Trichoderma harzianum and application thereof in degradation of deltamethrin

By co-culturing Trichoderma harzianum GZUAS681023 with deltamethrin under different pH and temperature conditions, the problem of the sensitivity of microbial degradation methods to environmental factors was solved, and a highly efficient and stable deltamethrin degradation effect was achieved, which is suitable for application in soil, water and plants.

CN120905031APending Publication Date: 2025-11-07GUIZHOU UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510937829.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-08
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

Existing technologies are difficult to efficiently degrade deltamethrin, and microbial degradation methods are sensitive to environmental factors and have unstable degradation efficiency.

Method used

Trichoderma harzianum GZUAS681023 was co-cultured with deltamethrin under different pH and temperature conditions to degrade deltamethrin via spore suspension.

Benefits of technology

Trichoderma harzianum GZUAS681023 exhibits efficient and stable degradation capabilities for deltamethrin under acidic, alkaline, and varying temperatures, making it suitable for degrading deltamethrin in soil, water, and plants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005488529470000071
    Figure BDA0005488529470000071
  • Figure BDA0005488529470000081
    Figure BDA0005488529470000081
  • Figure BDA0005488529470000091
    Figure BDA0005488529470000091
Patent Text Reader

Abstract

The invention relates to the technical field of microorganisms, in particular to trichoderma harzianum and application of the trichoderma harzianum in degradation of deltamethrin. The trichoderma harzianum is named as Trichoderma harzianum GZUAS681023 and is preserved in the Guangdong Microbial Culture Collection Center on July 26, 2024, and the preservation number of the trichoderma harzianum is GDMCC (China General Microbiological Culture Collection Center) NO: 64912. The Trichoderma harzianum GZUAS681023 provided by the invention has good tolerance to environmental factors such as pH value, temperature and the like, has high and stable degradation efficiency to deltamethrin in high-temperature, low-temperature, acidic and alkaline environments, and provides technical support for development of efficient deltamethrin degradation bacterial agents.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of microorganisms, in particular to a Trichoderma harzianum and application thereof in degrading deltamethrin. BACKGROUND

[0002] Deltamethrin is widely used in crop pest control and has high-efficiency and broad-spectrum insecticidal characteristics. However, due to its stable chemical properties, it is difficult to be quickly degraded in the environment and is prone to be left in soil, water and plants, and its degradation products such as 3-phenoxybenzoic acid may have higher toxicity, posing potential threats to the ecological environment and human health.

[0003] The existing methods for degrading deltamethrin include physical adsorption, chemical degradation and membrane separation technology, but have the following problems: in the physical adsorption method, activated carbon, bentonite and the like have good adsorption effect on deltamethrin, but the regeneration and treatment cost of the adsorbent is high, and the adsorption capacity is limited; in the chemical degradation method, a large amount of chemical reagents need to be used, which will cause secondary pollution to the environment; the membrane separation technology has good removal effect, but the equipment cost and energy consumption are high, and it is difficult to be applied on a large scale. In recent years, the microbial degradation method has become a research hotspot in the field of pesticide degradation due to its environmental friendliness, high-efficiency degradation, low cost, strong adaptability, good sustainability and easy control. However, the degradation efficiency of microorganisms on deltamethrin is greatly affected by environmental factors such as temperature and pH value, and the environmental tolerance is limited. Therefore, it is urgent to find a strain that can efficiently degrade deltamethrin and has strong environmental tolerance.

[0004] Based on this, the present application provides a deltamethrin-degrading strain Trichoderma harzianum, which aims to solve the above problems, provide a new way for degrading deltamethrin, and provide technical support for developing efficient deltamethrin-degrading agents. SUMMARY

[0005] The present application aims to provide a Trichoderma harzianum GZUAS681023 and application thereof in degrading deltamethrin.

[0006] To achieve the above-mentioned purpose, the technical solution adopted by the present application is as follows:

[0007] The Trichoderma harzianum GZUAS681023 described in the present application was preserved in the Guangdong Microbial Culture Collection Center on July 26, 2024, and the preservation number is GDMCC NO:64912.

[0008] The application of the Trichoderma harzianum GZUAS681023 in the degradation of deltamethrin.

[0009] Preferably, the application of the Trichoderma harzianum GZUAS681023 in the degradation of deltamethrin is specifically that: the spore suspension of the Trichoderma harzianum GZUAS681023 is co-cultured with deltamethrin in a culture medium to degrade deltamethrin.

