A dragon fruit u6 gene promoter and application thereof

Abstract

The application discloses a pitaya U6 gene promoter and application thereof. The pitaya U6 gene promoter is any one of proHuU6.1, proHuU6.1.2 and proHuU6.1.3, the DNA nucleotide sequence of proHuU6.1 is shown in SEQ ID NO. 4, the DNA nucleotide sequence of proHuU6.1.2 is shown in SEQ ID NO. 5, and the DNA nucleotide sequence of proHuU6.1.3 is shown in SEQ ID NO. 6. The application first clones the pitaya U6 snRNA gene RNA polymerase III promoter, i.e., the pitaya endogenous U6 promoter, from pitaya genomic DNA, provides an efficient promoter sequence for studying the transformation of pitaya and close plants, and has important significance for constructing a pitaya gene editing system and creating pitaya germplasm resources with excellent traits.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, particularly the field of plant transgenic technology, and specifically relates to a dragon fruit U6 gene promoter and its application. Background Technology

[0002] pitaya( Hylocereus undatus (Haw.) Britton & Rose belongs to the genus *Hylocereus* of the family Cactaceae. Hylocereus Dragon fruit (Pyracantha fortuneana) is a highly distinctive fruit crop in tropical and subtropical regions. Due to its unique taste, rich nutritional value, ornamental value, medicinal uses, and industrial applications, it occupies an increasingly important position in the global fruit market. Dragon fruit is widely distributed in tropical and subtropical regions around 30° north and south latitude. In my country, it is mainly distributed in the southern coastal provinces such as Hainan, Guangdong, and Guangxi. Dragon fruit possesses significant biological characteristics such as heat resistance, drought resistance, low soil fertility requirements, and strong adaptability. Furthermore, its fruit is rich in dietary fiber, minerals, protein, unsaturated fatty acids, and various antioxidants, making it extremely nutritious.

[0003] Gene editing technology is a revolutionary biotechnology that, based on a variety of tools, enables scientists to precisely edit and alter specific gene sequences. Applications of gene editing technology in agriculture include improving crop disease resistance and stress tolerance, modifying nutrient composition, increasing yield, and reducing pesticide use. Currently, the CRISPR-Cas system is the most widely used technology in plant gene editing. CRISPR-Cas technology is a gene editing technology developed based on bacterial innate immune mechanisms, achieving targeted modification of the genome through guide RNA precise positioning and Cas protein cleavage of DNA.

[0004] The U6 promoter is a type of RNA promoter specifically recognized by RNA polymerase III (Pol III). Its core function is to drive the transcription of U6 small nuclear RNA (U6 snRNA), thereby participating in the splicing regulation of pre-mRNA in plant cells. Due to its high transcriptional efficiency and structural conservation, the U6 promoter is a commonly used promoter for driving sgRNA expression in the CRISPR-Cas gene editing system. The U6 promoter contains two core regulatory elements: an upstream activation sequence (USE) element that regulates transcriptional activity, and a TATA box element that recognizes and binds to RNA polymerase III to drive promoter transcription. These elements together determine the promoter's transcriptional efficiency and species specificity. In plant gene editing, using endogenous U6 promoters (i.e., the target species' own U6 promoter) is generally more advantageous than borrowing U6 promoters from other species. For example, in cotton, using the cotton endogenous U6 promoter is more efficient than using the Arabidopsis U6 promoter. Currently, endogenous U6 promoters have been used to construct CRISPR / Cas9 editing systems in rice, Arabidopsis, tobacco, wheat, lettuce, and grape species, achieving highly efficient editing systems. In gene editing systems, CRISPR / Cas9 vectors are too large, increasing the difficulty of infection. Furthermore, previous studies have found that the 5' end of the U6 promoter contains a repressor. For example, in cotton, the GbU6-5P promoter, truncated to six segments (672, 468, 358, 280, 202, and 105 bp), retains transcriptional activity even at 105 bp, with activity increasing with truncated length. In jute, the CcU6.3 promoter truncated to 550 bp exhibits higher transcriptional activity in tobacco leaves and hairy roots than the full-length promoter. In apple, truncating the U6 promoter on chromosome 10 to 1500, 959, 275, and 116 bp, with the 275 bp promoter showing the highest fluorescence value and transcriptional activity in tobacco leaves. Therefore, high transcriptional activity and an appropriate U6 promoter length are beneficial for the construction of CRISPR / Cas9 vectors.

