Lignin degrading strain and application thereof

Abstract

The invention discloses a lignin degrading strain and application thereof, and relates to the technical field of microorganisms. The bacterial strain is a novel fungus bacterial strain, namely Pichia kudriavzevii M25, and the Pichia kudriavzevii M25 is preserved in the China Center for Type Culture Collection on March 21, 2025, and the preservation number is CCTCC No: M 2025554. The novel strain is obtained from a specific habitat through a unique separation and screening strategy, and the novel strain is found to be capable of efficiently secreting peroxidase, laccase and the like, and has the advantages of being simple in culture condition, high in enzyme activity and the like. The discovery of the strain provides a more competitive biocatalyst for large-scale production and industrial application of peroxidase and the like, and has important significance for promoting biological manufacturing, environmental pollution treatment and the like.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of microorganisms, and particularly relates to a lignin-degrading strain and application thereof. BACKGROUND

[0002] Lignin is a complex natural high-molecular organic polymer, one of the main components of plant cell walls (accounting for 15%-30% of the dry weight of plants), which together with cellulose and hemicellulose constitutes the structural support of the plant body, and endows the plant with mechanical strength and resistance to biological degradation. Agricultural waste (such as cake feed) also contains a large amount of lignin, which cannot be degraded and utilized by monogastric animals. This suggests that the degradation of lignin is crucial for the efficient utilization and sustainable development of biomass resources. Although the existing technology still faces efficiency and economic constraints, the development of biological methods (especially enzyme engineering and synthetic biology) provides a broad prospect for green degradation.

[0003] The degradation process of lignin involves various enzymes, such as peroxidase, laccase, manganese peroxidase, etc. Peroxidase is a kind of oxidoreductase widely existing in nature, which can catalyze the oxidation reaction of various substrates, and has important application value in lignin degradation, organic pollutant treatment, biological bleaching, biosensors, medicine, etc. Especially in environmental pollution control, peroxidase can efficiently degrade toxic substances such as dyes, phenolic compounds, polycyclic aromatic hydrocarbons, etc., and become one of the core tools of green biotechnology.

[0004] At present, peroxidase-producing microorganisms mainly concentrate on white rot fungi (such as Phanerochaete chrysosporium, Trametes versicolor), some bacteria and actinomycetes. However, the existing strains still have significant limitations in practical application:

[0005] 1. Low enzyme yield: The natural enzyme production level of wild strains is difficult to meet the industrial demand, for example, the lignin peroxidase yield of Phanerochaete chrysosporium is usually less than 50 U / mL, resulting in high production cost;

[0006] 2. Harsh culture conditions: Most high-yield strains need to rely on complex inducers (such as veratryl alcohol) or specific carbon-nitrogen ratio conditions, increasing the difficulty of large-scale production;

[0007] 3. Insufficient stability: The enzymes secreted by some strains are easily inactivated in high temperature or extreme pH environment, limiting their application scenarios;

[0008] 4. Bottleneck of genetic modification: The research on improving enzyme production efficiency through genetic engineering is still in the exploratory stage, and there are problems such as increased metabolic burden and strain degradation.

[0009] To address the above challenges, researchers have been committed to screening natural high-yield strains from nature or improving existing strains through mutagenesis techniques. However, the reported strains still have deficiencies in enzyme production efficiency, culture economy or environmental adaptability, and it is urgent to develop high-performance fungal resources with independent intellectual property rights. SUMMARY

[0010] To solve the above technical problems, the present application obtains a new fungal strain from a specific habitat through a unique isolation and screening strategy, which can efficiently secrete peroxidase and laccase, and has the advantages of simple culture conditions, high enzyme activity, etc. The discovery of this strain provides a more competitive biological catalyst for the large-scale production and industrial application of peroxidase, and has important significance for promoting biological manufacturing and environmental pollution control.

[0011] To achieve the above purpose, the present application adopts the following technical solutions:

[0012] One of the purposes of the present application is to provide a Pichia Kudriavzevii M25, which is preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC No: M 2025554.

[0013] The second purpose of the present application is to provide a microbial preparation, characterized in that it contains the Pichia Kudriavzevii M25 and / or its fermentation products.

[0014] The third purpose of the present application is to provide a method for culturing the Pichia Kudriavzevii M25, wherein the culture medium used includes ligninase-producing culture medium and cellulase-producing culture medium.