[0010] Further preferably, in the application of the Trichoderma harzianum GZUAS681023 in the degradation of deltamethrin, the spore concentration in the spore suspension of the Trichoderma harzianum GZUAS681023 is 10 8 CFU / mL.

[0011] Further preferably, in the application of the Trichoderma harzianum GZUAS681023 in the degradation of deltamethrin, the culture medium is an inorganic salt liquid medium, specifically: 2.0 g / L of ammonium chloride, 0.7 g / L of dipotassium hydrogen phosphate, 0.7 g / L of potassium dihydrogen phosphate, 0.4 g / L of magnesium sulfate, pH=6.8, 121℃ high-pressure steam sterilization for 20 min.

[0012] Further preferably, in the application of the Trichoderma harzianum GZUAS681023 in the degradation of deltamethrin, the co-culture is specifically that: the spore suspension is inoculated into the culture medium with a pH value of 4.0-10.0 at an inoculation amount of 2%, and is subjected to shaking culture under the condition of a culture temperature of 20℃-35℃ and a shaking speed of 180 r / min for 4 d.

[0013] Further preferably, in the application of the Trichoderma harzianum GZUAS681023 in the degradation of deltamethrin, in the co-culture: the pH value of the culture medium is 8.0; and the culture temperature is 28℃.

[0014] The application of the Trichoderma harzianum GZUAS681023 in the preparation of a microbial inoculant for degrading deltamethrin.

[0015] The application of the Trichoderma harzianum GZUAS681023 in the application disclosed by the application in degrading deltamethrin in soil, water and plants.

[0016] Preferably, the application of the Trichoderma harzianum GZUAS681023 or microbial inoculant in the application disclosed by the application in degrading deltamethrin in Auricularia.

[0017] The beneficial effects of the application:

[0018] 1. The application provides a deltamethrin-degrading strain Trichoderma harzianum GZUAS681023, which has a high and stable deltamethrin degradation rate, thereby providing technical support for developing a high-efficiency deltamethrin-degrading microbial inoculant.

[0019] 2. By investigating the influence of different pH values on the deltamethrin degradation efficiency of the Trichoderma harzianum GZUAS681023, it is found that the deltamethrin degradation rates are 71.52%, 69.88%, 75.31% and 73.63% respectively under the conditions of pH values of 4.0, 6.0, 8.0 and 10.0 for 4 days, which indicates that the Trichoderma harzianum GZUAS681023 has good tolerance to pH, and has a high deltamethrin degradation efficiency under acidic and alkaline conditions, and the degradation effect is stable.

[0020] 3. By investigating the influence of different temperatures on the deltamethrin degradation efficiency of the Trichoderma harzianum GZUAS681023, it is found that the deltamethrin degradation rates are 68.37%, 70.64%, 73.85% and 67.91% respectively under the conditions of culture temperatures of 20℃, 25℃, 30℃ and 35℃ for 4 days, which indicates that the Trichoderma harzianum GZUAS681023 has good tolerance to temperature conditions, and has a high deltamethrin degradation efficiency under low-temperature and high-temperature conditions, and the degradation effect is stable.

[0021] 4. By investigating the deltamethrin degradation effect of the Trichoderma harzianum GZUAS681023 on Auricularia in an indoor pot, it is found that the deltamethrin degradation rate of Auricularia reaches 71.31% on the 5th day after spraying the spore suspension of the Trichoderma harzianum GZUAS681023, which indicates that the Trichoderma harzianum GZUAS681023 has a good deltamethrin degradation effect on Auricularia, and provides a technical reference for popularizing and applying the Trichoderma harzianum GZUAS681023 to the degradation of deltamethrin in other plants, water and soil.

[0022] Microorganism preservation information:

[0023] Strain name: Trichoderma harzianum GZUAS681023;

[0024] Preservation unit: Guangdong Microbial Culture Collection Center;

[0025] Preservation address: 5th floor, No. 59, Building, Guangzhou, China;

[0026] Preservation date: July 26, 2024;

[0027] Preservation number: GDMCC NO: 64912. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 Morphological observation atlas of strain GZUAS681023 (in the figure: a is the morphology of the fungus under the microscope; b is the conidium under the microscope; c is the colony morphology);

[0029] Figure 2 Phylogenetic tree of strain GZUAS681023;

[0030] Figure 3 Effect of different pH values on degradation of deltamethrin by strain GZUAS681023;

[0031] Figure 4 Effect of different temperature conditions on degradation of deltamethrin by strain GZUAS681023;

[0032] Figure 5 Wood ear plant leaves sprayed with deltamethrin;

[0033] Figure 6 Wood ear plant leaves sprayed with spore suspension of Trichoderma harzianum GZUAS681023 and deltamethrin. DETAILED DESCRIPTION

[0034] The technical solutions of the present application will be described in detail below in combination with specific embodiments. The following examples are only used for explanation and illustration, and do not constitute a limitation on the technical solutions of the present application.