[0005] Currently, there is a lack of systematic research on the sequence characteristics, transcriptional regulatory mechanisms, and applicability of the dragon fruit U6 promoter in gene editing systems, which has become the primary key technical obstacle to the establishment of a dragon fruit gene editing technology system. Summary of the Invention

[0006] The purpose of this invention is to address the above-mentioned problems by providing a dragon fruit U6 gene promoter and its application.

[0007] To achieve its objective, the present invention employs the following technical solution:

[0008] The first aspect of the present invention provides a dragon fruit U6 gene promoter, wherein the dragon fruit U6 gene promoter is any one of proHuU6.1, proHuU6.1.2, and proHuU6.1.3, wherein the DNA nucleotide sequence of proHuU6.1 is shown in SEQ ID NO.4, the DNA nucleotide sequence of proHuU6.1.2 is shown in SEQ ID NO.5, and the DNA nucleotide sequence of proHuU6.1.3 is shown in SEQ ID NO.6.

[0009] A second aspect of the present invention provides an expression box containing the above-described promoter.

[0010] A third aspect of the present invention provides a recombinant vector containing the above-described promoter or expression cassette.

[0011] Preferably, the recombinant vector is a recombinant expression vector or a recombinant cloning vector.

[0012] Preferably, the backbone vector of the recombinant expression vector is the plant binary expression vector pCAMBIA1303, and the backbone vector of the recombinant cloning vector is pMD19-T.

[0013] A fourth aspect of the present invention provides a recombinant bacterium containing the above-described promoter, expression cassette, or recombinant vector.

[0014] The fifth aspect of the present invention provides the use of the above-described dragon fruit U6 gene promoter in any of the following:

[0015] (1) Application in the construction of expression cassettes, recombinant vectors or recombinant bacteria;

[0016] (2) Application in the construction of transgenic plants;

[0017] (3) Application in plant molecular breeding;

[0018] (4) Application in initiating the expression of target genes in plants;

[0019] The plant in question is either dragon fruit or Arabidopsis thaliana.

[0020] A sixth aspect of the present invention provides a method for expressing a target nucleic acid molecule in a plant, the method comprising introducing a nucleic acid construct into the plant, the nucleic acid construct containing the aforementioned promoter and a target nucleic acid molecule operatively linked to the promoter, wherein the plant is dragon fruit or Arabidopsis thaliana.

[0021] The beneficial effects of this invention are:

[0022] This invention is the first to clone the type III RNA polymerase promoter of the dragon fruit U6 snRNA gene—the endogenous dragon fruit U6 promoter—from the dragon fruit genomic DNA. This promoter was fused with the GUS gene, and the inflorescences of Arabidopsis thaliana were infected using Agrobacterium-mediated transformation to obtain T2 generation transgenic Arabidopsis thaliana. Stable expression of GUS confirmed the transcriptional activity of this promoter in leaves, cauline leaves, stems, pods, and inflorescences, providing a U6 promoter sequence for dragon fruit gene editing and transformation research. Furthermore, this invention is the first to truncate the active dragon fruit U6 gene promoter proHuU6.1, obtaining the truncated dragon fruit U6 gene promoters proHuU6.1.2 and proHuU6.1.3. The construction of a fusion expression vector with the GUS gene verified that the truncated dragon fruit U6 gene promoters still possess transcriptional activity, with proHuU6.1.2 exhibiting the highest transcriptional activity. The dragon fruit U6 promoter of this invention provides an efficient promoter sequence for the study of transformation of dragon fruit and closely related plants, which is of great significance for constructing a dragon fruit CRISPR / Cas gene editing system and creating dragon fruit germplasm resources with superior traits. Attached Figure Description

[0023] Figure 1 This is a sequence comparison diagram of the dragon fruit proHuU6.1 promoter and the Arabidopsis thaliana U6 promoter.

