A strain of Aspergillus chevallis and its applications

By using Aspergillus spp. strains, the problem of monotonous flavor in fermented dairy products and soy sauce in existing technologies has been solved, achieving efficient fermentation and improving the fermentation effect. This has solved the technical problems of fermentation in existing technologies, realized efficient technology application, solved the problem of monotonous flavor in existing technologies, and achieved diversified flavor effects.

CN120905041BActive Publication Date: 2025-12-02COFCO NUTRITION AND HEALTH RESEARCH INSTITUTE CO LTD +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511406953.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-29
Publication Date
2025-12-02
Estimated Expiration
2045-09-29

AI Technical Summary

Technical Problem

Existing lactic acid bacteria strains produce fermented dairy products and soy sauces with a single flavor profile and lack complex flavor layers, leading to product homogenization and making it difficult to create a distinctive and memorable product.

Method used

Using Aspergillus chevalieri (CGMCC No. 42131) as a novel strain, this strain utilizes multiple carbon sources for metabolism, fermenting dairy products and soy sauce. By preparing diverse metabolites, including D-minotriose and cellobiose, it generates higher alcohols and fruity aroma compounds, thereby enhancing flavor diversity.

Benefits of technology

Aspergillus chewasserle can produce a variety of metabolites, which enhance the flavor of fermented dairy products and soy sauce, and improve the nutritional value of food.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905041B_ABST
    Figure CN120905041B_ABST
Patent Text Reader

Abstract

This invention relates to the field of microorganisms and discloses a strain of Aspergillus chevallis and its applications. The Aspergillus chevallis provided by this invention has the accession number CGMCC No.42131. This Aspergillus chevallis can be used for fermentation to prepare soy sauce or dairy products, thereby improving the fermentation effect of soy sauce or dairy products.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbiology, and more specifically to a strain of Aspergillus chevallis and its applications. Background Technology

[0002] In the dairy processing industry, lactic acid bacteria are commonly used to produce fermented dairy products such as yogurt and cheese. Dairy products fermented with lactic acid bacteria as the main starter culture have long held a significant share of the global dairy consumption market. However, existing lactic acid bacteria strains used for large-scale production are mainly concentrated in a few classic strains such as Lactobacillus bulgaricus and Streptococcus thermophilus. Although these strains have advantages such as strong fermentation stability and controllable costs after decades of industrial application, their metabolic pathways are highly defined, and the flavor composition of the fermentation products tends to be fixed. Specifically, the flavor is mostly dominated by a single lactic acid fermentation taste, supplemented by a small amount of added sugar or flavoring to create sweetness and fruitiness, lacking the complex flavor layers produced by strain-specific metabolism; in terms of taste, they generally exhibit homogeneous viscosity and acidity, making it difficult to create differentiated product memorability. Similar problems exist in the soy sauce fermentation industry.

[0003] Therefore, developing a novel strain that can be used for fermentation of dairy products or soy sauce has significant technological breakthrough value and promising industrial application prospects. Summary of the Invention

[0004] The purpose of this invention is to overcome the above-mentioned problems existing in the prior art and to provide a strain of Aspergillus chevallis and its applications.

[0005] To achieve the above objectives, the first aspect of the present invention provides a strain of Aspergillus chevaleri ( Aspergillus chevalieri The preservation number of Aspergillus chevaleri is CGMCC No. 42131.

[0006] A second aspect of the present invention provides a composition for preparing soy sauce koji, the composition comprising koji material and Aspergillus cherubicin as described in the first aspect.

[0007] The third aspect of the present invention provides a method for preparing soy sauce koji, the method comprising: culturing the Aspergillus spp. described in the first aspect into koji material, or culturing the composition described in the second aspect.

[0008] The fourth aspect of the present invention provides a method for brewing soy sauce, wherein the method includes: inoculating soybean raw material with soy sauce koji prepared by the method described in the third aspect for fermentation.

[0009] The fifth aspect of the present invention provides a method for fermenting yogurt or cheese, the method comprising: inoculating the Aspergillus cheovalis described in the first aspect into dairy product raw materials for dairy product fermentation.

[0010] The sixth aspect of the present invention provides the use of Aspergillus chewasserus as described in the first aspect in the production of soy sauce, yogurt or cheese.