[0015] Preferably, the culture conditions include 25-30℃, 100-150r / min constant temperature shaking culture for 3-7d.

[0016] More preferably, the culture conditions include 28℃, 120r / min constant temperature shaking culture for 5d.

[0017] The fourth purpose of the present application is to provide the application of the Pichia Kudriavzevii M25, the microbial preparation or the Pichia Kudriavzevii M25 culture method in the preparation and / or production of lignin peroxidase.

[0018] The fifth purpose of the present application is to provide the application of the Pichia Kudriavzevii M25, the microbial preparation or the Pichia Kudriavzevii M25 culture method in the preparation and / or production of laccase.

[0019] The sixth object of the present application is to provide an application of the Pichia Kudriavzevii M25, the microbial preparation or the Pichia Kudriavzevii M25 culture method in the preparation and / or production of manganese peroxidase.

[0020] The seventh object of the present application is to provide an application of the Pichia Kudriavzevii M25, the microbial preparation or the Pichia Kudriavzevii M25 culture method in the preparation and / or production of cellulase.

[0021] The eighth object of the present application is to provide an application of the Pichia Kudriavzevii M25, the microbial preparation or the Pichia Kudriavzevii M25 culture method in the lignin degradation, organic pollutant treatment, biological bleaching, biosensor preparation and / or biological medicine product preparation.

[0022] Compared with the prior art, the present application has the following technical effects:

[0023] (1) The present application obtains a novel fungal strain from a specific habitat through a unique isolation and screening strategy, which can efficiently secrete peroxidase and laccase, and has the advantages of simple culture conditions, high enzyme activity, etc. The discovery of this strain provides a more competitive biological catalyst for the large-scale production and industrial application of peroxidase, and has important significance for promoting biological manufacturing and environmental pollution control.

[0024] (2) The novel fungal strain obtained by the present application also exhibits similar aroma and gas production characteristics as Saccharomyces cerevisiae in YPD medium, which makes it exhibit unique application potential in the fields of food fermentation (such as biological swelling of dough in the baking industry, flavor regulation in wine brewing) and industrial biological processes (solid state fermentation intensification based on in-situ gas generation, microbubble-assisted mass transfer system construction), and its application prospects in these fields are also very broad.

[0025] Deposit Description:

[0026] Deposit Agency: China Center for Type Culture Collection;

[0027] Deposit Number: CCTCC No: M 2025554;

[0028] Deposit Date: March 21, 2025;

[0029] Deposit Address: Wuhan, China. Wuhan University;

[0030] Taxonomic Name: Pichia Kudriavzevii M25. BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1Figure 1 is a schematic diagram of M25 on an aniline blue culture medium during the isolation process of Example 1 of the present application;

[0032] Figure 2 Figure 2 is a schematic diagram of a blank aniline blue culture medium during the isolation process of Example 1 of the present application;

[0033] Figure 3 Figure 3 is a schematic diagram of the morphology of M25 on an LB plate in Example 1 of the present application;

[0034] Figure 4 Figure 4 is a taxonomic identification result of M25 in Example 1 of the present application, wherein M from top to bottom is 5000, 3000, 2000, 1000, 750, 500, 250, 100 bp. DETAILED DESCRIPTION

[0035] The following examples are used to illustrate the present application, but are not used to limit the scope of the present application. Modifications or replacements of the methods, steps or conditions of the present application, without departing from the spirit and essence of the present application, all belong to the scope of the present application. The reagents and instruments used in the following examples can be obtained from the market, and the methods used in the examples are consistent with the commonly used methods, unless otherwise specified.

[0036] The technical solutions of the present application will be further described in detail below in combination with examples.

[0037] Example 1

[0038] 1 Method

[0039] 1.1 Sample source

[0040] Fermented product of potato and rice bran

[0041] 1.2 Culture medium

[0042] PDA culture medium: potato 200.0 g, glucose 20.0 g, distilled water 1 L.

[0043] Lignin primary screening liquid medium: alkaline lignin 2.0 g, ammonium sulfate 1.0 g, magnesium sulfate heptahydrate 0.5 g, potassium dihydrogen phosphate 1.0 g, sodium phosphate dibasic 0.2 g, distilled water 1 L.

[0044] Aniline blue coloration culture medium: yeast extract powder 5.0 g, sodium chloride 10.0 g, proteose peptone 10.0 g, agar 20.0 g, aniline blue 0.25 g, distilled water 1 L.

