNA fragment size and degradation were measured using agarose gel electrophoresis. The results showed that 99 samples were substandard, and the 1773 qualified DNA samples from yellow-feathered chicken breeder chickens were used for subsequent library construction and sequencing. Simplified genome sequencing was performed using high-throughput yield measurement technology. Sequencing data underwent quality control and filtering to remove low-quality sequencing reads and potential false positive BNPs. Feed conversion ratio was used as a phenotype and correlated with SNP data. GWAS analysis was performed using the EMMAX program (http: / / genetics.cs.ucla.edu / emmax / index.html), and the analysis model is as follows: y=Xb+Zu+m+e In the model, y represents the true value of the trait record, X represents the fixed-effects association matrix, b represents the fixed-effects vector, the fixed effects include batch effects and three principal component effects, Z represents the additive genetic effects association matrix, u represents the individual additive genetic effects vector, e represents the residual, and u ~ N(0, Gσ) 2 α ), e~N(0, Iσ 2 ε ), where G represents the genomic kinship matrix, I represents the identity matrix, and σ 2 α σ 2 ε represents the variance of the additive genetic effect and the variance of the residuals, respectively, and m represents the SNP marker effect.

[0024] Based on the association analysis results, a SNP molecular marker associated with the feed conversion ratio trait in yellow-feathered broilers was identified. This molecular marker is located in the SKAP1 gene on chromosome 27 of yellow-feathered broilers, specifically at locus 6404453, named chr27-6404453, with a polymorphism of G / A. Figure 1 The Manhattan diagram shows the mutation site of this SNP molecular genetic marker and the sequences of the upstream and downstream primers as shown in SEQ ID NO.1.

[0025] SEQ ID NO.1:5'- GGATCCCTTTCTTGGGGGCAGTCGTGAAAAAGGGGAATAATGACGGACGAAGGGGAGTAATGATGGATAAAGGGGAGTGATGATGGATAAAGGGGTGTAATGCTGGAATAAAGGGGTTTTACCCTCAAAACTAAAGGGAGAAAGGCAGAAATGTGCCCCCACTGTGTGCTGGGAGCCCTCCGGCTCTGTTATTTATACCACRG CGGTTCCCCCAGTTAACAGCTTAAATGAAGGGGCCGTTGCTTAAATGCTTTATTCATATTATACAGCGATTACCAGCTATAGCCATATTCCTTAATAACCTGTTATAAAGCATGTTATAAAACCCATTAGTGATGATGCTGGGGAAGGCTGTTAGGGAGCGTAATGCGGTAATCAGCGCCGTGCAACAGTGACAGAAG-3'; Where R is the G>A mutation site, and when R is A, yellow-feathered broilers have a lower feed conversion rate. 5'- and -3' represent the 5' end and 3' end of the nucleotide sequence, respectively.

[0026] Example 2: Validation of SNP molecular genetic markers I. The verification of SNP molecular genetic markers specifically includes the following steps: (1) The SNP molecular genetic marker chr27-6404453 obtained in Example 1 was first verified in another yellow-feathered broiler population. A total of 1773 healthy yellow-feathered broiler individuals were fed to the maximum for 49 days. The daily feed intake, initial weight and final weight of each chicken were recorded. The feed conversion rate was calculated. 150 individuals with low feed conversion rate (negative value) and 150 individuals with high feed conversion rate (positive value) were selected, and blood was taken for DNA extraction.

[0027] (2) Then, using the DNA extracted in step (1) as a template, the forward and reverse primers shown in SEQ ID NO.2-3 were added to carry out the PCR reaction.

[0028] SEQ ID NO.2: 5'-GAAATGTGCCCCCACTGTGT-3'; SEQ ID NO. 3: 5'-ATTACCGCATTACGCTCCCT-3'.

[0029] The PCR reaction system was a 20 μL system, including 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O added to 20 μL.

[0030] The PCR reaction conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

[0031] (3) Finally, the PCR products obtained in step (2) were sequenced using the Sanger sequencing method.

[0032] II. Results Analysis The sequencing results were analyzed, and the genotype of each individual was recorded according to the sequencing peak diagram of each sample (e.g., Figure 2 As shown in the diagrams, the corresponding loci in the AA genotype sequencing graph show only one peak, indicating that the alleles are the same (both are A); the corresponding loci in the GA genotype sequencing graph show two peaks, indicating that the alleles are different (one is G, and the other is A); the corresponding loci in the GG genotype sequencing graph show only one peak, indicating that the alleles are the same (both are G). One-way ANOVA using SPSS 26.0 was used to analyze the relationship between the genotypes and alleles of SNP molecular markers and feed conversion ratio. The results are shown in Tables 1 and 2.

