High-efficiency CRISPR / Cas9 gene editing system of blue marneffei containing tRNA-Gly sequence and application of high-efficiency CRISPR / Cas9 gene editing system

By introducing endogenous tRNA-Gly sequences into *Cymbidium marneffei* as sgRNA processing enhancement elements, a highly efficient CRISPR/Cas9 gene editing system was constructed, solving the problem of low efficiency in existing technologies, achieving a significant improvement in gene editing efficiency and system stability, and supporting functional genomics research.

CN120905210APending Publication Date: 2025-11-07THE FIRST AFFILIATED HOSPITAL OF GUANGXI MEDICAL UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511127264.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-12
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

The existing CRISPR/Cas9 gene editing system for Bryophytum marneffei is inefficient and lacks stability, making it difficult to meet the needs of functional genomics research.

Method used

We used the endogenous tRNA-Gly sequence of *Cynodon dactylon* as an sgRNA processing enhancement element to construct an efficient CRISPR/Cas9 gene editing system, and utilized the endogenous tRNA processing system to improve the expression abundance and stability of sgRNA.

Benefits of technology

It significantly improved gene editing efficiency from 75.0% to 95.8%, demonstrating high efficiency and stable editing performance across different gene targets and DNA repair pathways. It provides strong system versatility and stability, supporting functional genomics research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905210A_ABST
    Figure CN120905210A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of gene engineering, and relates to an efficient CRISPR / Cas9 gene editing system of blue marneffei containing a tRNA-Gly sequence and application of the efficient CRISPR / Cas9 gene editing system. The tRNA-Gly sequence of the blue marneffei bacterium is as shown in SEQ ID NO: 3. The tRNA-Gly sequence of the blue marneffei bacterium is disclosed in the invention. The invention also discloses an sgRNA expression vector containing the tRNA-Gly sequence, a CRISPR / Cas9 gene editing system, and an application of the sgRNA expression vector and the CRISPR / Cas9 gene editing system in gene editing of the blue marneffei. According to the invention, the tRNA-Gly sequence is used as an enhancement element for sgRNA processing, and the expression level and stability of sgRNA are remarkably improved by utilizing an endogenous tRNA processing mechanism of cells. The CRISPR / Cas9 system established by the invention has extremely high gene editing efficiency, good targeting specificity and wide universality in the blue marneffei, and the problem of low efficiency in the prior art is effectively solved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a high-efficiency CRISPR / Cas9 gene editing system of Talaromyces marneffei containing a tRNA-Gly sequence and application thereof. BACKGROUND

[0002] Talaromyces marneffei is an important opportunistic pathogenic fungus with temperature-dependent dimorphism conversion ability, which can cause fatal systemic infection in the host, especially posing a serious threat to immunocompromised populations. In-depth study of its pathogenic mechanism and environmental adaptation mechanism is crucial for the development of new antifungal treatment strategies, and efficient gene manipulation tools are the cornerstone of functional genomics research.

[0003] Traditional gene editing methods, such as homologous recombination-based gene knockout, have problems such as complicated operation and low efficiency in Talaromyces marneffei, which seriously restricts the systematic study of its functional genes. In recent years, clustered regularly interspaced short palindromic repeats and CRISPR-associated protein 9 (CRISPR / Cas9) gene editing technology has been widely used in various organisms due to its high efficiency, precision and simplicity. This technology uses a single guide RNA (sgRNA) to guide Cas9 nuclease to cut specific sites in the genome, thereby achieving precise modification of genes.

[0004] However, the application efficiency of CRISPR / Cas9 system in different species varies significantly, and needs to be systematically optimized for specific species. Previous studies have attempted to establish a CRISPR / Cas9 system in Talaromyces marneffei, for example, Wang et al. (Zhang X, Hu X, Jan S, et al. Development of CRISPR-Cas9 genome editing system in Talaromyces marneffei. Microbial Pathogenesis, 2021, 154: 104822.) used the endogenous U6 small nuclear RNA (U6 snRNA) promoter to drive sgRNA expression, but its gene editing efficiency was only about 40%, much lower than the performance of this technology in other fungi. This efficiency bottleneck may be related to insufficient sgRNA expression level, insufficient nuclear localization of Cas9 protein, and preference of DNA repair pathways, etc.