[0024] Figure 2 The image shows an agarose gel electrophoresis diagram of the cloned HuU6+U6 snRNA sequence analysis. Lanes 1 and 2 in the diagram are the amplified bands of HuU6+U6 snRNA.

[0025] Figure 3 Agarose gel electrophoresis images of the amplification products of promoters proHuU6.1, proHuU6.1.2, and proHuU6.1.3.

[0026] Figure 4 Agarose gel electrophoresis image showing PCR-positive identification of the T1 generation transgenic Arabidopsis thaliana using the GUS fusion expression vector of the dragon fruit U6 promoter.

[0027] Figure 5 GUS staining image of leaves from T2 generation transgenic Arabidopsis thaliana plants with GUS fusion expression vector of dragon fruit U6 promoter.

[0028] Figure 6 The image shows the quantitative results of the GUS gene in the T2 generation transgenic Arabidopsis thaliana plants of the dragon fruit U6 promoter GUS fusion expression vector.

[0029] Figure 7 GUS staining images of various tissues of T2 generation transgenic Arabidopsis thaliana plants with the GUS fusion expression vector of dragon fruit U6 promoter. Detailed Implementation

[0030] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0031] Unless otherwise specified, the methods described in the following examples are conventional methods.

[0032] Example 1: Obtaining the promoter of the dragon fruit U6 gene and constructing the promoter GUS fusion expression vector.

[0033] Based on the conservation of the U6 gene sequence across different species, the DNA sequence of the conserved 102bp U6 snRNA from the Arabidopsis thaliana AtU6-26 gene (Genebank accession number: X52528.1) was compared with the dragon fruit genome sequence (http: / / www.pitayagenomic.com / download.php). One candidate HuU6 gene for dragon fruit was identified, and its upstream reference sequence was obtained. DNAMAN software was used to compare the Arabidopsis thaliana U6 promoter + U6 snRNA sequence with the dragon fruit U6 promoter + U6 snRNA sequence. Figure 1 As shown, the dragon fruit U6 promoter contains a typical TATA-like box element that binds to pol III RNA polymerase and an upstream sequence element USE. PCR amplification primer pairs HuU6-1F and HuU6-1R were designed upstream and downstream of the obtained candidate dragon fruit U6 promoter + U6 snRNA sequence to amplify the dragon fruit U6 promoter + U6 snRNA sequence fragment.

[0034] 100 mg of fresh dragon fruit stem segments were taken, ground into powder using liquid nitrogen freeze-thaw method, and genomic DNA was extracted from the dragon fruit stem segments using CATB method. The DNA concentration was measured using a spectrophotometer and the quality was detected using 1% agarose gel electrophoresis.

[0035] Using dragon fruit stem segment genomic DNA as a template and HuU6-1F and HuU6-1R as primers, PCR amplification was performed using PrimeSTAR® Max DNA Polymerase (TaKaRa, Japan). The reaction volume was 50 μL, containing 1 μL each of 10 μM HuU6-1F and HuU6-1R primers, 200-500 ng of dragon fruit genomic DNA, 25 μL of PrimeSTAR® Max DNA Polymerase, and sterile water to a final volume of 50 μL. The PCR program was as follows: 98℃ pre-denaturation for 5 min; then 35 cycles of 95℃ for 30 s, 60℃ for 45 s, and 72℃ for 90 s; followed by 72℃ for 5 min. The sequences of primers HuU6-1F and HuU6-1R are as follows:

[0036] HuU6-1F (SEQ ID NO.1): 5'-TTGTTTCCAGGGTAAGTCTGTCTGC-3';

[0037] HuU6-1R (SEQ ID NO. 2): 5'-AAAAAAATTTGGACCATTTCTCGATT-3'.

[0038] Amplification results as follows Figure 2 As shown, the amplified band was 1217 bp (sequence shown in SEQ ID NO.3), which is the amplified band of the dragon fruit U6 promoter + U6 snRNA gene. The obtained PCR product was given an A tail and ligated into the T vector pMD 19-T (TaKaRa, Japan), transformed into E. coli, identified by bacterial culture PCR, and named p19T-U6 after Sanger sequencing confirmed the results were correct.