[0035] Example 1

[0036] Trichoderma harzianum GZUAS681023 was preserved in the Guangdong Microbial Culture Collection Center on July 26, 2024, with the preservation number GDMCC NO: 64912.

[0037] Example 2

[0038] Trichoderma harzianum GZUAS681023 was activated in PDA agar medium, and spores were washed with sterile water to adjust the spore concentration to 10 8 CFU / mL, and deltamethrin was co-cultured in inorganic salt liquid medium (ammonium chloride 2.0 g / L, potassium phosphate dibasic 0.7 g / L, potassium phosphate monobasic 0.7 g / L, magnesium sulfate 0.4 g / L, pH = 6.8, 121 ℃ high-pressure steam sterilization for 20 min) to degrade deltamethrin.

[0039] The co-culture conditions were as follows: inoculation amount was 2%; medium pH value was 8.0; and the culture was oscillated at 28 ℃ and 180 r / min for 4 d.

[0040] Example 3

[0041] Trichoderma harzianum GZUAS681023 was activated in PDA agar medium, and spores were washed with sterile water to adjust the spore concentration to 10 8 CFU / mL, and deltamethrin was co-cultured in inorganic salt liquid medium (ammonium chloride 2.0 g / L, potassium phosphate dibasic 0.7 g / L, potassium phosphate monobasic 0.7 g / L, magnesium sulfate 0.4 g / L, pH = 6.8, 121 ℃ high-pressure steam sterilization for 20 min) to degrade deltamethrin.

[0042] The co-culture conditions were as follows: inoculation amount was 2%; medium pH value was 4.0; and the culture was oscillated at 28 ℃ and 180 r / min for 4 d.

[0043] Example 4

[0044] Trichoderma harzianum GZUAS681023 was activated in PDA agar medium, and spores were washed with sterile water to adjust the spore concentration to 10 8 CFU / mL, and deltamethrin was co-cultured in inorganic salt liquid medium (ammonium chloride 2.0 g / L, potassium phosphate dibasic 0.7 g / L, potassium phosphate monobasic 0.7 g / L, magnesium sulfate 0.4 g / L, pH = 6.8, 121 ℃ high-pressure steam sterilization for 20 min) to degrade deltamethrin.

[0045] The co-culture conditions were as follows: inoculation amount was 2%; medium pH value was 6.0; and the culture was oscillated at 28 ℃ and 180 r / min for 4 d.

[0046] Example 5

[0047] Trichoderma harzianum GZUAS681023 was activated in PDA agar medium, and spores were washed with sterile water to adjust the spore concentration to 10 8CFU / mL, and deltamethrin in inorganic salt liquid medium (NH4Cl 2.0 g / L, K2HPO4 0.7 g / L, KH2PO4 0.7 g / L, MgSO4 0.4 g / L, pH = 6.8, 121 ℃ high pressure steam sterilization for 20 min) for co-culture, to degrade deltamethrin.

[0048] The co-culture conditions are as follows: the inoculation amount is 2%; the pH value of the culture medium is 10.0; and the oscillation culture is carried out at 28 ℃ and 180 r / min for 4 d.

[0049] Example 6

[0050] The Trichoderma harzianum GZUAS681023 is activated in PDA agar medium, the spores are washed with sterile water, and the spore concentration is adjusted to 10 8 CFU / mL, and deltamethrin in inorganic salt liquid medium (NH4Cl 2.0 g / L, K2HPO4 0.7 g / L, KH2PO4 0.7 g / L, MgSO4 0.4 g / L, pH = 6.8, 121 ℃ high pressure steam sterilization for 20 min) for co-culture, to degrade deltamethrin.

[0051] The co-culture conditions are as follows: the inoculation amount is 2%; the pH value of the culture medium is 8.0; and the oscillation culture is carried out at 20 ℃ and 180 r / min for 4 d.