[0011] Through the above technical solution, the Aspergillus schwanniferus with accession number CGMCC No.42131 provided by the present invention can be used for fermentation to prepare soy sauce or dairy products, and can improve the fermentation effect of soy sauce or dairy products.

[0012] Biological Preservation

[0013] The strain provided by this invention is classified as *Aspergillus chevaleri*. Aspergillus chevalieri It was deposited on July 16, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42131 and address at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0014] Figure 1 This is a colony morphology diagram of CCNH109 on a culture medium plate provided by the present invention;

[0015] Figure 2 This is a microscopic morphological image of CCNH109 provided by the present invention. Detailed Implementation

[0016] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0017] The inventors of this invention isolated a strain of *Aspergillus cherubicin* CCNH109 during the brewing process of baijiu (Chinese liquor) and accidentally discovered that this *Aspergillus cherubicin* CCNH109 possesses the ability to ferment soy sauce or dairy products. Furthermore, the *Aspergillus cherubicin* CCNH109 provided by this invention can ferment Tween 80, N-acetyl-β-D-glucosamine, N-acetamide-β-D-mannosamine, ribitol, apricotyl, D-arabinose, L-arabinose, D-arabinol, arbutin, D-cellobiose, dextrin, erythritol, and D... Fructose, D-galactose, gentiobiose, D-gluconic acid, D-glucosamine, α-D-glucose, α-D-glucose-1-phosphobenzyl salt, glycerol, glycogen, m-cellulose alcohol, maltose, maltotriose, D-mannitol, D-mannose, D-mellothiose, α-methyl-D-galactoside, β-methyl-D-galactoside, β-methyl-D-glucosinolate, 6-OD-glucopyranoyl-D-fructofuranose, D-allulose, D-mellothiose, L-rhamnose, D-ribose, salicin, sedoheptalan, D-sorbitol, L-sorbitol, mesonibiose, xylitol, D-xylose, γ-aminobutyric acid, bromosuccinic acid Using fumaric acid, D-lactic acid methyl ester, L-lactic acid, P-hydroxyphenylacetic acid, malic acid, succinic acid, succinic acid, methyl succinate, methyl methyl-L-glutamic acid, L-aspartic acid, L-glutamic acid, glycyl-L-glutamic acid, ornithine, sucrose, α-D-lactose, proline, pyroglutamic acid, L-serine, 2-aminoethanol, and L-alanine as carbon sources for growth and metabolism, *Aspergillus spp.* CCNH109 unexpectedly possesses the ability to utilize D-melatonin and cellobiose, increasing the fruit aroma of higher alcohols such as isoamyl alcohol and isobutanol, as well as fruit aromas such as ethyl acetate and acetaldehyde (green apple flavor) in the fermentation system. In other words, the *Aspergillus spp.* CCNH109 provided by this invention has a broad carbon source utilization spectrum and can generate diverse metabolites, effectively decomposing complex sugars, producing more flavor substances, and enhancing the nutritional value of food.

[0018] Based on the above findings, the first aspect of the present invention provides a strain of Aspergillus chevaleri ( Aspergillus chevalieri The preservation number of Aspergillus chevaleri is CGMCC No. 42131.

[0019] In this invention, "Aspergillus serrata CCNH109", "strain CCNH109" and "CCNH109" all refer to Aspergillus serrata with accession number CGMCC No.42131.

[0020] A second aspect of the present invention provides a composition for preparing soy sauce koji, the composition comprising koji material and Aspergillus cherubicin as described in the first aspect.

[0021] Preferably, the content of *Aspergillus spores* is 0.1-1 wt% of the dry weight of the koji.

[0022] Preferably, the koji material comprises wheat bran and water.

[0023] The third aspect of the present invention provides a method for preparing soy sauce koji, the method comprising: culturing the Aspergillus spp. described in the first aspect into koji material, or culturing the composition described in the second aspect.

[0024] Preferably, the culture temperature is 25-35℃.

[0025] Preferably, the humidity of the culture is 80-90%.

[0026] Preferably, the incubation time is 48-96 h.

[0027] According to the present invention, the koji material may be sterilized before cultivation. The sterilization method may be a method conventionally used in the art, which will not be described in detail here.