[0005] In the optimization of sgRNA expression system, the RNA polymerase III (Pol III) dependent promoter (such as U6 and 5S rRNA promoter) is a common choice. In addition, studies have shown that the integration of transfer RNA (tRNA) elements in the sgRNA expression cassette can utilize the endogenous tRNA processing system in cells to accurately cut and modify sgRNA, thereby significantly improving its expression level and stability, and thus improving the efficiency of gene editing. For example, Xie et al. (Xie K, Minkenberg B, Yang Y. Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system. PNAS, 2015, 112(11): 3570-3575.) confirmed that the tRNA enhancement element can greatly improve the efficiency of gene editing in rice. However, in Malassezia, there is no report on using endogenous tRNA sequences as sgRNA processing enhancement elements to improve the efficiency of the CRISPR / Cas9 system.

[0006] Therefore, there is an urgent need in the art to develop a new, efficient and stable Malassezia gene editing system to solve the problem of low efficiency in the prior art, thereby accelerating the functional genomics research and pathogenic mechanism exploration of the pathogenic fungus. SUMMARY

[0007] The present application aims to solve the technical problems of low efficiency and insufficient stability of the existing Malassezia CRISPR / Cas9 gene editing system, and provides a new strategy and new tool that can significantly improve the efficiency of gene editing.

[0008] The present application provides a tRNA-Gly sequence of Malassezia, which is shown as SEQ ID NO: 3.

[0009] The present application provides a tRNA-Gly sequence of Malassezia, which is shown as SEQ ID NO: 3.

[0010] Further, the Cas9 expression vector is constructed based on plasmid pCAMBIA0380.

[0011] Further, the tRNA-Gly sequence is inserted into the endogenous U6 promoter of Malassezia and the universal sgRNA backbone to obtain the sgRNA expression vector.

[0012] Further, the sequence obtained by inserting the tRNA-Gly sequence into the endogenous U6 promoter of Mortierella and the universal sgRNA skeleton is shown as SEQ ID NO: 4.

[0013] The application provides application of a tRNA-Gly sequence of Mortierella in construction of a high-efficiency CRISPR / Cas9 gene editing system of Mortierella.

[0014] The application provides application of a tRNA-Gly sequence or a CRISPR / Cas9 gene editing system in gene editing of Mortierella.

[0015] The application provides a method for improving the gene editing efficiency of Mortierella CRISPR / Cas9, which comprises introducing the tRNA-Gly sequence as an sgRNA processing enhancer into an sgRNA expression vector.

[0016] Compared with the prior art, the application has the following beneficial effects:

[0017] 1. The application first identifies and applies the endogenous tRNA-Gly sequence of Mortierella: the application first separates and identifies the tRNA-Gly sequence (SEQ ID NO: 3) derived from Mortierella, and innovatively uses the sequence as an sgRNA processing enhancer, and effectively improves the expression abundance and stability of sgRNA by using the endogenous tRNA processing system in cells;

[0018] 2. The gene editing efficiency can be significantly improved by the technical scheme of the application: by integrating the tRNA-Gly sequence into the sgRNA expression vector, the gene editing efficiency of the CRISPR / Cas9 system established by the application in Mortierella is greatly improved, and experimental data show that the editing efficiency can be improved from 75.0% to 95.8% by introducing the tRNA-Gly element under the driving of the U6 promoter.