[0045] Congo red cellulose culture medium: Congo red 0.2 g, microcrystalline cellulose 1.88 g, magnesium sulfate heptahydrate 0.25 g, potassium phosphate dibasic 0.50 g, agar 20.0 g, distilled water 1 L.

[0046] Carboxymethylcellulose sodium (CMC-Na) medium: ammonium sulfate 1.0 g, calcium chloride 0.02 g, magnesium sulfate heptahydrate 0.20 g, carboxymethylcellulose sodium (CMC-Na) 10.0 g, ferric chloride hexahydrate 0.05 g, dipotassium hydrogen phosphate 1.0 g, agar 20.0 g, distilled water 1 L.

[0047] Lignin enzyme production medium: alkali lignin 3.0 g, dipotassium hydrogen phosphate 1.0 g, magnesium sulfate heptahydrate 0.10 g, calcium chloride 0.08 g, ferrous sulfate heptahydrate 0.05 g, manganese chloride 0.02 g, potassium dihydrogen phosphate 1.0 g, proteose peptone 2.0 g, distilled water 1 L.

[0048] Cellulose enzyme production medium: carboxymethylcellulose sodium 10.0 g, proteose peptone 5.0 g, ammonium sulfate 2.0 g, potassium dihydrogen phosphate 2.0 g, yeast powder 1.0 g, magnesium sulfate heptahydrate 0.5 g, calcium chloride 0.1 g, sodium chloride 0.5 g, ferrous sulfate heptahydrate 0.05 g, manganese sulfate 0.02 g, for cellulase strain fermentation.

[0049] The above medium, unless otherwise specified, is sterilized at 121°C for 15 min before use.

[0050] 1.3 Isolation and screening of strains

[0051] Strain enrichment and primary screening: 20 g of potato and rice bran fermentation product was poured into a conical flask containing 200 mL of PDA liquid medium, and cultured at 28°C and 120 r / min for 3 d to obtain a fermentation suspension. 5 mL of the fermentation suspension was added to the lignin primary screening enrichment medium, and cultured at 28°C for 3 d. The enrichment culture was gradient-diluted, and different concentrations of the diluents were spread on lignin primary screening plate medium. Each concentration was repeated three times, and placed in a constant temperature incubator at 28°C for inverted culture for 3-5 d.

[0052] After the lignin solid medium grew colonies, different morphological single colonies were picked and cultured in lignin liquid medium for 3 d. The obtained colony isolates were gradient-diluted by 10 times, and 10 -4 ,10 -5 After the aniline blue solid plate was cultured for 3 d, strains with obvious discoloration ring effect were selected. The purified strains were transferred to LB liquid medium, and the obtained single colonies were numbered. The bacterial liquid and 50% sterile glycerol were mixed at a ratio of 1:1 in a strain cryopreservation tube, and stored in a -80°C refrigerator for later use.

[0053] Enzyme activity determination: the strains preliminarily screened were inoculated into LB liquid medium for culture for 3 days to obtain seed liquid, the seed liquid was inoculated into ligninase-producing medium and cellulase-producing medium, and was cultured at 28°C and 120 r / min constant temperature shaker for 5 days, the fermentation liquid was centrifuged at 4°C and 8000 r / min for 10 min to obtain supernatant, i.e. crude enzyme liquid, and the supernatant was used for determination of laccase, lignin peroxidase, manganese peroxidase and cellulase activity.

[0054] 1.4 Enzyme activity determination

[0055]

[0056] Enzyme activity is defined as the amount of enzyme required to catalyze the conversion of 1 μmol of substrate into product per minute as an enzyme activity unit (U) (Cui T, Yuan B, Ling C, Fang B, Mao X, Fei Q. Evaluation and analysis of enzyme activity test methods of lignin-degrading enzymes [J]. Chemical Industry Progress, 2020, 39(12):5189-5202; Hu X, Zhang D, Zhou Y, Wei Y, Chen S. Identification and degradation characteristics of a lignin-degrading strain. Biotechnology Bulletin, 2019, 35(9):172-177).