[0028] According to the present invention, the koji material can be steamed before the cultivation. According to a specific embodiment of the present invention, the steaming method includes steaming the koji material at a temperature of 115-130°C for 15-25 minutes.

[0029] The fourth aspect of the present invention provides a method for brewing soy sauce, wherein the method includes: inoculating soybean raw material with soy sauce koji prepared by the method described in the third aspect for fermentation.

[0030] The soybean raw material can be prepared according to methods conventionally used in the art. According to some specific embodiments of the present invention, the preparation method of the soybean raw material includes: soaking and steaming soybeans, then mixing in salt and water, wherein the amount of salt (sodium chloride) is 0.1-0.3 g and the amount of water is 1-3 g relative to 1 g of soybeans.

[0031] Preferably, the fermentation is carried out in the presence of salt, which can be a salt commonly used in the art. According to a specific embodiment of the present invention, the salt is sodium chloride.

[0032] Preferably, the fermentation temperature is 35-50°C.

[0033] Preferably, the fermentation time is 15-35 days.

[0034] According to the present invention, the fermentation product can be post-processed after fermentation. The post-processing method can be a method conventionally used in the art. According to a specific embodiment of the present invention, the post-processing method includes adding brine to the fermentation product and heating.

[0035] The Aspergillus serrulata CCNH109 provided by this invention can be applied to fermented foods such as sauces (fermented broad bean paste, soybean paste, and wheat paste), fermented black beans, natto, fermented bean curd, and miso to enhance the flavor of fermented products.

[0036] The fifth aspect of the present invention provides a method for fermenting yogurt or cheese, the method comprising: inoculating the Aspergillus cheovalis described in the first aspect into dairy product raw materials for dairy product fermentation.

[0037] According to the present invention, the method for fermenting dairy products further includes: adding a compound bacteria to the dairy product raw materials, wherein the compound bacteria can be strains commonly used in fermented dairy products, and according to the present invention, the lactic acid bacteria can be *Lactobacillus plantarum* (…). Lactobacillus plantarum ), Lactococcus lactis ( Lactococcus lactis ) and Leuconostoc membranaceus ( Leuconostoc mesenteroides At least one of the following.

[0038] Preferably, the ratio of the number of viable bacteria of the compound bacteria to that of Aspergillus chevallaris CCNH109 (or the ratio of the number of viable bacteria to the number of spores) is 1:(0.5-2).

[0039] Preferably, the fermentation temperature is 35-45℃.

[0040] Preferably, the fermentation time is 1-50 h.

[0041] The sixth aspect of the present invention provides the use of Aspergillus chewasserus as described in the first aspect in the production of soy sauce, yogurt or cheese.

[0042] The present invention will be described in detail below through examples. Unless otherwise specified, the reagents and materials used in the following examples are all commercially available products purchased from regular chemical or biological reagent / material suppliers, and all reagents are of analytical grade.

[0043] Reference strain: Aspergillus cheivae, CICC41680, purchased from China Industrial Microbial Culture Collection Center;

[0044] Coronavirus ( Eurotium cristatum ), CGMCC No. 19604, recorded in CN113249233A;

[0045] Shanghai-brewed 3.042 Aspergillus oryzae ( Aspergillus oryzae CICC2339 was purchased from the China Industrial Microbial Culture Collection Center.

[0046] Example 1

[0047] The inventors of this invention isolated a bacterial strain from a sample of fermented baijiu (Chinese liquor) and named it CCNH109. Figure 1 andFigure 2 The image shows the morphology of CCNH109. The colony is smooth with radial grooves, yellowish-brown in the center and pale yellow around the edges, with a velvety, fine texture. The Bt2a sequence of CCNH109 is shown in SEQ ID NO.1, and... Aspergillus chevalieri The Bt2a sequence similarity was 99.27%. Based on both morphological and Bt2a sequence similarities, CCNH109 is identified as Aspergillus chevaleris.