[0019] 3. The system is universal and stable: the gene editing system established by the application shows efficient and stable editing performance in different gene targets (such as pks3 and mp1) and different DNA repair pathways, which proves its wide applicability;

[0020] 4. The application provides a powerful tool for functional genomics research: the efficient gene editing system provided by the application is successfully applied to the function verification of known virulence factors (such as mp1) of Mortierella, accurately reproduces the biological function, proves the reliability and practical value of the tool, and provides guarantee for in-depth study of the pathogenic mechanism. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1Figure of the Cas9 expression vector pCas9-H2B used in Example 1.

[0022] Figure 2 Figure of the control sgRNA expression vector pU6-gRNA used in Example 1.

[0023] Figure 3 Figure of the enhanced sgRNA expression vector pU6-tRNA-gRNA used in Example 1.

[0024] Figure 4 Figure of the transformation results of the inventive group in Example 2, wherein Figure 4 A is the colony morphology on the primary transformation plate, Figure 4 B is the colony morphology after the second purification, showing a typical white phenotype.

[0025] Figure 5 Figure of the host survival curve after infection of the wild type and Δmp1 mutant strains of M. alpina in Example 3. DETAILED DESCRIPTION

[0026] Example 1

[0027] Construction of basic elements of the CRISPR / Cas9 system and general experimental methods

[0028] This example aims to construct basic elements for gene editing of M. alpina, including an optimized Cas9 expression vector and a series of modular sgRNA expression vectors; (PCR amplification of all DNA fragments in the inventive examples, if not otherwise specified, is performed using a high-fidelity, hot-start DNA polymerase);

[0029] 1. Construction by PCR amplification, wherein the reaction system is shown in Table 1:

[0030] Table 1 Reaction system (50 μL)

[0031]

[0032] Note: The amount of template DNA is adjusted according to its type: 10 pg-30 ng for plasmid DNA and 50-400 ng for genomic DNA;

[0033] The reaction procedure is shown in Table 2:

[0034] Table 2 Reaction procedure

[0035]

[0036] 2. Construction of the Cas9 expression vector

[0037] To express Cas9 nuclease in high efficiency in Marninifia, an optimized Cas9 expression vector pCas9-H2B was designed, and the structure thereof is shown in Figure 1

[0038] The key elements include: a codon-optimized Cas9 gene driven by a strong promoter Pef1a, and a nuclear localization signal (H2B NLS) derived from the endogenous histone H2B of Marninifia at the C-terminal. The endogenous H2B NLS is selected to improve the specific localization and enrichment efficiency of Cas9 protein in the nucleus of Marninifia. The full sequence of the pCas9-H2B vector is constructed based on the plasmid pCAMBIA0380 as a carrier, and is designed and entrusted to General Biotech (Anhui) Co., Ltd. for full gene synthesis.

[0039] The pCas9-H2B sequence is shown in SEQ ID NO: 1:

[0040] ​cctcccaaa gctgccgaga agaagcccag cactggtggc aaggccccag ctggaaagga ctgctgctga gaagaaggag gctggca agaagactgc caccgctgcc actggcgaga agaagaagcg tggcaagacc cgcaaggaaa cctactcttc ctac Figure 2 taacagctcgaatttccccgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatc.

[0041] Note: italicized part is the strong promoter of EF-1-alpha from T. marneffei, which is used to drive the constitutive and high efficient expression of downstream genes;

[0042] Bold part is the Cas9 endonuclease gene from Streptococcus pyogenes, whose codons are optimized to adapt to the high efficient expression in T. marneffei;

[0043] Underlined part is the Nuclear Localization Signal from the C-terminus of the endogenous histone H2B of T. marneffei, which is used to guide the Cas9 protein into the nucleus;

[0044] Bold italicized part is the terminator and poly(A) tailing signal from the nopaline synthase gene of Agrobacterium, which is used to ensure the correct termination and stabilization of the transcript.

[0045] 3. Construction of a series of modular sgRNA expression vectors

[0046] To systematically verify the effect of the tRNA-Gly enhancer element of the present application, a series of sgRNA expression plasmids were constructed in a modular manner in this embodiment;

[0047] Control group: the construction process of the control sgRNA expression vector pU6-gRNA is as follows:

[0048] Firstly, the complete DNA sequence of sgRNA expression cassette containing Talaromyces marneffei endogenous U6 promoter and universal sgRNA scaffold was designed.

