Application of transcription factor OSH45 in improvement of phosphorus nutrient absorption and low-nutrient stress tolerance
By cloning and utilizing the OSH45 gene, the problems of insufficient phosphorus absorption and low phosphorus adaptability in crops have been solved, achieving growth advantage and phosphorus nutrient accumulation in low phosphorus environments, and providing a new molecular breeding approach.
Patent Information
- Application Number
- CN202511105618.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-07
- Publication Date
- 2025-11-07
AI Technical Summary
Existing technologies have limitations in improving crop phosphorus uptake and adaptability to low phosphorus environments. Direct overexpression of positive regulators may lead to excessive phosphorus accumulation or abnormal growth, while negative regulators inhibit the plant's response to low phosphorus, and there are limited methods for improvement.
By cloning and utilizing the rice homeobox transcription factor OSH45 gene, the phosphorus uptake capacity of crops can be regulated by overexpression or knockout. OSH45 overexpression vectors and mutant vectors can be constructed to achieve gene editing to improve or reduce phosphorus uptake capacity.
OSH45 overexpression plants exhibited significant phosphorus uptake and growth advantages under low phosphorus conditions, regulated the balance of phosphorus and nitrogen, and enhanced the crop's growth adaptability and phosphorus accumulation under low phosphorus conditions.
Smart Images

Figure CN120905244A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of genetic engineering applied to plant molecular breeding and crop nutrition improvement. Specifically, the present application relates to a technology for improving the phosphorus utilization efficiency and tolerance to phosphorus starvation stress of crops, cloning a rice homeobox transcription factor OSH45 (Oryza sativa homeobox 45) gene through reverse genetics, identifying the function of the gene through overexpression technology and gene editing technology, and the application of the gene. BACKGROUND
[0002] Phosphorus (P) is one of the essential macronutrients for plant growth and development, and crops usually absorb and utilize inorganic phosphate (Pi) (Brinch-Pedersen et al., 2002). However, the effective phosphorus content in soil is usually low and has poor mobility, and about 30% of cultivated land has a phosphorus deficiency problem. The application of phosphorus fertilizer in farmland is the main means to improve yield, but due to the easy fixation of phosphorus fertilizer in soil, the actual utilization rate of plants is less than 25% (Johnston et al., 2014). Excessive fertilization not only increases the cost but also causes environmental problems, so it is urgent to cultivate crops with high phosphorus nutrient utilization efficiency through genetic improvement to reduce the dependence on phosphorus fertilizer from the source (Conley et al., 2009).
[0003] Previous studies have shown that rice has developed a complex phosphate starvation response mechanism to improve its adaptability to low-phosphorus environments. At the molecular level, OsPHR2 (Phosphate Starvation Response 2) is a core regulatory transcription factor for phosphate signaling in rice, which can activate the expression of a series of phosphate-deficient response genes by binding to the P1BS element in the promoter of downstream genes (Guo et al., 2015). However, the activity of OsPHR2 is negatively regulated by SPX domain proteins such as OsSPX1: when the intracellular phosphorus nutrients are sufficient, OsSPX1-OsSPX6 will bind to OsPHR2 to inhibit its transcriptional activity, thereby preventing the plant from excessive absorption of phosphorus. This feedback ensures the balance when phosphorus is excessive, but it may also limit the plant's full activation of absorption capacity under low phosphorus (Lv et al., 2014; Wang et al., 2014). In addition to the SPX-PHR module, other factors involved in phosphate deficiency response have been identified in rice, such as the bHLH transcription factor OsPTF1, which can enhance low-phosphorus tolerance; some WRKY transcription factors (such as OsWRKY21 / OsWRKY108) transcribe and activate the expression of the phosphate transport gene OsPT1 to promote phosphorus accumulation; in addition, the Pup1 locus (containing the protein kinase gene PSTOL1) found in natural variation can enhance root growth and improve low-phosphorus acquisition ability. These studies provide clues for improving crop phosphorus nutrition (Yi et al., 2005; Zhang et al., 2020; Chin et al., 2011). However, there are still deficiencies in the existing technology for low-phosphorus adaptation improvement: on the one hand, most of the known positive regulatory factors for phosphorus absorption (such as OsPHR2 / OsPT8) have strong functions, and direct overexpression may lead to excessive accumulation of phosphorus in plants, causing toxic symptoms or abnormal growth; on the other hand, negative regulatory factors (such as OsSPX proteins) inhibit the plant's response to low phosphorus, weakening the effect of improvement through a single pathway (Zhou et al., 2008; Jia et al., 2011). In addition, QTLs like Pup1 currently exist mainly in specific varieties, and their widespread use is limited. In summary, the plant low-phosphorus signal network is very complex, and the exploration of new key regulatory genes and mechanisms is still ongoing. It is urgent to discover and utilize new phosphorus nutrition response regulatory factors to make up for the deficiencies of existing technology and provide new strategies for cultivating crops that can efficiently utilize phosphorus.