[0048] SEQ ID NO.1:

[0049] TGTCCGCTTTTAATAGAGTCAGATTGGGTGATATACTAACAGTATCACAGGCAGACTATTCTCCGGCGAGCACGGTCTCGACGGCTCTGGTGTAAGTACAGTCGGGTCTCCGAGATGGACGCGTATCGGATATGGATATCTAAATGGATTGCAGCTACAATGGCTCCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCA ACGAGGTTTGCCTAATTCATTCGTGTCTGTGTGGGAAACAGTTCTGACAGTGACAGGCCTCCAACAAATATGTCCCCCGTGCCGTCCTCGTCGACCTTGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCCTTCGGCCAGCTCTTCCGTCCCGATAACTTCGTTTTCGGTCAGTCCGGTGCCGGTAACAACTGGGCCAA

[0050] Example 2

[0051] CCNH109 cells were cultured on malt extract medium at 28°C until sporulation occurred. A spore suspension was prepared in a Class II biosafety cabinet. The turbidity was adjusted to 100%T (T being the turbidity value) using an FF-IF inoculum on a turbidimeter. A cotton swab was dipped in clean inoculum and rolled on the surface of the plate to collect spores. The spore-laden swab was then repeatedly smeared up and down on the dry upper wall of the inoculum to disperse the spores. The inoculum was then rinsed down to create a homogeneous spore suspension. The bacterial concentration of the suspension was accurately adjusted to 75%T, with a tolerance of 2%. The prepared suspension was quickly poured into a V-shaped trough and inoculated onto FF plates (100 μL per well) using a pipette. The plates were incubated at 28°C for 4 days. After incubation, the results were analyzed using Microlog™ 3 software in a BIOLOG instrument.

[0052] The results showed that CCNH109 could utilize Tween 80, N-acetyl-β-D-glucosamine, N-acetamide-β-D-mannitol, ribitol, apricotyl, D-arabinose, L-arabinose, D-arabinol, arbutin, D-cellobiose, dextrin, erythritol, D-fructose, D-galactose, gentiobiose, D-gluconic acid, D-glucosamine, α-D-glucose, α-D-glucose-1-phosphoside, glycerol, glycogen, m-cellulose alcohol, maltose, maltotriose, D-mannitol, D-mannose, D-mercaptotriose, α-methyl-D-galactoside, β-methyl-D-galactoside, β-methyl-D-glucosinolate, 6-OD-glucopyranoyl-D-fructofuranose, D-allulose, D-melatotriose, L-rhamnose, D-ribose, salicin, and sedum. Heptanal polysaccharides, D-sorbitol, L-sorbitol, mesobiose, xylitol, D-xylose, γ-aminobutyric acid, bromosuccinic acid, fumaric acid, D-methyl lactate, L-lactic acid, P-hydroxyphenylacetic acid, malic acid, succinic acid, succinic acid, methyl succinate, methyl methyl succinate, methyl acyl-L-glutamic acid, L-aspartic acid, L-glutamic acid, glycyl-L-glutamic acid, ornithine, sucrose, α-D-lactose, proline, pyroglutamic acid, L-serine, 2-aminoethanol, and L-alanine are used as carbon sources for growth and metabolism. However, CICC41584, mentioned in "Identification and Optimization of Culture Conditions of a Strain of *Cynotrophomonas* in Baijiu Daqu," cannot utilize D-melanotriose and cellobiose. The CCNH109 of this invention has a broad carbon source utilization spectrum and can generate a variety of metabolites. It can effectively decompose complex sugars, produce more flavor substances, increase the proportion of digestible sugars, and improve the nutritional value of food. The D-minotriose and cellobiose in it can add higher alcohols such as isoamyl alcohol and isobutanol to the fermentation system, as well as fruit flavors such as ethyl acetate and acetaldehyde (green apple flavor).

[0053] Example 3

[0054] CCNH109 was inoculated onto sterile wheat bran with a moisture content of 70 wt%, and the inoculation was repeated every 12 hours for 5 days. The spores were then dried at 35℃ to obtain spore powder, and the spore count was determined to be 10⁻⁶. 9 per g.

[0055] Preparation of soy sauce koji: Wheat bran with 45 wt% moisture content was steamed at 121℃ for 20 min, cooled to 30℃, and inoculated with CCNH109 spore powder at a rate of 0.3 wt%. The koji was cultured at 30℃ for 72 h, with the koji being turned once a day. After cultivation, it was dried at low temperature to obtain soy sauce koji. A control group inoculated with *Aspergillus oryzae* strain 3.042 was also included.