[0033] Table 1. Statistical table of distribution differences of SNP molecular marker genotypes between low and high feed conversion ratios.

[0034] Table 2. Statistical table of distribution differences of SNP molecular marker alleles between low and high feed conversion ratios.

[0035] The experimental results in Tables 1 and 2 show that, among these SNP molecular markers, the genotype and allele frequencies exhibited highly significant differences (P < 0.01) between the low and high feed conversion ratio (FCR) groups. In the low FCR group, the frequency of allele A was higher than that of allele G, and the frequency of genotype AA was higher than that of genotype GG, indicating that individuals with the AA genotype at position 201 had a superior FCR phenotype compared to those with the GG genotype. This further demonstrates that the polymorphism of the screened molecular markers is significantly correlated with the FCR trait, identifying them as SNP loci associated with the FCR trait, which can be used for breeding yellow-feathered broilers with low FCR.

[0036] Example 3: Assisted molecular breeding method for feed conversion ratio trait in yellow-feathered broilers based on SNP molecular genetic marker chr27-6404453 This invention provides a kit for detecting the SNP molecular genetic marker chr27-6404453, which includes 2×Taq Master Mix, forward and reverse primers as shown in SEQ ID NO.2-3, and ddH2O.

[0037] This invention also provides an auxiliary molecular breeding method for feed conversion ratio traits in yellow-feathered broilers based on the SNP molecular genetic marker chr27-6404453, specifically including the following steps: (1) Blood was collected from the wing vein of the yellow-feathered broiler individual to be tested, anticoagulated with EDTA, stored at -20℃, and DNA was extracted.

[0038] (2) Perform PCR on the DNA extraction product from step (1). The PCR reaction system is a 20 μL system, including 10 μL of 2×TaqMaster Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O to 20 μL. The PCR reaction conditions are: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

[0039] (3) The PCR products from step (2) were sequenced using the Sanger sequencing method.

[0040] (4) Based on the sequencing results, genotyping was performed, and homozygous individuals with the SNP molecular genetic marker chr27-6404453 as the AA genotype were selected for breeding to reduce feed conversion rate and effectively reduce feed consumption and breeding costs. Individuals with this marker were selected to join the core breeding population, which can achieve rapid homozygosity of the alleles related to this trait and provide technical support for accelerating the progress of genetic selection.

[0041] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A SNP molecular genetic marker for the SKAP1 gene associated with chicken feed conversion ratio, characterized in that, The SNP molecular marker is located at position 6404453 on chicken chromosome 27, with a polymorphism of G / A.

2. The SNP molecular genetic marker of the SKAP1 gene related to chicken feed conversion ratio according to claim 1, characterized in that, The mutation sites and upstream and downstream sequences of the SNP molecular genetic marker are shown in SEQ ID NO.1, where R is the mutation site, and when R is A, it indicates a chicken with low feed conversion ratio.

3. A primer for amplifying the SNP molecular genetic marker as described in claim 1 or 2, characterized in that, This includes the forward primer shown in SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.

3.

4. A kit for detecting the SNP molecular genetic markers of claim 1 or 2, characterized in that, Includes the primers described in claim 3.

5. The application of the SNP molecular genetic marker of claim 1 or 2, the primer of claim 3, or the kit of claim 4 in screening chicken individuals or parents with low feed conversion ratio.

6. A method for screening chickens with low feed conversion ratio, characterized in that, The SNP molecular genetic markers described in claim 1 or 2 of the individuals to be screened were amplified and sequenced using PCR technology, and homozygous individuals with the SNP molecular genetic marker genotype AA were selected as chickens with low feed conversion ratio.

7. The method for screening chickens with low feed conversion ratio according to claim 6, characterized in that, The PCR amplification system was as follows: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O added to a final volume of 20 μL.

8. The method for screening chickens with low feed conversion ratio according to claim 7, characterized in that, The sequence of the forward primer is shown in SEQ ID NO.2, and the sequence of the reverse primer is shown in SEQ ID NO.

3.

9. The method for screening chickens with low feed conversion ratio according to claim 6, characterized in that, The PCR reaction conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.