[0004] The references involved in the present application are as follows:
[0005] BRINCH-PEDERSEN, H., L. D. & HOLM, P. B. 2002. Engineering crop plants: getting a handle on phosphate. Trends in Plant Science, 7, 118-125. (BRINCH-PEDERSEN, H., L. D. & HOLM, P. B. 2002. Engineering crop plants: getting a handle on phosphate. Trends in Plant Science, 7, 118-125. (BRINCH-PEDERSEN, H.,
[0006] CHIN, J. H., GAMUYAO, R., DALID, C, BUSTAMANTE, M., PRASETIYONO, J., MOELJOPAWIRO, S., WISSUWA, M. & HEUER, S. 2011. Developing rice with high yield under phosphorus deficiency: Pup1 sequence to application. Plant Physiology, 156, 1202-16. (CHIN, J. H., GAMUYAO, R., DALID, C. et al. (2011). Developing rice with high yield under phosphorus deficiency: Pup1 sequence to application. Plant Physiology, 156, 1202-16.
[0007] CONLEY, D. J., PAERL, H. W., HOWARTH, R. W., BOESCH, D. F., SEITZINGER, S. P., HAVENS, K. E., LANCELOT, C. & LIKENS, G. E. 2009. Controlling eutrophication: nitrogen and phosphorus. Ecology, 323, 1014-1015. (CONLEY, D. J., PAERL, H. W., HOWARTH, R. W. et al. (2009) Controlling eutrophication: nitrogen and phosphorus. Ecology, 323, 1014-1015).
[0008] GUO, M., RUAN, W., LI, C, HUANG, F., ZENG, M., LIU, Y., YU, Y., DING, X., WU, Y., WU, Z., MAO, C, YI, K., WU, P. & MO, X. 2015. Integrative comparison of the role of the PHOSPHATE RESPONSE 1 subfamily in phosphate signaling and homeostasis in rice. Plant Physiology, 168, 1762-1776.
[0009] JIA, H., REN, H., GU, M., ZHAO, J., SUN, S., ZHANG, X., CHEN, J., WU, P. & XU, G. 2011. The phosphate transporter gene OsPhtl ;8 is involved in phosphate homeostasis in rice. Plant Physiology, 156, 1164-1175.
[0010] JOHNSTON, A. E., POULTON, P. R., FIXEN, P. E. & CURTIN, D. 2014. Phosphorus: its efficient use in agriculture. Advances in Agronomy, 123, 177-228.
[0011] LV, Q., ZHONG, Y., WANG, Y., WANG, Z., ZHANG, L., SHI, J., WU, Z., LIU, Y., MAO, C, YI, K. & WU, P. 2014. SPX4 negatively regulates phosphate signaling and homeostasis through its interaction with PHR2 in rice. The Plant Cell, 26, 1586-1597.
[0012] WANG, Z., RUAN, W., SHI, J., ZHANG, L., XIANG, D., YANG, C, LI, C, WU, Z., LIU, Y., YU, Y., SHOU, H., MO, X., MAO, C & WU, P. 2014. Rice SPX1 and SPX2 inhibit phosphate starvation responses through interacting with PHR2 in a phosphate-dependent manner. Proceedings of the National Academy of Sciences of the United States of America, 111, 14953-14958.
[0013] YI, K., WU, Z., ZHOU, J., DU, L., GUO, L., WU, Y. & WU, P. 2005. OsPTF1, a novel transcription factor involved in tolerance to phosphate starvation in rice. Plant Physiology, 138, 2087-2096.
[0014] ZHANG, J., GU, M., LIANG, R., SHI, X., CHEN, L., HU, X., WANG, S., DAI, X., QU, H., LI, H. & XU, G. 2020. OsWRKY21 and OsWRKY108 function redundantly to promote phosphate accumulation through maintaining the constitutive expression of OsPHT1; 1 under phosphate-replete conditions. New Phytologist, 229, 1598-1614.
