A streptomyces circovorus and its use

By using microbial agents and pesticides prepared from Streptomyces circumvallate and its crude metabolic extracts or fermentation broths, the safety and environmental pollution problems of chemical agents in the control of root-knot nematode disease in vegetables have been solved, achieving highly efficient biological control of cucumber root-knot nematode disease.

CN120905097BActive Publication Date: 2025-12-26SANYA BIOSAFETY CENT OF CHINESE ACAD OF MEDICAL SCI +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511445239.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-11
Publication Date
2025-12-26
Estimated Expiration
2045-10-11

AI Technical Summary

Technical Problem

Existing chemical agents pose safety concerns when controlling root-knot nematodes in vegetables, affecting vegetable quality, polluting the environment, and limiting continuous cropping and yield. Therefore, there is an urgent need for biological control technologies.

Method used

By using Streptomyces anulatus (CGMCC NO.35572) and its crude metabolites or fermentation broth, microbial agents and pesticides are prepared to control cucumber root-knot nematode disease.

Benefits of technology

Streptomyces circotropicus significantly reduced the incidence of cucumber root-knot nematode disease, achieving a control effect of 67.6%. It is safe and highly effective, avoiding the toxic risks of chemical pesticides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905097B_ABST
    Figure CN120905097B_ABST
Patent Text Reader

Abstract

This invention discloses a Streptomyces circumvallate and its applications, belonging to the field of microbial technology. The purpose of this invention is to provide an effective method for controlling root-knot nematodes. This invention provides a Streptomyces circumvallate (… Streptomyces anulatus The *Streptomyces circumferentialis* strain described is named TC20, with accession number CGMCC NO.35572, and accession date of August 11, 2025. It is deposited at the China General Microbiological Culture Collection Center. This strain has great application potential for addressing the damage caused by the southern root-knot nematode in cucumber production.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of microorganisms, and particularly relates to a Streptomyces annulus and application thereof. BACKGROUND

[0002] Vegetable root-knot nematode disease (commonly known as "tumor disease") caused by root-knot nematode is a common disease in vegetable planting. In recent years, with the continuous expansion of the area of greenhouse vegetable planting, a suitable environment has been created for the breeding and spread of the disease, leading to more and more serious damage, especially in the continuous cropping of greenhouse cucumbers, tomatoes, celery and other crops, with annual economic losses of tens of billions of yuan. At present, the prevention and control of the disease is still mainly based on chemical methods, and common agents include abamectin, dazomet and the like. Although such chemical agents can effectively kill root-knot nematodes, they have many drawbacks: they can affect the safety and food quality of vegetables, pollute soil and water resources, destroy the ecological balance, and restrict the continuous cropping of vegetables and lead to yield reduction. With the increasing demand for the development of green, safe and efficient agriculture, more and more chemical pesticides are prohibited for use in vegetable production, and safe and efficient biological control technology for vegetable root-knot nematodes has therefore attracted increasing attention.

[0003] Actinomycetes have been a research hotspot because they can produce a large number of secondary metabolites (such as enzymes, hormones, antibiotics, etc.) with commercial value. However, with the deepening of research on the extraction of natural products from common environmental microorganisms, the discovery of new species and new compounds has become increasingly difficult.

[0004] Due to the diversity of insect habitats and diets, insects carry a large number of related microorganisms; different insects and their symbiotic actinomycetes have formed diverse interaction relationships and unique systems through long-term evolution. Therefore, insect symbiotic actinomycetes are gradually becoming an important resource for exploring new strains of high-activity actinomycetes, and showing broad application prospects in the field of agricultural biological control. SUMMARY

[0005] The purpose of the present application is to provide an effective method for preventing and controlling root-knot nematodes.

[0006] The present application provides a Streptomyces annulus (T.C.20) for use in the prevention and control of root-knot nematodes. Streptomyces anulatus The Streptomyces annulus is named T.C.20, has a preservation number of CGMCC NO.35572, was preserved on August 11, 2025, and is preserved in the General Microbiological Center of the Chinese Microorganism Bacterium Preservation Management Committee, located at No.3, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and is classified and named Streptomyces annulus. Streptomyces anulatus

[0007] The present application provides a microbial preparation containing the above-mentioned Streptomyces annulus.

[0008] ​The application provides application of the above-mentioned streptomyces annulus or the above-mentioned microbial preparation in preparation of a pesticide for preventing cucumber root-knot nematode disease.

[0009] The application provides application of the above-mentioned streptomyces annulus or the above-mentioned microbial preparation in preparation of a pesticide for treating cucumber root-knot nematode disease.

[0010] The application provides a cucumber pesticide, and the effective component of the cucumber pesticide is the above-mentioned streptomyces annulus.