[0049] Subsequently, the designed sequence was entrusted to Suzhou Jinyuizhi Biotechnology Co., Ltd. for whole gene synthesis;

[0050] The synthesized DNA fragment (SEQ ID NO: 2) was connected to the pUC57-GW-Kan universal vector scaffold provided by the company through Seamless Cloning technology, thereby obtaining the recombinant plasmid pU6-gRNA.

[0051] The finally obtained pU6-gRNA plasmid was verified by Sanger sequencing to ensure that its sequence was completely consistent with the design. The structure of the plasmid is shown in GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC , and it serves as the starting template for subsequent modular construction.

[0052] Among them, the sequence of pU6-gRNA is shown in SEQ ID NO: 2:

[0053] GTCTGTTCACCACAACCAGGTGTCACCGTCCTTATACGGCCAGTTTTTCCTTCCATAGTATTTCACCTACTATTTCTGCCTAGCCCTTTCTTCTATTTCCATTCATTTTTTTTCACTTCGTTCGACCTTTGCCATTGATCAGACCAGACAATCCGGTAAGCGACAATTTTGATGTTCCTTTGTGGCCTCAGGCCCACAACTACTCACACCGGCAGCCAAGCGACCCAATCAACCACTTTCATCCCCAACCCAACACTTTCCGACCCCTCCCATATAATCCATTCGGTTCCTATGCCTTATAAAGGACGAAACACCTGAGACCATGGTCTCG GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC Figure 3 TTTTTT;

[0054] Note: The italic part is the U6 small nuclear RNA (U6 snRNA) promoter of T. marneffei endogenous, which is recognized by RNA polymerase III (Pol III) and used to drive the efficient and constitutive expression of sgRNA.

[0055] The underlined part is a universal single guide RNA skeleton sequence derived from the S. pyogenes CRISPR / Cas9 system;

[0056] The bold part is the RNA polymerase III (Pol III) terminator, which is composed of a continuous thymine (T) segment as a clear signal for accurate termination of sgRNA transcription driven by Pol III.

[0057] Invention group: enhanced sgRNA expression vector (pU6-tRNA-gRNA): based on pU6-gRNA, a tRNA-Gly enhancer element (SEQ ID NO: 3) is inserted between the U6 promoter and the sgRNA skeleton, and the structure is as shown in GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTC ;

[0058] Among them, the sequence of pU6-tRNA-gRNA is shown as SEQ ID NO: 4:

[0059] GTCTGTTCACCACAACCAGGTGTCACCGTCCTTATACGGCCAGTTTTTCCTTCCATAGTATTTCACCTACTATTTCTGCCTAGCCCTTTCTTCTATTTCCATTCATTTTTTTTCACTTCGTTCGACCTTTGCCATTGATCAGACCAGACAATCCGGTAAGCGACAATTTTGATGTTCCTTTGTGGCCTCAGGCCCACAACTACTCACACCGGCAGCCAAGCGACCCAATCAACCACTTTCATCCCCAACCCAACACTTTCCGACCCCTCCCATATAATCCATTCGGTTCCTATGCCTTATAACAAAGCATCATTGGTCTAGTGGTAGAATTCATCGTTGCCATCGATGAGGCCCGTGTTCGATTCACGGATGATGCAAAAGGACGAAACACCTGAGACCATGGTCTCG CGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC Figure 4 TTTTTT;

[0060] Note: The italic part represents the U6 small nuclear RNA (U6 snRNA) promoter endogenous to T. marneffei, which is recognized by RNA polymerase III (Pol III) and used to drive high-efficiency and constitutive expression of sgRNA;

[0061] The underlined part represents the universal single guide RNA skeleton sequence derived from the S. pyogenes CRISPR / Cas9 system;