[0039] Based on the dragon fruit U6 promoter + U6snRNA sequence obtained from sequencing (SEQ ID NO.3), the 802bp upstream of the transcription start point G of the dragon fruit U6snRNA gene was used as the U6 promoter and named proHuU6.1 (sequence shown in SEQ ID NO.4). The 5' end of this promoter was then truncated to obtain two different promoter truncated versions: the first is 584bp and named proHuU6.1.2 (sequence shown in SEQ ID NO.5); the second is 329bp and named proHuU6.1.3 (sequence shown in SEQ ID NO.6). PCR amplification primers for the proHuU6.1 promoter and its truncated fragment were designed, and 15 bp upstream and downstream of the vector restriction enzyme site were added to the 5' end of the primers for PCR amplification. Using p19T-U6 bacterial culture as a template, PCR amplification was performed using PrimeSTAR® MaxDNA Polymerase high-fidelity polymerase. The reaction system was 50 μL, containing 1 μL each of 10 μM upstream and downstream primers, 1 μL of p19T-U6 bacterial culture, 25 μL of PrimeSTAR® Max DNA Polymerase, and sterile water to a final volume of 50 μL. The PCR reaction program was: 95℃ pre-denaturation for 5 min; 95℃ for 30 s, 65℃ for 45 s, 72℃ for 90 s, 35 cycles; 72℃ for 5 min. The amplification primers for promoters proHuU6.1, proHuU6.1.2, and proHuU6.1.3 are as follows (the underlined lowercase letters indicate the vector homologous arm sequence):

[0040] The amplification primer pair for proHuU6.1 is proHuU6.1-F / proHuU6.1-R:

[0041] proHuU6.1-F (SEQ ID NO.7):

[0042] 5'- cggtacccggggatc GTAAGTGAGCAAAGAGGAACCTTCT-3';

[0043] proHuU6.1-R (SEQ ID NO.8):

[0044] 5' -gtcagatctaccatg AGCAACAAGCCTGTTCTGCAG-3';

[0045] The amplification primer pair for proHuU6.1.2 is proHuU6.1.2-F / proHuU6.1-R (SEQ ID NO.8):

[0046] proHuU6.1.2-F (SEQ ID NO.9)

[0047] 5'- cggtacccggggatc GTGGCAGAATATGTGGTGCAGTG-3';

[0048] The amplification primer pair for proHuU6.1.3 is proHuU6.1.3-F / proHuU6.1-R (SEQ ID NO.8):

[0049] proHuU6.1.3-F (SEQ ID NO.10):

[0050] 5'- cggtacccggggatc TGCATAGAACTCCTAGATTATTTTG-3'.

[0051] The downstream amplification primers for promoters proHuU6.1.2 and proHuU6.1.3 are both proHuU6.1-R (SEQ ID NO: 6.1-R).

[0052] ID NO.8).

[0053] PCR products were identified using a 1% agarose gel electrophoresis, such as... Figure 3 As shown, amplified bands containing vector homologous arms (proHuU6.1, proHuU6.1.2, and proHuU6.1.3) were successfully obtained. The PCR products were purified and recovered to obtain the promoter fragments, which were then sequenced. The sequences of the proHuU6.1, proHuU6.1.2, and proHuU6.1.3 amplified bands were the corresponding promoter sequences (shown in SEQ ID NO.4, SEQ ID NO.5, or SEQ ID NO.6) plus the vector homologous arm sequences at both ends. BamHI and Nco The plant binary expression vector pCAMBIA1303 (selected for the hygromycin gene) was digested overnight with restriction enzyme I, and the linearized vector was purified and recovered. The promoter and linearized vector were ligated using the ClonExpress II One Step Cloning Kit (Novozymes, China). The ligation system consisted of: 2 μL of 5*CE II Buffer, 200 ng of linearized vector, 50 ng of recovered promoter fragment, and sterile water to a final volume of 10 μL. Homologous recombination was performed at 37℃ for 30 min to obtain the recombinant product. The recombinant product was transformed into *E. coli*, and bacterial PCR was performed to identify the successful acquisition of the dragon fruit U6 promoter GUS fusion expression vectors: pCAMBIA1303-proHuU6.1::GUS expression vector, pCAMBIA1303-proHuU6.1.2::GUS expression vector, and pCAMBIA1303-proHuU6.1.3::GUS expression vector.