[0011] The application further limits the application of the above-mentioned cucumber pesticide in resisting cucumber root-knot nematode disease.

[0012] The application provides application of the above-mentioned streptomyces annulus or the above-mentioned microbial preparation in preparation of a pesticide for treating cucumber root-knot nematode disease.

[0013] Further limitation is that the fermentation liquor of the streptomyces annulus is obtained by inoculating the seed liquid of the streptomyces annulus T.C.20 strain into ISP3 liquid culture medium at 5%, and culturing the inoculated medium in a sterile shaker at 28 DEG C for 7 days.

[0014] Further limitation is that the fermentation liquor of the streptomyces annulus is obtained by inoculating the seed liquid of the streptomyces annulus T.C.20 strain into ISP3 liquid culture medium at 5%, and culturing the inoculated medium in a sterile shaker at 28 DEG C for 7 days.

[0015] S2: the obtained fermentation culture is extracted with ethyl acetate, and after extraction, the upper organic phase is poured out to obtain a crude extract, and then the ethyl acetate in the crude extract is separated by rotary evaporation to obtain the metabolic crude extract.

[0016] Beneficial effects: the application separates a strain of streptomyces, and the greenhouse potting prevention and treatment effect of the strain on southern root-knot nematode is 1.32, and the prevention and treatment effect is 67.6%, and the root-knot index of the negative control group is 5.13. The strain has great application potential for solving the harm of southern root-knot nematode in cucumber production.

[0017]

Biological preservation information

[0018] Figure 1A colony morphology chart of Streptomyces anulatus T.C.20 strain of the application;

[0019] Figure 2 An application effect comparison chart of fermentation liquor of Streptomyces anulatus T.C.20 strain of the application in preventing and treating root-knot nematode disease of potted cucumbers; A is avermectin; B is T.C.20 strain; C is sterile water. DETAILED DESCRIPTION

[0020] TWYE: Yest extract 0.25 g, K2HPO4 0.5 g, Agar 18.0 g, water to 1 L, adjust pH to 7.2;

[0021] SM3: dextrose 10 g, peptone 5 g, tryptone 3 g, sodium chloride 5 g, Agar 18 g, water to 1 L, adjust pH to 7.2;

[0022] GS: Soluble starch 20.0 g, KNO3 1.0 g, NaCl 0.5 g, MgSO4·7 H2O 0.5 g, K2HPO4 0.5 g, FeSO4·7 H2O 10.0 mg, Agar 18.0 g, water to 1 L, adjust pH to 7.4.

[0023] Example 1. Strain screening and identification

[0024] (1) Strain isolation and purification

[0025] In this example, the beet armyworm larvae were collected from the cowpea planting site of the Institute of Hot Work in Sanya, Hainan Province, and the microorganisms in the intestines of the beet armyworm larvae were isolated and identified by dilution coating method, as follows:

[0026] The collected beet armyworm larvae were placed in sterile water, sterile water, 75% alcohol, 75% alcohol and sterile water for 30 s, respectively, for in vitro disinfection; the head of the disinfected larvae was clamped with forceps, and the intestine was clamped out with a sharp forceps, and the intestine was collected into a mortar and ground into a suspension with 5 mL of sterile water. The suspension was diluted to 10 -4 , 10 -5 , 10 -6 , 10 -7Four concentration gradients were used, with 100 μL of each concentration spread onto three different media (TWYE, SM3, and GS) containing 50 μg / mL actinomycin and 50 μg / mL nalidixic acid (pH adjusted to 8.0). Three plates were spread for each concentration, for a total of 36 plates. The plates were inverted and incubated at 28°C. Colony size was checked daily, and newly grown colonies were isolated and purified until no new colonies grew.

[0027] (2) Strain identification

[0028] The sequence of strain TC20 was analyzed. trpB Sequence fragment amplification, for the amplified sequence trpB Sequence homology analysis and phylogenetic analysis, through BLAST homology alignment, determined that the closest species to this strain is *Streptomyces circumsus*. Streptomyces anulatus ).

[0029] The primer sequence is as follows:

[0030] trpBF: 5'- GCGCGAGGACCTGAACCACACCGGCTCACACAAGATCAACA-3' (SEQ ID NO. 1);

[0031] trpBR: 5'-TCGATGGCCGGGATGATGCCCTCGGTGCGCGACAGCAGGC-3' (SEQ ID NO. 2);

[0032] strain TC20 trpB The gene sequence is as follows: (SEQ ID NO.3)