[0062] The underlined part represents the universal single guide RNA skeleton sequence derived from the S. pyogenes CRISPR / Cas9 system;

[0063] The underlined part represents the universal single guide RNA skeleton sequence derived from the S. pyogenes CRISPR / Cas9 system;

[0064] The construction method is as follows: the universal PCR amplification method of step 1 of example 1 is used, the pU6-gRNA plasmid is used as a template, and the primer pair CBO7427 / 7428 is used for amplification to obtain the linearized vector skeleton pU6-tRNA-gRNA;

[0065] The linearized vector skeleton pU6-tRNA-gRNA and the tRNA-Gly enhancement element (SEQ ID NO: 3) as an insertion fragment are connected by homologous recombination using a recombination enzyme cloning kit (NEBuilder® HiFi DNA Assembly MasterMix of NEB Company. Catalog No: E2621L);

[0066] The relevant primers and sequences are shown in Table 3:

[0067] Table 3 Relevant primers and sequences

[0068]

[0069] All the obtained recombination products are transformed into E. coli DH5α competent cells for amplification, and the sequence is verified by Sanger sequencing to be correct.

[0070] Example 2

[0071] This example aims to prove that the tRNA-Gly sequence (SEQ ID NO: 3) can significantly improve the gene editing efficiency of the CRISPR / Cas9 system in M. lusitanica by direct comparison;

[0072] Table 4 Primer sequences

[0073]

[0074] Note: The polyketide synthase gene pks3 was selected as the reporter gene, and its inactivation will cause the colony color to change from red to white, which is easy to observe.

[0075] 1. Preparation of gene editing elements:

[0076] All linear DNA fragments were prepared by the general PCR amplification method described in step 1 of Example 1:

[0077] (1) Preparation of sgRNA expression cassette: two-step overlap extension PCR method was used.

[0078] First, the pU6-gRNA or pU6-tRNA-gRNA expression vector constructed in step 3 of Example 1 was used as a template to perform two rounds of PCR: the first round used primer pair CBO7070 / CBO7291 in Table 4, and the second round used primer pair CBO7292 / CBO7073 in Table 4; then, the two PCR products were mixed in equal molar amounts as a template, and fusion PCR was performed using primer pair CBO7070 / CBO7073 in Table 4 to obtain the complete sgRNA expression cassette containing the pks3 target sequence.

[0079] (2) Preparation of Cas9 expression cassette: the pCas9-H2B vector prepared in step 2 of Example 1 was used as a template, and primer pair CBO7074 / CBO7526 in Table 4 was used for PCR amplification.

[0080] (3) Preparation of donor DNA: the full-length genomic DNA sequence of M. lylani was used as a template, and primer pairs CBO7285 / CBO7286 and CBO7287 / CBO7288 in Table 4 were used to amplify the upper and lower homology arms of the pks3 gene, respectively; the pNAT-HYG plasmid (SEQ ID NO: 19) was used as a template, and primer pair CBO6732 / CBO6733 was used to amplify the hygromycin resistance gene (hph) expression cassette. The three fragments were assembled into linear donor DNA for HDR repair by fusion PCR;

[0081] Among them, the sequence of the pNAT-HYG plasmid is shown in SEQ ID NO: 19:

[0082]

[0083] The specific process of fusion PCR is as follows:

[0084] Preparation of donor DNA: linear donor DNA for homology directed repair (HDR) is prepared by the method of overlap extension fusion PCR, which comprises the following steps:

[0085] (1) Amplification of initial fragments:

[0086] The upstream homology arm (LHA) is obtained by PCR amplification using primer pair CBO7285 / CBO7286 in Table 4, with the Malbranchea gene genomic DNA as the template, and the upstream homology arm of the pks3 gene is obtained, wherein the 5' end of the downstream primer CBO7286 contains a sequence complementary to the start end of the hygromycin resistance gene (hph) expression cassette.