[0054] Example 2: Genetic transformation of dragon fruit U6 promoter GUS fusion expression vector and verification of promoter function

[0055] I. Genetic Transformation of Dragon Fruit U6 Promoter GUS Fusion Expression Vector

[0056] The pCAMBIA1303-proHuU6.1::GUS expression vectors, pCAMBIA1303-proHuU6.1.2::GUS expression vectors, and pCAMBIA1303-proHuU6.1.3::GUS expression vectors obtained in Example 1 were transformed into GV3101 Agrobacterium competent cells using a liquid nitrogen flash-freezing transformation method. Using wild-type Arabidopsis thaliana (col) as the recipient, the dragon fruit U6 promoter GUS fusion expression vector was transformed into Arabidopsis thaliana through Agrobacterium infection of Arabidopsis thaliana inflorescences.

[0057] Seeds of Arabidopsis thaliana produced after infection with the Agrobacterium tumefaciens vector GV3101 containing the dragon fruit U6 promoter GUS fusion expression vector were collected. After disinfection with 75% ethanol, the seeds were sown on 1 / 2 MS medium containing 60 mg / L hygromycin for antibiotic selection. Arabidopsis seedlings with true leaves and roots were transplanted into soil for further cultivation. Five Arabidopsis seedlings transformed with each dragon fruit U6 promoter GUS fusion expression vector were selected for PCR identification. Genomic DNA was extracted from the rosette leaves of transgenic Arabidopsis for PCR identification. The proHuU6.1 promoter fragment was identified using proHuU6.1-F and proHuU6.1-R primers; the proHuU6.1.2 promoter fragment was identified using proHuU6.1.2-F and proHuU6.1-R primers; and the proHuU6.1.3 promoter fragment was identified using proHuU6.1.3-F and proHuU6.1-R primers. PCR was performed using 2× Taq Master Mix (Novizan, China). The PCR reaction system consisted of 1 μL each of 10 μM upstream and downstream primers, 100-200 ng of transgenic Arabidopsis rosette leaf genomic DNA, 5 μL of 2× Taq Master Mix, and sterile water to a final volume of 10 μL. The PCR program was 95℃ for 7 min; 95℃ for 30 s, 64℃ for 45 s, 72℃ for 1 min, for 35 cycles; 72℃ for 5 min. PCR products were detected by agarose gel electrophoresis. Figure 4 As shown, the amplification bands of the three promoters in the genomic DNA of the rosette leaves of transgenic Arabidopsis thaliana are all of the correct size.

[0058] II. Verification of the startup sub-functions of Dragon Fruit proHuU6.1, proHuU6.1.2, and proHuU6.1.3

[0059] Seeds from the selected positive T1 generation Arabidopsis thaliana plants were collected. After sterilization with 75% alcohol, the seeds were sown on 1 / 2 MS medium containing 60 mg / L hygromycin for antibiotic selection. Arabidopsis seedlings with true leaves and roots were transplanted into soil for further culture. T2 generation transgenic Arabidopsis thaliana plants using the dragon fruit U6 promoter GUS fusion expression vector were obtained.

[0060] GUS histochemical staining was performed on T2 generation transgenic Arabidopsis thaliana plants using the dragon fruit U6 promoter GUS fusion expression vector. The procedure was as follows: Wild-type Arabidopsis thaliana plants were used as negative controls. Rosette leaves, scape leaves, stems, pods, and flowers from both transgenic and wild-type plants were placed in freshly prepared GUS staining solution (200 mL: 0.7444 g EDTA-2Na + 0.3292 g potassium ferricyanide + 0.4224 g potassium ferrocyanide + 190 mL sodium phosphate buffer (pH 7.0) + 1 mL 10 mM X-Gluc) and stained at 37°C for 48 h. After staining, the plants were repeatedly destained in 75% ethanol to remove chlorophyll until the green color faded, and then photographed under a stereomicroscope. Leaf tissues from T2 generation transgenic Arabidopsis and wild-type Arabidopsis were harvested, flash-frozen in liquid nitrogen, and ground into powder. GUS protein was extracted using a GUS reporter gene quantification kit (Shanghai Bosen, China) according to the kit's instructions. Protein content was determined using a Bradford protein assay kit (Shanghai Bosen, China) according to the kit's instructions, and a protein standard curve was constructed. A 4-MUG standard curve was also constructed and 4-MUG fluorescence values ​​were measured according to the GUS reporter gene quantification kit's instructions.