[0057] Enzyme activity (U / mL) = (△OD) / (△T) x 10^6 / ε x Vtotal / Venzyme

[0058] In the formula:

[0059] Vtotal: total reaction volume (mL) when measured;

[0060] Venzyme: enzyme liquid volume (mL) when measured;

[0061] △T: reaction time (min);

[0062] △OD: measured absorbance value;

[0063] ε: molar extinction coefficient (M-1.cm-1): the molar extinction coefficient of veratryl alcohol is 9300 M -1 .cm -1 ; the molar extinction coefficient of ABTS is 36000 M -1 .cm -1 ; the molar extinction coefficient of Mn 2+ is 49600 M -1 .cm -1 .

[0064] 10 6 is the coefficient for converting mol into μmol.

[0065] Cellulase activity determination (Wu S, Xie Y, Duan X, Ye M, Xu W, Huang G, Zhong X, Ren H. Screening of cellulase-producing strains and their enzymatic properties [J / OL]. Food Science and Technology): The total reaction volume was 5 mL: first add 200 μL of 1% CMC-Na in citric acid buffer solution and 200 μL of crude enzyme solution, mix well, then water bath at 50°C for 30 min, then add 600 μL of DNS reagent, shake well, then boil in boiling water bath for 10 min, cool in ice water, and dilute to 5 mL with distilled water. Take 200 μL and add to the enzyme label plate, and measure the absorbance at 540 nm. According to the glucose standard curve drawn, calculate the activity of carboxymethyl cellulase. The enzyme activity calculation method is as follows:

[0066] Enzyme activity (U / mL) = (W x △f x 1000) / (180.16 x △T)

[0067] Where: W is the amount of glucose produced by enzymatic reaction, which can be obtained according to the glucose standard curve; △f represents the dilution ratio, i.e. the ratio of the total volume of the test tube to the volume of the enzyme solution added; 1000 represents unit conversion; 180.16 represents the molecular weight of glucose; △T is the reaction time of enzyme and substrate (30 min).

[0068] 1.5 Taxonomic identification

[0069] 1.5.1 DNA group extraction

[0070] Column method extraction

[0071] 1) Take 2 ml centrifuge tube, add 200 μL pretreatment solution and a few grinding beads, then add appropriate amount of bacterial sample, put into the grinder and grind until fully.

[0072] 2) Add 20 μL Proteinase K, add 200 μL lysis solution, mix well by inverting, and place at 70°C for 10 min.

[0073] 3) Add 200 μL anhydrous ethanol, mix well by inverting, and centrifuge briefly to remove liquid droplets on the inner wall of the tube cap.

[0074] 4) Pass through the adsorption column, wash once with washing solution and twice with rinsing solution.

[0075] 5) Place the adsorption column at room temperature for 3-5 minutes to completely dry the residual rinsing solution in the adsorption material.

[0076] 6) Transfer the adsorption to a new centrifuge tube, and add 50-100 μL ddH2O to the middle of the adsorption membrane, and place it at room temperature for 3-5 min, and centrifuge at 12000 rpm for 2 min, and collect the solution into the centrifuge tube.

[0077] 1.5.2 DNA group amplification

[0078] Amplification system: template 2 μL; ITS1 11 μL; ITS4 1 μL; PCR Mix 21 μL. Reaction condition: pre-denaturation at 96 °C for 5 min; then 96 °C denaturation for 30 s; 56 °C annealing for 30 s; 72 °C extension for 1 min; 40 cycles in total; 72 °C extension for 5 min.

[0079] Fungi 18S

[0080] ITS1 TCCGTAGGTGAACCTGCGG (SEQ ID NO. 1)

[0081] ITS4 TCCTCCGCTTATTGATATGC (SEQ ID NO. 2)

[0082] 1.5.3 PCR product detection and purification

[0083] 3 μL PCR product was detected by 1.0% agarose gel, and the band characteristics were observed.

[0084] 1.5.3 Sequencing

[0085] The purified PCR product was subjected to machine detection.

[0086] 1.5.5 Result comparison

[0087] The sequencing results were compared by NCBI-BLAST.

[0088] 2 Results

[0089] 2.1 Isolation process

[0090] The pictures involved in the isolation process are shown in Figures 1-2 , wherein Figure 1 is a schematic diagram of M25 on aniline blue medium, Figure 2 is a schematic diagram of blank aniline blue medium.

[0091] 2.2 Morphological identification

[0092] The morphological diagram of M25 on LB plate is shown in Figure 3 , and the morphological analysis results are shown in Table 1.