[0087] The downstream homology arm (RHA) is obtained by PCR amplification using primer pair CBO7287 / CBO7288, with the Malbranchea gene genomic DNA as the template, and the downstream homology arm of the pks3 gene is obtained. Wherein the 5' end of the upstream primer CBO7287 contains a sequence complementary to the end of the hph expression cassette.

[0088] Screening marker gene: using the plasmid containing the hygromycin resistance gene (hph) expression cassette as the template, primer pair CBO6732 / CBO6733 is used for PCR amplification.

[0089] The three PCR products are subjected to gel electrophoresis and recovered and purified.

[0090] (2) Fusion PCR assembly:

[0091] The three fragments of the upstream homology arm, the hph expression cassette and the downstream homology arm purified in step (1) are mixed in a molar ratio of 1:2:1, and are used as the template for the second round of fusion reaction.

[0092] The outermost primer pair (Nested Primers), i.e. CBO7285 and CBO7288, is used for the second round of PCR reaction.

[0093] (3) Product verification and purification: the final fusion PCR product is verified by agarose gel electrophoresis, and after confirming that its size is consistent with the expected full-length donor DNA, it is subjected to gel recovery and purification for subsequent protoplast transformation experiments.

[0094] 2. Preparation and transformation of Malbranchea protoplasts

[0095] Protoplast preparation and transformation were performed using conventional methods in the art (Szewczyk et al. 2006. Nature Protocols 1(6): 3111-3120.).

[0096] The sgRNA expression cassette (1.5 μg), Cas9 expression cassette (3 μg) and donor DNA (3 μg) prepared in step 1 were mixed in the same 1.5 mL centrifuge tube, then the mixed DNA solution was completely evaporated to dryness using a vacuum concentrator, finally, 15 μL of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) was added to the centrifuge tube containing the dry DNA precipitate, which was fully resuspended and dissolved by gentle blowing, thereby obtaining a highly concentrated DNA mixture for subsequent PEG-mediated co-transformation. The mixture was co-transformed into protoplasts by PEG-mediated method and screened on the regeneration medium containing 200 μg / mL hygromycin.

[0097] 3. Efficiency calculation

[0098] The gene editing efficiency was calculated according to the number of positive transformants (white colonies) counted by colony color.

[0099] The results are shown in Table 5 and Figure 4 .

[0100] Control group: using pU6-gRNA system without tRNA-Gly element, the gene editing efficiency was 75.0%;

[0101] Invention group: using pU6-tRNA-gRNA system integrated with tRNA-Gly enhancement element, the gene editing efficiency was significantly improved to 95.8%.

[0102] Figure 4 A and Figure 5 B respectively show the transformation results of G2 group on the primary and secondary plates, a large number of well-grown white colonies can be seen, which directly proves the success of gene knockout. There is a significant difference in gene editing efficiency between the two groups of experiments. This result powerfully proves that the introduction of tRNA-Gly sequence as an enhancement element into the sgRNA expression system can significantly improve the gene editing efficiency mediated by CRISPR / Cas9.

[0103] Table 5 Effect of tRNA-Gly enhancement element on pks3 gene editing efficiency

[0104]

[0105] Note: G0 is the negative control group with only the donor DNA transformed, and the extremely low total number of primary transformants proves the necessity of the CRISPR-Cas9 system for efficient transformation.

[0106] Example 3

[0107] Application of the optimized system in the validation of the function of the known virulence gene mp1

[0108] This example aims to demonstrate the reliability and practical value of the optimized gene editing system CRISPR-Cas9 in functional genomics research, by targeting the knockout of the known key virulence factor mp1, to verify whether this system can accurately reproduce its biological function.

[0109] Table 6 Primers

[0110]

[0111] 1. Preparation of gene knockout elements:

[0112] Using the universal PCR amplification method of step 1 in Example 1

[0113] (1) sgRNA expression cassette: using the overlap extension PCR method, using the primer pair CBO8551 / CBO8550 in Table 6 and the universal outer primers CBO7070 / CBO7073 (Table 4), and using the pU6-tRNA-gRNA plasmid as the template, an enhanced sgRNA expression cassette targeting the mp1 gene was prepared.