[0052] Example 7

[0053] The Trichoderma harzianum GZUAS681023 is activated in PDA agar medium, the spores are washed with sterile water, and the spore concentration is adjusted to 10 8 CFU / mL, and deltamethrin in inorganic salt liquid medium (NH4Cl 2.0 g / L, K2HPO4 0.7 g / L, KH2PO4 0.7 g / L, MgSO4 0.4 g / L, pH = 6.8, 121 ℃ high pressure steam sterilization for 20 min) for co-culture, to degrade deltamethrin.

[0054] The co-culture conditions are as follows: the inoculation amount is 2%; the pH value of the culture medium is 8.0; and the oscillation culture is carried out at 25 ℃ and 180 r / min for 4 d.

[0055] Example 8

[0056] The Trichoderma harzianum GZUAS681023 is activated in PDA agar medium, the spores are washed with sterile water, and the spore concentration is adjusted to 10 8 CFU / mL, and deltamethrin in inorganic salt liquid medium (NH4Cl 2.0 g / L, K2HPO4 0.7 g / L, KH2PO4 0.7 g / L, MgSO4 0.4 g / L, pH = 6.8, 121 ℃ high pressure steam sterilization for 20 min) for co-culture, to degrade deltamethrin.

[0057] The co-culturing conditions are as follows: inoculation amount is 2%; pH value of the culture medium is 8.0; and the culture is carried out at 30℃ and 180r / min for 4 days.

[0058] Example 9

[0059] The Trichoderma harzianum GZUAS681023 is activated in PDA agar medium, and spores are washed with sterile water to adjust the spore concentration to 10 8 CFU / mL, and the spores are co-cultured with deltamethrin in inorganic salt liquid medium (ammonium chloride 2.0g / L, dipotassium hydrogen phosphate 0.7g / L, potassium dihydrogen phosphate 0.7g / L, magnesium sulfate 0.4g / L, pH=6.8, 121℃ high-pressure steam sterilization for 20min) to degrade deltamethrin.

[0060] The co-culturing conditions are as follows: inoculation amount is 2%; pH value of the culture medium is 8.0; and the culture is carried out at 35℃ and 180r / min for 4 days.

[0061] Example 10

[0062] The Trichoderma harzianum GZUAS681023 is activated in PDA agar medium, and spores are washed with sterile water to adjust the spore concentration to 10 8 CFU / mL. The spore suspension is sprayed on agaric vegetables with deltamethrin residues, and the spraying amount is adjusted according to the dripping of leaves to degrade the deltamethrin residues in the agaric vegetables.

[0063] In order to further verify the reliability of the application and screen out the best scheme, the inventors have carried out a series of tests, which are as follows:

[0064] 1. Isolation and screening of strains

[0065] (1) 10g of soil polluted by deltamethrin for a long time is weighed and added to 100mL of sterile water, and homogenized for 6min and then placed for 3min. 10mL of supernatant is taken and added to 100mL of PDA liquid medium, and enrichment culture is carried out at 28℃ and 180r / min for 4 days.

[0066] (2) 10mL of the enrichment culture liquid is taken and added to inorganic salt liquid medium (ammonium chloride 2.0g / L, dipotassium hydrogen phosphate 0.7g / L, potassium dihydrogen phosphate 0.7g / L, magnesium sulfate 0.4g / L, pH=6.8, 121℃ high-pressure steam sterilization for 20min) containing 50mg / L of deltamethrin, and the culture is carried out at 28℃ and 180r / min for 5 days.

[0067] (3) 1mL of the bacterial liquid is diluted to 10 6 -10 8, coated in inorganic salt agar medium containing deltamethrin, 28℃ constant temperature inverted culture for 5d; pick up different fungal colonies in fresh PDA medium, repeatedly purified 3-4 times to obtain pure fungi.

[0068] 2. Strain identification

[0069] 2.1 Morphological identification

[0070] The purified fungi were taken out and streaked on PDA agar medium, and placed in a constant temperature incubator at 25℃ in the dark for 7d. The colonies were picked up and observed under a microscope for fungal morphology and spores. The morphological identification results are shown in Figure 1 , where: a is the fungal morphology under the microscope; b is the conidium under the microscope; c is the colony morphology.

[0071] It was found that the colonies of strain GZUAS681023 were hairy and radiated on PDA plates, and would cover the entire PDA plate in about 4d, with a dense spore-producing bundle zone in the middle, showing concentric growth. After the colonies gradually matured, the color changed from white to yellow-green. The spore stalks were tree-shaped, with interlaced or opposite branches, and the main axis was straight. The spore stalks had 2-3 small stems, which were bottle-shaped and relatively short, with a thin bottom, a swollen middle, and a thin top. The conidia were spherical or oval, with a size of 2.8μm×3.0μm, with a flat base and smooth wall, and were successively produced from the small stems.