[0056] Lipase activity: One enzyme activity unit is defined as the rate at which 1 μmol of fatty acids is produced per minute from the hydrolysis of olive oil by 1 gram of soy sauce koji. Lipase catalyzes the hydrolysis of oil esters into fatty acids, and the fatty acid content is determined using the copper soap method.

[0057] The activity of glucosidase is defined as follows: at 37℃ and pH=5.0, one unit of enzyme activity is defined as the production of 1 nmol of p-nitrophenol per minute per gram of soy sauce koji. α-Glucosidase decomposes p-nitrophenyl-α-D-glucopyranoside to generate p-nitrophenol, and β-glucosidase decomposes p-nitrophenyl-β-D-glucopyranoside to generate p-nitrophenol. p-Nitrophenol has a maximum absorption peak at 400 nm.

[0058] Amylase activity: Under conditions of 4℃ and pH=5.2, the amount of enzyme required per gram of soy sauce koji to catalyze the production of 1 mg of reducing sugar from α-1,4-glycosidic bonds in starch per minute is defined as one unit of enzyme activity. The reducing sugar reduces 3,5-dinitrosalicylic acid to a brownish-red substance. α-Amylase is intolerant of acid, and β-amylase is intolerant of heat. Based on these characteristics, the activity of another type of amylase can be measured after inactivation at 70℃ for 15 min. The absorbance at 540 nm was used for detection.

[0059] Pectinase activity: Under conditions of 50℃ and pH=3.5, one unit of enzyme activity is defined as the production of 1 mg of galacturonic acid per hour from pectin by 1 gram of soy sauce koji. Pectinase hydrolyzes pectin to produce galacturonic acid, which has a reducing aldehyde group. It reacts with DNS reagent to produce a reddish-brown substance, and the absorbance at 540 nm is detected by an enzyme-linked immunosorbent assay (ELISA) reader or a visible light spectrophotometer.

[0060] Ferulic acid esterase activity: Under conditions of 40℃ and pH=6.0, one enzyme activity unit is defined as the amount of p-nitrophenol produced per minute by hydrolyzing ferulic acid p-nitrophenyl ester per gram of soy sauce koji. Ferulic acid esterase catalyzes the decomposition of the substrate ferulic acid p-nitrophenyl ester to produce p-nitrophenol, which has a maximum absorption peak at 405 nm.

[0061] Tanninase activity: One unit of enzyme activity is defined as the amount of enzyme required to hydrolyze 0.01 µmol of propyl gallate per minute per gram of soy sauce koji at 40℃ and pH=5.0. Propyl gallate, an antioxidant, was used as the substrate for the tanninase enzymatic reaction, and the absorbance of the substrate before and after the reaction was measured at 270 nm.

[0062] Cellulase activity: The amount of enzyme required to catalyze the production of 1 μg of reducing sugar from sodium carboxymethyl cellulose per minute by 1 gram of soy sauce koji at 37℃ and pH=5.5 is defined as one unit of enzyme activity. The content of reducing sugar produced by cellulase catalyzing the degradation of sodium carboxymethyl cellulose was determined by the anthrone colorimetric method, and the absorbance at 620 nm was measured.

[0063] Glutaminase activity: One unit of enzyme activity is defined as the rate at which one gram of soy sauce koji catalyzes the production of 1 nmol of ammonia from glutamine per minute. Glutaminase catalyzes the hydrolysis of glutamine into L-glutamic acid and ammonia. The rate of ammonia increase is detected using Nessler's reagent, and the absorbance at 420 nm is measured.

[0064] Aminopeptidase activity: The level of aminopeptidase in the sample was determined using a double-antibody sandwich method. A microplate was coated with purified aminopeptidase antibody to prepare a solid-phase antibody. Soy sauce koji was added sequentially to the wells coated with monoclonal antibody, followed by binding with HRP-labeled aminopeptidase antibody to form an antibody-antigen-enzyme-labeled antibody complex. After thorough washing, the substrate TMB was added for color development. TMB was converted to blue under the catalysis of HRP enzyme, and then to yellow under acidic conditions. The color intensity was positively correlated with the aminopeptidase level in the sample. Absorbance was measured at 450 nm.