[0015] ZHOU, J., JIAO, F., WU, Z., LI, Y., WANG, X., HE, X., ZHONG, W. & WU, P. 2008. OsPHR2 is involved in phosphate-starvation signaling and excessive phosphate accumulation in shoots of plants. Plant Physiology, 146, 1673-1686.
[0016] The currently known gene HOS66 (Os03g0123500) is involved in the negative regulation of cell expansion and cell wall thickening, and plays an important role in the development of rice stems and grains. SUMMARY
[0017] The problem to be solved by the present application is to provide the use of the gene OSH45.
[0018] In order to solve the above technical problems, the present application provides a rice gene OSH45 with transcription regulation activity, and the nucleotide sequence thereof is shown in SEQ ID NO: 1.
[0019] The sequence is Sequence ID: NC_089042.1 in NCBI, https: / / rice.uga.edu / cgi-bin / sequence_display.cgi?orf=LOC_Os08g19650.1 (LOC_Os08g19650.1).
[0020] As an improvement of the gene of the present application: mutants, alleles and derivatives generated by adding, substituting, inserting and deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO: 1 are also included.
[0021] The present application also simultaneously provides a protein encoded by the gene OSH45, and the amino acid sequence thereof is shown in SEQ ID NO: 2.
[0022] As an improvement of the protein of the present application: derivatives generated by adding, substituting, inserting and deleting one or more amino acids in the amino acid sequence shown in SEQ ID NO: 2 are also included.
[0023] The present application also simultaneously provides the use of the above-mentioned gene in improving the phosphorus uptake of crops (improving the phosphorus nutrient uptake of crops).
[0024] As an improvement of the use of the present application: for breeding plants that are tolerant to phosphorus nutrient stress; for genetic improvement of crops to improve the phosphorus nutrient uptake.
[0025] As a further improvement of the use of the present application:
[0026] Overexpression of OSH45 gene positively regulates the phosphorus uptake capacity of crops (including rice) (i.e., the phosphorus uptake capacity of crops is enhanced, so that the crops can tolerate low-phosphorus environment);
[0027] Knockout of OSH45 gene negatively regulates the phosphorus uptake capacity of crops (including rice) (i.e., the phosphorus uptake capacity of the resulting crops is weakened).
[0028] As a further improvement of the use of the present application: using a plant expression vector containing the gene OSH45 to transform crops (including rice) to achieve genetic improvement of the phosphorus nutrient uptake of crops (including rice);
[0029] The plant expression vector containing the gene OSH45 includes Osh45 mutant vector and OSH45 overexpression vector.
[0030] Using the Osh45 mutant vector to obtain mutant crops (including rice) with weakened phosphorus uptake capacity;
[0031] The transgenic crops (including rice) obtained by using the OSH45 overexpression vector have enhanced phosphorus absorption capacity, and thus can tolerate low phosphorus environment. The OSH45 overexpression vector is pCAMBIA1300-35S::OSH45-GFP.
[0032] The application also simultaneously provides a method for regulating the phosphorus absorption capacity of crops (including rice): transforming a crop (including rice) with a gene OSH45 overexpression vector, and obtaining a transgenic crop (including rice) plant, so as to regulate the phosphorus absorption capacity of the crop (including rice).
[0033] Description: The OSH45 overexpression vector can exogenously express the OSH45 gene; the obtained transgenic rice plant has a significantly higher OSH45 gene expression level in vivo than the natural level, and thus has improved phosphorus absorption capacity and growth advantage in a low phosphorus environment.
[0034] The propagation material of the transgenic plant of the application includes seeds, seedlings, tissue cultures or any other propagation material of the plant that can grow into a complete plant, and the propagation material contains the stably heritable OSH45 exogenous gene.
[0035] The expression of OSH45 is induced by phosphorus deficiency. A plant expression vector containing the gene is used to transform rice for genetic improvement of rice. The phosphorus absorption capacity of the obtained transgenic rice is weakened by using an osh45 mutant. The phosphorus absorption capacity of the obtained transgenic rice is enhanced by using OSH45 overexpression material, so that the obtained low-phosphorus nutrient stress breeding material can tolerate a low phosphorus environment.
[0036] The application discloses that the expression of a gene OSH45 is induced by phosphorus deficiency, and application of the gene OSH45 in improving the phosphorus absorption of rice and low-phosphorus nutrient stress breeding. That is, the application provides a new molecular regulation approach aiming at the problems of low phosphorus utilization efficiency and limited improvement means. The technical problem to be solved by the application is application of OSH45 cloned from rice in improving the phosphorus absorption of plants and low-phosphorus nutrient stress breeding.