[0072] 2.2 Molecular biological identification

[0073] Strain GZUAS681023 was streaked on PDA agar medium and placed in a constant temperature incubator at 25℃ for 3d. The mycelium was inoculated in PDA liquid medium and sent to Guangzhou Aik Biotechnology Co., Ltd. for sequencing. The ITS rRNA gene sequence is as follows:

[0074] CCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAAC

[0075] GTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCC

[0076] CCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTTTTGTATACC

[0077] CCCTCGCGGGTTTTTTTTATAATCTGAGCCTTCTCGGCGCCTCTCGTAGGCG

[0078] TTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATC

[0079] GATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAG

[0080] TGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGG

[0081] CATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGC

[0082] GTTGGGGATCGGCCCTGCCTCTTGGCGGTGGCCGTCTCCGAAATACAGTGG

[0083] CGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGA

[0084] GCGCGGCGCGTCCACAGCCGTTAAACACCCAACTTCTGAAATGTTGACCTC

[0085] GGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCA

[0086] The sequence was uploaded to the NCBI database, and the results of BLAST comparison are shown in Table 1. It was found that the similarity of strain GZUAS681023 with Trichoderma harzianum was 100%. The phylogenetic tree of strain GZUAS681023 was constructed by using MEGA X software (as shown in Figure 2 Table 1), and it was found that strain GZUAS681023 was in the same branch as KY644130.1.

[0087] Table 1 BLAST comparison results of strain GZUAS681023

[0088]

[0089] According to the morphological characteristics of strain GZUAS681023, combined with the ITS sequence comparison results, strain GZUAS681023 was identified as Trichoderma harzianum.

[0090] 3. Degradation test of deltamethrin by strain GZUAS681023 under different pH conditions

[0091] (1) The strain GZUAS681023 was activated in PDA agar medium, and spores were washed with sterile water to adjust the spore concentration to 10 8 CFU / mL. Inorganic salt liquid medium with pH values of 4.0, 6.0, 8.0, and 10.0 and a deltamethrin concentration of 50 mg / L was prepared.

[0092] (2) The spore suspension was inoculated into the deltamethrin inorganic salt liquid medium with different pH values at an inoculation amount of 2%, and the inorganic salt liquid medium containing the drug without inoculation was used as a blank control. The culture was incubated at 28°C and 180 r / min for 4 days.

[0093] (3) The residual amount of deltamethrin was determined according to GB 23200.121-2021 "Determination of residues of 331 pesticides and their metabolites in plant-derived food by liquid chromatography-mass spectrometry", and the degradation rate of deltamethrin was calculated according to the following formula:

[0094] Deltamethrin degradation rate (%) = [1-(measured residual amount / control group measured residual amount)] x 100%

[0095] The effect of different pH values on the degradation of deltamethrin by the strain is shown in Figure 3 Table 2 shows the deltamethrin degradation rate under different pH conditions. As shown in Table 2, the degradation rates of deltamethrin were 71.52%, 69.88%, 75.31%, and 73.63% under pH conditions of 4.0, 6.0, 8.0, and 10.0 for 4 days, respectively, indicating that the strain GZUAS681023 has good tolerance to pH, and has high degradation efficiency and stable degradation effect under acidic and alkaline conditions.

[0096] Table 2 Deltamethrin degradation rate under different pH conditions

[0097]

[0098] 4. Degradation test of deltamethrin by strain GZUAS681023 under different temperature conditions

[0099] (1) The strain GZUAS681023 was activated in PDA agar medium, and spores were washed with sterile water to adjust the spore concentration to 10 8 CFU / mL. Inorganic salt liquid medium with pH values of 4.0, 6.0, 8.0, and 10.0 and a deltamethrin concentration of 50 mg / L was prepared.

[0100] (2) The spore suspension was inoculated into deltamethrin inorganic salt liquid culture medium at an inoculation rate of 2%. The inorganic salt liquid culture medium containing the drug but not inoculated was used as a blank control. The culture temperatures were set at 20℃, 25℃, 30℃ and 35℃, and the culture was shaken at 180r / min for 4 days.

[0101] (3) The residue of deltamethrin was determined according to GB 23200.121-2021 "Determination of the residues of 331 pesticides and their metabolites in plant-derived foods by liquid chromatography-mass spectrometry" and the degradation rate of deltamethrin was calculated.