[0061] GUS histochemical staining results as follows Figure 5 As shown, no blue color was observed in wild-type Arabidopsis thaliana, but blue color was observed in the leaves of transgenic Arabidopsis thaliana with the promoters proHuU6.1, proHuU6.1.2, and proHuU6.1.3, although the intensity of the blue color varied. The blue color of proHuU6.1 was lighter, while that of pHuU6.1.2 and pHuU6.1.3 was darker. The GUS staining of the three promoters was mainly concentrated in the veins and petioles.

[0062] GUS reporter gene quantification results as follows: Figure 6 As shown, the proHuU6.1.2 promoter exhibited the highest GUS activity at 9023.3 pmol / min / mg; followed by the proHuU6.1.3 promoter at 7650.1 pmol / min / mg; and the proHuU6.1 promoter showed the lowest GUS activity at 5139.9 pmol / min / mg.

[0063] GUS staining and quantitative detection of the GUS gene in transgenic Arabidopsis leaves showed that all three promoters had transcriptional activity in Arabidopsis. Among them, the proHuU6.1 promoter, truncated to 584 bp, showed the highest transcriptional activity in the proHuU6.1.2 promoter.

[0064] GUS histochemical staining results of various tissues from T2 generation transgenic Arabidopsis thaliana are as follows: Figure 7 As shown, no blue staining was observed in the rosette leaves, stems, pods, and flowers of wild-type Arabidopsis plants. GUS staining was detected in the rosette leaves, stems, pods, and flowers of transgenic Arabidopsis plants with the proHuU6.1, proHuU6.1.2, and proHuU6.1.3 promoters. These results indicate that the proHuU6.1, proHuU6.1.2, and proHuU6.1.3 promoters have transcriptional activity in the rosette leaves, stems, pods, and flowers.

[0065] The nucleotide sequence of the dragon fruit U6 gene promoter in this invention is as follows:

[0066] 1. The promoter proHuU6.1 sequence (SEQ ID NO.4) is as follows:

[0067] GTAAGTGAGCAAAGAGGAACCTTCTGAGGATGTGAATTAAGTCATGGCTCCTTGTATTTCTCTAAGCTATCTGAGTACTTCAGCACTTGTATACTTCAACTTTGTGATCAATCCTCTAGTATTCAGCAACAGCAATCCTTTTTTGAGACTGATTAGTTTGAGTTCTGCTTGTGTGATGGTTAGTGCTTTTGTCCAACTTATGAGAGCATCCTACAAATGTGGCAGAATATGTGGTGCAGTGTTCTGCGGACATCGTAGAGTTTAGACCTATGATGCTATTTTCACCTTGAGACAGGTCAAGGAGCCAATCCTCCGGAGTTTGAAGCCACAGAAATCCCCAGCGGTCCAGAAAGACAGGAGTGGTTTGTTAGTAATAAGGTGAATACTTTTGCTGCGTCGTTGTTGTCATGTTATATGCATCTTACTTGCTCTTTTTAGTTTAACACACACAACTGCTGCTTGCAAATAACGGTTGCATAGAACTCCTAGATTATTTTGCAAATCATGGTATGTCACCGGTTTTTTCCCCTGTATAAGTTCATCGAATAACTTACAACGAGTTTGTGAACTTAATCGGTGTGCAGTACTTCCACCCTTGTTAATTGTGGTTCAAATTGAAGGGTCCTTTGGCAGGAGAGGGGATTTTCAGGCAGGAGGGCTTTGCATAGCCGTTTGTCAATAGGGTTTGTGCGTTCATAGAGGTGTGATGTGGGCCTAGCATGCCTAATGCAGAGGAAAGTCCCACATTGCTATTTATGTAATTCAGTTGTTGTTGATATTCCTGCAGAACAGGCTTGTTGCT。