[0065] Protease activity: At 30℃ and neutral (pH=7.0), one enzyme activity unit is defined as 1 nmol of tyrosine produced per minute by catalyzing the hydrolysis of casein by each gram of soy sauce koji. Protease hydrolyzes casein to produce tyrosine, which in turn reduces phosphomolybdic acid to form tungsten blue; tungsten blue has a characteristic absorption peak at 680 nm.

[0066] Saccharifying enzyme activity: At 40℃ and pH=4.6, the amount of enzyme required to break down soluble starch to produce 1 mg of glucose per minute per gram of soy sauce koji is defined as one unit of enzyme activity. Saccharifying enzymes hydrolyze soluble starch to produce glucose, which then reacts with 3,5-dinitrosalicylic acid to form a reddish-brown compound with maximum light absorption at 540 nm. Within a certain range, the color intensity of the reaction solution is directly proportional to the amount of glucose.

[0067] A standard curve was established to measure the concentration of degradation products of the above-mentioned enzyme activity-related substrates versus absorbance values ​​to determine the enzyme activity of the test strains. Enzyme activity units were expressed as nmol / (min × g soy sauce koji), and the results are shown in Table 1.

[0068] Using the enzyme activity of Aspergillus oryzae in Huniang 3.042 as the baseline (activity = 1), the relative enzyme activity of CCNH109 represents its multiple of enzyme activity relative to Huniang 3.042.

[0069] Table 1

[0070]

[0071] After soaking and cooking soybeans, a low-salt solid-state fermentation process was adopted: NaCl aqueous solution (salt content 13.5wt%) was added, and the soybeans were soaked and cooked at a salt water weight ratio of 1:1.7. The mixture was placed in a constant temperature incubator, and the fermentation temperature was controlled within 40-55℃ for 25 days. The matured soy sauce mash was then placed in earthenware jars, and salt water (salt content 13.5wt%) was added in two batches for soaking and oil extraction. The mixture was then heated at 85±5℃ for 10 minutes to obtain the finished soy sauce. Finally, the characteristic chemical components were measured and sensory evaluation was performed.

[0072] The total acid content was determined according to GB12456—2021 "Determination of Total Acidity in Food";

[0073] The amino acid nitrogen content was determined according to GB5009.235—2016 (Determination of Amino Acid Nitrogen in Food);

[0074] The total nitrogen content was determined according to the method for total nitrogen in GB5009.5—2016 "Determination of Protein in Food".

[0075] The glutamic acid content was determined using a fully automated amino acid analyzer.

[0076] The results are shown in Table 2.

[0077] Table 2

[0078]

[0079] The soy sauce brewed with CCNH109 is comparable to that brewed with Huniang 3.042 in terms of total acidity, amino acid nitrogen, total nitrogen, glutamic acid, and sensory evaluation. However, it has a higher total acidity than Huniang 3.042 and a better ester aroma.

[0080] Example 4

[0081] (a) Fermented Yogurt

[0082] Fresh milk was treated at 90℃ for 15 min and inoculated with CCNH109 and the first compound lactic acid bacteria (Lactobacillus plantarum). Lactobacillus plantarum (CGMCC No. 15013, described in CN109423467A), the inoculation live bacteria / spore count was 10. 5The mixture was stirred evenly at 42℃ for 4 h, with the fermentation time determined based on the curd state. After fermentation, the mixture was stored at 4℃ for 24 h to obtain the compound group. A control group without CCNH109 inoculant was set up. Sensory evaluation showed that, compared to the control group, the compound group enhanced the ester aroma, grassy aroma, and umami flavor of the yogurt. The 1-octen-3-ol content in the compound group, measured using headspace solid-phase microextraction-gas chromatography-mass spectrometry, reached 398 mg / kg, an increase of 895% compared to the control group. The physical properties of the compound group and the control group were tested, and the results are shown in Table 3.

[0083] Acidity test method: Refer to GB 5009.239-2016 "National Food Safety Standard - Determination of Acidity in Food";

[0084] Methods for testing the viscosity, stringiness, and hardness of yogurt: The texture of yogurt was evaluated using the methods described in Wu Xueyan's "Correlation Study between Sensory Evaluation and Texture of Yogurt" [J]. China Dairy Industry, 2015, 43(10): 52-54.