[0037] The application relates to improving the phosphorus absorption of rice by using the gene product, and the specific technical steps of the application are as follows:
[0038] (1) OSH45 is a phosphorus starvation response gene and is located in the nucleus
[0039] The present application first identifies and clones the rice gene OSH45 (Oryza sativa Homeobox 45). By gene expression analysis, it is found that OSH45 is significantly induced under phosphate starvation conditions: when seedlings are switched from normal nutrient solution to phosphate-free culture for 7 days, the root OSH45 transcription level is greatly elevated. RT-qPCR further confirms that the expression of OSH45 in the root is significantly up-regulated under phosphate deficiency treatment compared with normal conditions, indicating that OSH45 is a typical phosphate deficiency-responsive gene. In addition, the expression of OSH45 is detected in different tissues of seedlings, with relatively high expression in leaves, followed by roots, stem base and leaf sheath. This spatial expression pattern indicates that OSH45 may coordinate multiple tissue physiological processes related to phosphate nutrition.
[0040] The present application constructs a 35S::OSH45-GFP fusion expression vector, which fuses green fluorescent protein GFP to the C-terminus of OSH45. In tobacco leaf cell transient expression and the obtained stable genetic transformation plants of rice, the GFP fluorescence signal is mainly distributed in the nucleus, and no obvious free signal is observed in the cytoplasm, indicating that OSH45 protein is localized in the nucleus. This result indicates that OSH45 functions as a transcription factor.
[0041] (2) OSH45 affects the growth and development of rice
[0042] The present application evaluates the effect of OSH45 gene on plant phosphate adaptability through hydroponic experiment system. In a temperature-controlled greenhouse, 7-day-old wild type, osh45 mutant and OSH45-OE transgenic lines are transferred to nutrient solution with different phosphorus levels for 14 days, and their growth conditions are compared (phosphorus treatment scheme is described in detail in the specific embodiments below). The results show that under normal sufficient phosphorus supply (200 μM Pi, high phosphorus, HP), the growth phenotypes of plants of different genotypes are not significantly different; the plant height and biomass of osh45 mutant are comparable to those of wild type, and OSH45 overexpression plants also do not show significant growth advantage. However, under low phosphorus stress conditions (10 μM Pi, LP), the difference between different genotypes is obvious: OSH45 overexpression plants grow significantly better than wild type, with higher plant height, and the measured aboveground dry weight is about 20% higher than that of the control (as a contrast, OSH45 knockout mutant grows slightly limited under low phosphorus, with average plant height and biomass slightly lower than those of wild type but the difference is not significant). This indicates that overexpression of OSH45 can enhance the low-phosphorus-tolerant growth ability of rice, and deletion of OSH45 may slightly weaken the ability of the plant to adapt to low phosphorus.
[0043] (3) OSH45 affects the phosphate nutrition homeostasis of rice
[0044] Further in vivo nutrient measurement results show that OSH45 mainly affects the plant's absorption and accumulation of phosphorus, without disturbing the balance of other elements. In the growth comparison test, the nutrient content of 21-day-old plants was analyzed, and it was found that under normal nutritional conditions, the inorganic phosphorus (Pi) concentration in the leaves of the osh45 mutant was slightly lower than that of the wild type (decreased by about 10%), suggesting that the absence of OSH45 would lead to a decrease in the plant's phosphorus absorption capacity; the Pi concentration in the leaves of the OSH45 overexpression line was about 80-90% higher than that of the wild type, showing obvious phosphorus enrichment characteristics. The total phosphorus content measured at the same time also showed that the overexpression line was higher than the wild type. Notably, there was no significant difference in the content of other essential mineral elements such as potassium (K), iron (Fe), manganese (Mn), and copper (Cu) between plants of different genotypes, proving that OSH45 specifically promotes the absorption and accumulation of phosphorus elements in plants, without causing unbalanced absorption of other nutrients. The above results confirm, at the physiological level, that overexpression of the OSH45 gene can improve the phosphorus nutrition level of rice, which has a positive effect on the survival of plants in low-phosphorus environments.