[0093] Table 1 Morphological analysis results of M25

[0094] Shape Positive color Reverse color Size Edge Smooth Transparent Dry and wet Surface M25 Circle Opalescent Opalescent Medium √ √ × Wet Convex

[0095] 2.3 Viable count

[0096] The viable count results of M25 are shown in Table 2.

[0097] Table 2 M25 viable count results

[0098] LB plate viable count, CFU mL -1 ]] M25 5.3×10^7

[0099] 2.4 Enzymatic activity

[0100] The results of the viable count of M25 peroxidase, laccase, manganese peroxidase and cellulase are shown in Table 3.

[0101] Table 3 M25 viable count results

[0102]

[0103] The results show that by lignin medium separation, it is finally detected that M25 is the fungus with the highest peroxidase activity.

[0104] 2.5 Taxonomic identification of M25

[0105] The results of the taxonomic identification of M25 are shown in Table 4. Figure 4

[0106] The sequencing results are shown in SEQ ID NO. 3. After NCBI-Blast comparison, M25 is finally identified as Pichia, and the homology is closest to Pichia Kudriavzevii.

[0107] > M25_seq.Contig1

[0108] ​TGCGGAAGGATCATTACTGTGATTTAGTACTACACTGCGTGAGCGGAACGAAAACAAAAACACCTAAAATGTGGAATATAGCATATAGTCGACAAGAGAAATCTACGAAAAACAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTTTGAGCGTCGTTTCCATCTTGCGCGTGCGCAGAGTTGGGGGAGCGGAGCGGACGACGTGTAAAGAGCGTCGGAGCTGCGACTCGCCTGAAAGGGAGCGAAGCTGGCCGAGCGAACTAGACTTTTTTTCAGGGACGCTTGGCGGCCGAGAGCGAGTGTTGCGAGACAACAAAAAGCTCGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATC (SEQ ID NO.3)

[0109] 2.6 Preservation

[0110] The cases of biological preservation of M25 are shown in Table 4.

[0111] Table 4 Cases of biological preservation of M25

[0112] Scientific name Preservation number M25 Pichia Kudriavzevii CCTCC No: M2025554

[0113] Comparative Example

[0114] The cases related to other strains with high enzyme activity in the prior art are shown in Table 5.

[0115] Table 5 Cases related to comparative strains

[0116]

[0117]

[0118] The above-described embodiments are merely preferred modes of the present application and are not intended to limit the scope of the present application. Various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art without departing from the design spirit of the present application shall fall within the scope of protection of the present application as defined by the claims.

Claims

1. A Pichia Kudriavzevii M25, characterized in that, It is preserved in China Center for Type Culture Collection, and the preservation number is CCTCC No: M 2025554.

2. A microbial preparation, characterized in that, The Pichia kudriavzevii M25 and / or its fermentation product of claim 1 are contained therein.

3. A method of culturing the Pichia kudriavzevii M25 of claim 1, characterized in that, The culture medium used by it includes ligninase-producing culture medium and cellulase-producing culture medium.

4. The method of claim 3, wherein, The culture conditions thereof include 25-30℃, 100-150r / min constant temperature shaker culture for 3-7d.

5. The method of claim 4, wherein, The culture conditions thereof include 28℃, 120r / min constant temperature shaker culture for 5d.

6. The use of the Pichia kudriavzevii M25 of claim 1, the microbial preparation of claim 2 or the Pichia kudriavzevii M25 culture method of any one of claims 3-5 in the preparation and / or production of lignin peroxidase.

7. The use of the Pichia kudriavzevii M25 of claim 1, the microbial preparation of claim 2 or the Pichia kudriavzevii M25 culture method of any one of claims 3-5 in the preparation and / or production of laccase.

8. The use of the Pichia kudriavzevii M25 of claim 1, the microbial preparation of claim 2 or the Pichia kudriavzevii M25 culture method of any one of claims 3-5 in the preparation and / or production of manganese peroxidase.

9. The use of the Pichia kudriavzevii M25 of claim 1, the microbial preparation of claim 2 or the Pichia kudriavzevii M25 culture method of any one of claims 3-5 in the preparation and / or production of cellulase.

10. The use of the Pichia kudriavzevii M25 of claim 1, the microbial preparation of claim 2 or the Pichia kudriavzevii M25 culture method of any one of claims 3-5 in lignin degradation, organic pollutant treatment, biological bleaching, biosensor preparation and / or biological medicine product preparation.

Images