[0114] (2) Cas9 expression cassette: using the primer pair CBO7074 / CBO7526 in Table 4, the pCas9-H2B vector prepared in step 2 of Example 1 was used as the template for amplification.

[0115] (3) Donor DNA: using the full-length genomic sequence DNA of M. mycoides as the template, the primer pair CBO8546 / CBO8547 and CBO8548 / CBO8549 in Table 6 was used to amplify the upper and lower homology arms of the mp1 gene, respectively; the primer pair CBO6732 / CBO6733 in Table 4 was used to amplify the hygromycin resistance gene (hph) expression cassette. Through fusion PCR (process same as Example 2), the three fragments were assembled into linear donor DNA.

[0116] 2. Transformation and selection

[0117] The same method as in Example 2 was used for the preparation and transformation of M. mycoides protoplasts, and the transformants were selected on the regeneration medium containing hygromycin.

[0118] 3. Verification of transformants

[0119] The transformant colonies were picked and verified whether the mp1 gene was successfully replaced by colony PCR (primer pair CBO8544 / CBO8545 in Table 6).

[0120] 4. Animal infection test

[0121] The Δmp1 mutant strain and wild type (WT) strain verified correctly by colony PCR in step 3 were selected;

[0122] The mice were anesthetized with isoflurane, and the lower respiratory tract infection was performed using a lung liquid quantification atomizer (HRH-MAG4, Beijing Hui Rong He), 1x10 8 The 6-8 week old BALB / c female mice (10 in each group) were inoculated with 1x10

[0123] The results are shown in Table 1: ​ The mice infected with the Δmp1 mutant strain showed significantly reduced pathogenicity. Log-rank test analysis showed that the survival curves between the two groups had statistically significant difference (p=0.038).

[0124] The results powerfully prove that the CRISPR / Cas9 gene editing system established by the tRNA-Gly element optimization has high accuracy and reliability, and is a powerful and practical tool for studying the gene function of the pathogenic fungi such as Malassezia.

[0125] The above-described embodiments are only to describe the preferred modes of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.

Claims

1. A tRNA-Gly sequence of Malassezia, characterized in that, The sequence is shown as SEQ ID NO:

3.

2. A high efficient CRISPR / Cas9 gene editing system of Marniniflca grisea containing the tRNA-Gly sequence of claim 1, characterized in that, The CRISPR / Cas9 gene editing system comprises a Cas9 expression vector and an sgRNA expression vector.

3. The CRISPR / Cas9 gene editing system of claim 2, wherein, The Cas9 expression vector is constructed based on plasmid pCAMBIA0380.

4. The CRISPR / Cas9 gene editing system of claim 2, wherein, The tRNA-Gly sequence is inserted into the endogenous U6 promoter of M. laco-cyanus and a universal sgRNA backbone to obtain an sgRNA expression vector.

5. The CRISPR / Cas9 gene editing system of claim 4, wherein, The sequence obtained by inserting the tRNA-Gly sequence into the endogenous U6 promoter of M. laco-cyanus and a universal sgRNA backbone is shown as SEQ ID NO:

4.

6. Use of the tRNA-Gly sequence of M. laco-cyanus in claim 1 in constructing a high-efficiency CRISPR / Cas9 gene editing system of M. laco-cyanus.

7. Use of the tRNA-Gly sequence in claim 1 or the CRISPR / Cas9 gene editing system in any one of claims 2-5 in gene editing of M. laco-cyanus.

8. A method of improving the efficiency of gene editing of Malassezia CRISPR / Cas9, characterized in that, It comprises introducing the tRNA-Gly sequence in claim 1 into an sgRNA expression vector as an sgRNA processing enhancement element.