[0033] TCGTTTTCCGCTTAACAAGTCGTGAAGCTCCAGCGCTCCTCATCGGTGACCGCGCGGTACTCGCCGCGCCCGACGTCCTTGAGGTACGCGTGCTCCGGGCCGATGCCGGGGTAGTCCAGTCCCGCCGAGATGGAGTACGGCTCGGTGATCTGGCCCTCGTCGTCCTGGAGGACGTAGGAGCGCGAGCCGTGCAGGATGCCGGGCTCCCCCGCGGTGAGGGTCGCCGCGTGCTCACCGGTCTCCACCCCGTGCCCGGCGGGCTCGCAGCCCACCAGGCGGACGTCGGCGTCGGGGATGAAGGCGTGGAAGAGGCCGATGGCGTTGGAGCCGCCTCCGAGCGCGGCGACCGCCGCGTCCGGGAGGCGTCCCGCGCGCTCCAGGATCTGGCGGCGGGCCTCGACGCCGATGACCCGGTGGAAGTCGCGGACCATCGCCGGGAAGGGGTGCGGGCCCGCGACCGTGCCGAAGAGGTAGTGCGTGCGGTCCACGTTGGCGACCCAGTCGCGGAACGCCTCGTTGATGGCGTCCTTCAGCGTCCGCGAGCCGGACTTCACGGCGACGACCTCGGCGCCGAGCATCCGCATCCGGGCCACGTTCAGCGCCTGGCGCTCGGTGTCGATCTCGCCCATGTAGATGGTGCATTCGAGGCCGAAGAGGGCGCAGGCGGTCGCGGTGGCGACGCCGTGCTGGCCGGCTCCGGTCTCGGCGATGACACGGGTCTTGCCCATGCGCTTGGTGAGGAGGGCCTGACCCAGCACGTAAAAG.

[0034] Example 2. Effect of Metabolites from S. circinatus T.C. 20 Strain on Killing of Southern Root-knot Nematodes

[0035] 1. Preparation of Nematodes for Testing

[0036] The southern root-knot nematodes used in the experiment were collected from the greenhouse of the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences. The southern root-knot nematodes were taken from the roots of naturally infected pepper plants, washed gently with water, and the egg masses were removed from the surface of the roots. The egg masses were then disinfected in 0.5% sodium hypochlorite for 3 minutes, washed with sterile water three times, and placed in a culture dish containing a small amount of sterile water. The culture dish was then incubated in a 28°C incubator, and the hatched second instar larvae of the root-knot nematodes were collected after 24-48 hours. The larvae were suspended in sterile water for use in the experimental study.

[0037] 2. Preparation of the crude extract of the Streptomyces annulatus T.C.20 strain metabolites

[0038] Method for preparing the crude extract of the Streptomyces annulatus T.C.20 strain metabolites:

[0039] S1: Seed liquid of the Streptomyces annulatus T.C.20 strain was inoculated into ISP3 liquid medium at 5%, and sterile culture was carried out at 28°C for 7 days on a shaking table to obtain a fermentation culture;

[0040] S2: The obtained fermentation culture was extracted with ethyl acetate. After extraction, the layers were separated, and the upper organic phase was poured out to obtain a crude extract. The ethyl acetate in the crude extract was then separated by rotary evaporation to obtain the crude extract of the metabolites.

[0041] 3. Determination of the effect of the crude extract of the Streptomyces annulatus T.C.20 strain metabolites on killing the southern root-knot nematodes

[0042] The crude extract obtained by fermentation of the T.C.20 strain was dissolved in methanol to form a mother liquor at 20 mg / mL. In a 96-well sterile cell culture plate, 5 μL of the crude extract mother liquor was added to each well, and 5 μL of methanol was used as a control. Then, 95 μL of a nematode suspension (about 100 nematodes) was added to the treatment and control groups, respectively, to make the final concentration 1 mg / mL and the total volume 100 μL. The plate was incubated in a 28°C incubator for 24 hours, and the death of the root-knot nematodes was observed. The corrected mortality rate was calculated, which was the nematocidal effect. Each test was repeated three times, and the nematocidal effect is shown in Table 1.

[0043] Corrected mortality rate calculation formula:

[0044] ;

[0045] Table 1: Nematocidal effect of the crude extract of the Streptomyces annulatus T.C.20 strain metabolites

[0046]

[0047] Example 3: Pot experiment for preventing and treating cucumber root-knot nematode disease by Streptomyces annulatus T.C.20

[0048] 1. Preparation of nematodes and fermentation broth of Streptomyces annulatus T.C.20 for the experiment

[0049] Preparation of root-knot nematode: Southern root-knot nematodes used in the test were collected from the greenhouse of the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences. The southern root-knot nematodes were taken from the roots of naturally infected pepper plants, washed gently with water, and the egg masses were removed from the surface of the roots, disinfected in 0.5% sodium hypochlorite for 3 min, then washed with sterile water for 3 times, placed in a culture dish containing a small amount of sterile water, and incubated in a 28°C incubator. The hatched second instar larvae of root-knot nematodes were collected after 24-48 h and suspended in sterile water for use in the test.