[0068] 2. The promoter proHuU6.1.2 sequence (SEQ ID NO.5) is as follows:

[0069] GTGGCAGAATATGTGGTGCAGTGTTCTGCGGACATCGTAGAGTTTAGACCTATGATGCTATTTTCACCTTGAGACAGGTCAAGGAGCCAATCCTCCGGAGTTTGAAGCCACAGAAATCCCCAGCGGTCCAGAAAGACAGGAGTGGTTTGTTAGTAATAAGGTGAATACTTTTGCTGCGTCGTTGTTGTCATGTTATATGCATCTTACTTGCTCTTTTTAGTTTAACACACACAACTGCTGCTTGCAAATAACGGTTGCATAGAACTCCTAGATTATTTTGCAAATCATGGTATGTCACCGGTTTTTTCCCCTGTATAAGTTCATCGAATAACTTACAACGAGTTTGTGAACTTAATCGGTGTGCAGTACTTCCACCCTTGTTAATTGTGGTTCAAATTGAAGGGTCCTTTGGCAGGAGAGGGGATTTTCAGGCAGGAGGGCTTTGCATAGCCGTTTGTCAATAGGGTTTGTGCGTTCATAGAGGTGTGATGTGGGCCTAGCATGCCTAATGCAGAGGAAAGTCCCACATTGCTATTTATGTAATTCAGTTGTTGTTGATATTCCTGCAGAACAGGCTTGTTGCT。

[0070] 3. The promoter proHuU6.1.3 sequence (SEQ ID NO.6) is as follows:

[0071] TGCATAGAACTCCTAGATTATTTTGCAAATCATGGTATGTCACCGGTTTTTTCCCCTGTATAAGTTCATCGAATAACTTACAACGAGTTTGTGAACTTAATCGGTGTGCAGTACTTCCACCCTTGTTAATTGTGGTTCAAATTGAAGGGTCCTTTGGCAGGAGAGGGGATTTTCAGGCAGGAGGGCTTTGCATAGCCGTTTGTCAATAGGGTTTGTGCGTTCATAGAGGTGTGATGTGGGCCTAGCATGCCTAATGCAGAGGAAAGTCCCACATTGCTATTTATGTAATTCAGTTGTTGTTGATATTCCTGCAGAACAGGCTTGTTGCT。

Claims

1. A dragon fruit U6 gene promoter, characterized in that: The promoter of the dragon fruit U6 gene is any one of proHuU6.1, proHuU6.1.2, and proHuU6.1.

3. The DNA nucleotide sequence of proHuU6.1 is shown in SEQ ID NO.4, the DNA nucleotide sequence of proHuU6.1.2 is shown in SEQ ID NO.5, and the DNA nucleotide sequence of proHuU6.1.3 is shown in SEQ ID NO.

6.

2. An expression box containing the promoter of claim 1.

3. A recombinant vector containing the promoter of claim 1 or the expression cassette of claim 2.

4. The recombinant vector according to claim 3, characterized in that: The recombinant vector is a recombinant expression vector or a recombinant cloning vector.

5. The recombinant vector according to claim 4, characterized in that: The backbone vector of the recombinant expression vector is the plant binary expression vector pCAMBIA1303, and the backbone vector of the recombinant cloning vector is pMD19-T.

6. A recombinant bacterium containing the promoter of claim 1, the expression cassette of claim 2, or the recombinant vector of claim 3.

7. The use of the dragon fruit U6 gene promoter according to claim 1 in any of the following: (1) Application in the construction of expression cassettes, recombinant vectors or recombinant bacteria; (2) Application in the construction of transgenic plants; (3) Application in initiating the expression of target genes in plants; The plant in question is either dragon fruit or Arabidopsis thaliana.

8. A method for expressing a target nucleic acid molecule in a plant, characterized in that: The method includes introducing a nucleic acid construct into a plant, the nucleic acid construct containing the promoter of claim 1 and a target nucleic acid molecule operatively linked to the promoter; the plant is dragon fruit or Arabidopsis thaliana.

Images