[0085] Table 3

[0086]

[0087] (ii) Fermented cheese

[0088] Fresh whole milk was treated at 73℃ for 30 min, then naturally cooled and inoculated with a second compound lactic acid bacteria (30 mg / L, FloraDanica starter, purchased from Chr. Hansen, documented at doi.org / 10.3389 / fnut.2021.649611) and CCNH109 (10 5 Ferment at 32°C for 1 h using 10 spores / mL, then add rennet (0.1 g / L). After 1.5 h, cut the curd into hazelnut-sized pieces and stir at 32°C for 20 min. Add CCNH109 spores and curd sequentially to a mold (11 cm in diameter, 11 cm in height) according to the following procedure: evenly sprinkle 10... 5 1 spore - add to 100mL of curd - evenly sprinkle 10 spores on the surface of the curd 5Add 100 mL of curd to each spore and repeat the above steps until the mold is full. Fermentation temperature is 20℃, and the mixture is left to stand for 12 h under no pressure to remove the buttermilk. Then, it is dry-salted at 20℃ for 24 h. It is then dried at 14℃ and 70% humidity for 24 h, punctured, and matured at 28℃ for 5 days, 14℃ for 14 days, and 4℃ for 14 days at a relative humidity of 85%. A control group without CCNH109 inoculant was also included. Sensory evaluation showed that, compared to the control group, the blended group had enhanced grassy, ​​creamy, and umami flavors. The 1-octen-3-ol content in the blended group was measured to be 691 mg / kg using headspace solid-phase microextraction-gas chromatography-mass spectrometry, which was 340% higher than that in the control group. A texture analyzer was used to evaluate the cheese samples using a P / 50 probe. The speed before and after testing was 5 mm / s, the testing speed was 1 mm / s, and the testing distance was 7 mm. Based on the measurement results, the instrument's built-in software was used to perform texture profile analysis to test the physical properties of the cheese samples prepared in the compound group and the control group. The physical properties of the cheese samples prepared in the compound group and the control group and their results are shown in Table 4.

[0089] Table 4

[0090]

[0091] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. A strain of Aspergillus chevaleri ( Aspergillus chevalieri ), characterized in that, The preservation number of the *Aspergillus chevaleri* is CGMCC No. 42131.

2. A composition for preparing soy sauce koji, characterized in that, The composition comprises koji and Aspergillus chebula as described in claim 1.

3. The composition according to claim 2, wherein, The content of *Aspergillus spores* is 0.1-1 wt% of the dry weight of the koji material. And / or, the koji material includes bran and water.

4. A method for preparing soy sauce koji, characterized in that, The method includes: culturing the Aspergillus schwanniferum strain of claim 1 into koji material, or culturing the composition of claim 2 or 3.

5. The preparation method according to claim 4, wherein, The culture temperature is 25-35℃; And / or, the humidity of the culture is 80-90%; And / or, the incubation time is 48-96 hours.

6. A method for brewing soy sauce, characterized in that, The method includes: inoculating soybean raw materials with the soy sauce koji prepared by the method of claim 4 or 5 for fermentation.

7. The brewing method according to claim 6, wherein, The fermentation is carried out in the presence of salt; And / or, the fermentation temperature is 35-50°C; And / or, the fermentation time is 15-25 days.

8. A method for fermenting yogurt or cheese, characterized in that, The method includes: inoculating the Aspergillus schwanniferum of claim 1 into dairy raw materials for dairy fermentation.

9. The method according to claim 8, wherein, The fermentation temperature of the dairy products is 35-45℃; And / or, the fermentation time of the dairy products is 1-50 hours.

10. The use of Aspergillus chewasserum as described in claim 1 in the production of soy sauce, yogurt or cheese.

Citation Information

Patent Citations

  • Lactobacillus plantarum capable of realizing high yield of lactic acid and application of the same to fields of food and feeds

    CN109423467A

  • Eurotium cristatum, microbial inoculum and application of eurotium cristatum and microbial inoculum

    CN113249233A

  • Eurotium chevalieri producing feruloyl esterase and application thereof in yeast for making hard liquor

    CN109468232A

  • Aspergillus oryzae and application thereof

    CN119979343A