[0050] Preparation of fermentation broth: The T.C.20 strain of Streptomyces anulatus seed liquid was inoculated into ISP3 liquid medium at 5%, and cultured aseptically at 28°C for 7 days on a shaker to obtain the fermentation broth.

[0051] ISP3 liquid medium: oat meal 20.0 g, NaCl 1.0 g, FeSO4·7H2O 0.001 g, MnCl2·4H2O 0.001 g, ZnSO4·7H2O 0.001 g, and water to 1 L.

[0052] 2. Effect test of T.C.20 strain of Streptomyces anulatus fermentation broth on the control of potted cucumber root-knot nematode disease

[0053] The seeds of Zhongnong No. 6 cucumber were disinfected with 1% sodium hypochlorite, and after germination, they were sown in sterilized soil (vermiculite: substrate soil = 1:2). When the first true leaf emerged, the seedlings were transplanted into 7 cm*7 cm*10 cm plastic pots with sterilized soil (vermiculite: substrate soil = 1:2). When the Zhongnong No. 6 cucumber seedlings grew to two true leaves, three 1000 μL blue gun heads were inserted evenly into the pots. The experimental group was irrigated with 10 mL of T.C.20 strain of Streptomyces anulatus fermentation broth; the positive control group was irrigated with 10 mL of abamectin solution (0.18 mg / mL); the negative control group was irrigated with 10 mL of sterile water. After 48 h of irrigation, the blue gun heads in the pots were removed, and 150 μl of nematode suspension containing 100 southern root-knot nematodes was injected into each hole, with a total of 300 nematodes per pot, and the gun hole was then covered with substrate soil. After 30 days, the investigation was carried out, with 10 replicates per group, and three independent repeated tests. The control effect is shown in Tables 2, 3, 4 and Figure 2 .

[0054] Control effect calculation formula:

[0055] ;

[0056] Root-knot index calculation formula: root-knot index = number of root knots / fresh weight of roots;

[0057] Table 2 Effect of the first potting test

[0058]

[0059] Note: Different lower case letters after the same column data indicate significant differences between treatments (Tukey's test, P < 0.05).

[0060] Table 3 Effect of the second pot experiment

[0061]

[0062] Note: Different lower case letters after the same column data indicate significant differences between treatments (Tukey's test, P < 0.05).

[0063] Table 4 Effect of the third pot experiment

[0064]

[0065] Note: Different lower case letters after the same column data indicate significant differences between treatments (Tukey's test, P < 0.05).

[0066] From the experiment, it can be seen that the pot experiment clearly shows the biocontrol effect of T.C.20 strain on cucumber root-knot nematode disease. The results show that the average number of root-knots on cucumber seedlings in the sterile water control treatment group is 83.3 per plant, and the average root-knot index is 5.13 (the average value of root-knot index in Tables 2-4). The average number of root-knots on pot-grown cucumber seedlings treated with Streptomyces lydicus T.C.20 fermentation broth is 27.7 per plant, and the average root-knot index is 1.32, with an average control effect on root-knot nematodes of 67.6%. It shows that Streptomyces lydicus T.C.20 can significantly reduce the number of root-knots on cucumber seedlings and effectively control cucumber root-knot nematode disease. In addition, the average number of root-knots on cucumber seedlings treated with pesticide avermectin is as low as 13.73 per plant, with the best control effect on root-knot nematodes. However, according to the Chinese pesticide toxicity classification standard, avermectin is a high-toxicity insecticide with high toxicity to fish and other species, which will directly endanger human health if not used properly. In comparison, Streptomyces lydicus T.C.20 is derived from natural habitats and has the characteristics of high efficiency and safety, and has important value in the prevention and control of root-knot nematode disease in agricultural production.

Claims

1. A Streptomyces circovallatus (ATCC 31243) which is characterized by, Streptomyces anulatus The ring circle Streptomyces is named T.C. 20, the preservation number is CGMCC NO. 35572, and the preservation date is August 11, 2025, which is preserved in the China General Microbiological Culture Collection Center. ​ 2. A microbial preparation containing the ring circle Streptomyces of claim 1.

3. Use of the ring circle Streptomyces of claim 1 or the microbial preparation of claim 2 in the preparation of a pesticide for preventing cucumber root-knot nematode disease.

4. Use of the ring circle Streptomyces of claim 1 or the microbial preparation of claim 2 in the preparation of a pesticide for treating cucumber root-knot nematode disease.

5. A cucumber pesticide, characterized by comprising: The effective component of the cucumber pesticide is the ring circle Streptomyces of claim 1.

6. Use of the cucumber pesticide of claim 5 in resisting cucumber root-knot nematode disease.

Citation Information

Patent Citations

  • Streptomyces badius and application thereof

    CN112522162A