[0102] The effects of different temperature conditions on the degradation of deltamethrin by the strain, such as Figure 4 As shown in Table 3, the degradation rates of deltamethrin under different temperature conditions are as follows. Table 3 shows that after culturing at temperatures of 20℃, 25℃, 30℃, and 35℃ for 4 days, the degradation rates of deltamethrin were 68.37%, 70.64%, 73.85%, and 67.91%, respectively. This indicates that *Trichoderma harzianum* GZUAS681023 has good tolerance to culture temperature and exhibits high degradation efficiency for deltamethrin under both low and high temperature conditions, with stable degradation performance.

[0103] Table 3. Degradation rate of deltamethrin under different temperature conditions

[0104]

[0105] 5. Degradation test of deltamethrin in indoor potted Malabar spinach by strain GZUAS681023

[0106] (1) The strain GZUAS681023 was activated in PDA agar medium, and the spores were washed off with sterile water to adjust the spore concentration to 10. 8 CFU / mL.

[0107] (2) Select healthy and disease-free Malabar spinach, spray with 25g / L deltamethrin EC, and spray with Trichoderma harzianum GZUAS681023 spore suspension after 1 hour. The amount of water dripping from the leaves is the standard. The group without spore suspension spraying is the control. Each group is repeated 3 times.

[0108] (3) Take samples on the 2nd, 3rd, 4th and 5th days respectively and determine the residual amount of deltamethrin according to GB 23200.121-2021 "Determination of the Residues of 331 Pesticides and Their Metabolites in Plant-Derived Foods by Liquid Chromatography-Mass Spectrometry" and calculate the degradation rate of deltamethrin.

[0109] Malabar spinach leaves sprayed with deltamethrin, such as Figure 5 As shown, the leaves of Malabar spinach sprayed with Trichoderma harzianum GZUAS681023 spore suspension and deltamethrin are as follows: Figure 6The results of the degradation rate of deltamethrin in the indoor potted wood ear vegetable at different time points are shown in Table 4. As shown in Table 4, the degradation rate of deltamethrin in the wood ear vegetable reached 71.31% on the 5th day after spraying the Trichoderma harzianum GZUAS681023 spore suspension, indicating that the Trichoderma harzianum GZUAS681023 has a good degradation effect on deltamethrin in the wood ear vegetable, and at the same time provides a technical reference for popularizing and applying the Trichoderma harzianum GZUAS681023 to the degradation of deltamethrin in other plants, water bodies and soils.

[0110] Table 4 Degradation rate of deltamethrin in indoor potted wood ear vegetable at different time points after spraying spore suspension

[0111]

[0112] Although the present application has been described in detail with general description, specific embodiments and experiments above, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of the present application claimed.

Claims

1. A strain of Trichoderma harzianum GZUAS681023, which was deposited with the Guangdong Microbial Culture Collection Center on July 26, 2024, and has the accession number GDMCC NO: 64912.

2. Use of the Trichoderma harzianum GZUAS681023 of claim 1 in degrading deltamethrin.

3. Use according to claim 2, characterized in that, The use specifically involves co-culturing a spore suspension of the Trichoderma harzianum GZUAS681023 and deltamethrin in a culture medium to degrade the deltamethrin.

4. Use according to claim 3, characterized in that, The spore concentration in the spore suspension of the Trichoderma harzianum GZUAS681023 is 10 8 CFU / mL.

5. Use according to claim 3, characterized in that, The culture medium is an inorganic salt liquid medium, specifically: 2.0 g / L of ammonium chloride, 0.7 g / L of dipotassium hydrogen phosphate, 0.7 g / L of potassium dihydrogen phosphate, 0.4 g / L of magnesium sulfate, pH = 6.8, 121°C high-pressure steam sterilization for 20 min.

6. Use according to claim 3, characterized in that, The co-culturing specifically involves inoculating the spore suspension into the culture medium with a pH value of 4.0-10.0 at an inoculation amount of 2%, and then oscillating the culture at a culture temperature of 20-35°C and a rotation speed of 180 r / min for 4 d.

7. Use according to claim 6, characterized in that, In the co-culturing, the pH value of the culture medium is 8.0, and the culture temperature is 28°C.

8. Use of the Trichoderma harzianum GZUAS681023 of claim 1 in preparing a microbial inoculant for degrading deltamethrin.

9. Use of the Trichoderma harzianum GZUAS681023 of claim 1 in degrading deltamethrin in soil, water, and plants.

10. Use according to claim 9, characterized in that, The plants are wood ear vegetables.