[0045] (4) OSH45 regulates the phosphorus signal network
[0046] The present application performs transcriptome sequencing and key gene expression analysis on transgenic materials. By comparing the whole gene expression profiles of OSH45 overexpression plants (OSH45-OE) and wild type under different phosphorus supply conditions, it is found that OSH45 overexpression causes large-scale transcriptional reprogramming. Under normal phosphorus conditions (HP), there are 2406 genes differentially expressed between OSH45-OE and WT (threshold Fold Change≥2, P<0.05), about 60% of which are up-regulated genes; under phosphorus stress conditions (-P), the number of differential genes is 1439. Further comparison finds that there are 708 typical "phosphorus starvation-induced genes" (PSI genes) that remain up-regulated in OSH45-OE plants under high phosphorus conditions, accounting for about 38% of the total number of known PSI genes; at the same time, 366 "phosphorus starvation-suppressed genes" (PSS genes) are down-regulated in OSH45-OE plants, accounting for about 25% of the known PSS genes. In other words, OSH45 overexpression plants have pre-activated part of the phosphorus deficiency response pathway under normal conditions: a large number of genes that are normally activated only when the plant is deficient in phosphorus are continuously highly expressed in OSH45-OE. This transcriptional pattern reduces the sensitivity of OSH45-OE plants to changes in environmental phosphorus levels: compared with the wild type, the number of genes that need to be adjusted when OSH45-OE encounters phosphorus deficiency is greatly reduced, indicating that OSH45-OE plants are in a state similar to "phosphorus deficiency pre-adaptation". These results reveal that OSH45 improves the adaptability of plants to low phosphorus stress by widely regulating the transcriptional network.
[0047] (5) OSH45 regulates the expression of rice phosphate-starvation responsive genes
[0048] NIP wild type, osh45 mutant and OSH45 overexpression (OE) materials grown in nutrient sufficient solution for 7 days were transferred to HP and -P solution for another 7 days. Root RNA was extracted for RT-qPCR analysis. In OSH45 overexpression plants, multiple phosphate acquisition and utilization related genes were significantly upregulated. In particular, multiple members of the high-affinity phosphate transporter family were upregulated, such as root uptake phosphorus OsPT1, OsPT2, OsPT4, OsPT8, the expression of which in OSH45-OE plants was much higher than in wild type, while the expression of OsPT1 and OsPT8 in osh45 knockout mutants was lower than in wild type. This indicates that OSH45 positively regulates these phosphate transporter genes, promoting the absorption of phosphorus from the external medium and its transport to the aboveground part. At the same time, some enzyme genes that help internal phosphorus recycling, such as acid phosphatase, were also upregulated to varying degrees in OSH45-OE (transcriptome data showed that acid phosphatase genes were generally upregulated), which is conducive to the plant's acquisition of phosphorus from organic phosphorus sources. On the other hand, OSH45 overexpression led to the suppression of negative regulator genes: important inhibitors in the phosphate starvation stress signaling pathway, OsSPX1, OsSPX2 and OsSPX3, were significantly downregulated in OSH45-OE plants. This indicates that OSH45 can reduce the SPX-mediated negative feedback by downregulating the expression of SPX genes, which is equivalent to indirectly enhancing the role of OsPHR2 and other phosphate-starvation core regulatory factors. This mechanism explains why the expression level of phosphate transporters is upregulated and the absorption of phosphorus is significantly increased in OSH45 overexpression plants, enabling the plant to maximize the activation of absorption and adaptation mechanisms under low phosphorus stress.
[0049] In addition to its effect on phosphorus nutrition, the role of OSH45 also involves the coordination of internal nutrient balance in rice. The results of the present invention show that OSH45 overexpression not only enhances phosphorus absorption capacity, but also suppresses the expression of some nitrogen metabolism related genes: such as OsNRT2.1 encoding high-affinity nitrate transporter and OsNIA1 encoding nitrate reductase, which are significantly downregulated in OSH45-OE plants. It is known that when plants are deficient in phosphorus, their nitrate nitrogen absorption and assimilation often decreases to maintain the balance of nitrogen and phosphorus in the body, which is an adaptive strategy. The results of the present invention show that OSH45 may be involved in the cross-regulation between nitrogen and phosphorus nutrients, by reducing the plant's uptake / assimilation of nitrogen to adapt to the balanced demand under low phosphorus supply conditions. Therefore, OSH45 is believed to play a "overall coordination" role in maintaining the N:P element balance of the plant and integrating nutrient signals. This characteristic means that by regulating OSH45, not only can phosphorus absorption be improved, but also nitrogen waste caused by increased phosphorus can be avoided, thereby optimizing nutrient utilization.
[0050] The genes known at present with the function of improving plant phosphorus absorption and phosphorus nutrient stress breeding (such as OsPHR2, OsPTF1, PSTOL1, etc.) are different from the OSH45 gene of the present application in that: OSH45 is the first Homeobox family transcription factor confirmed to be involved in plant phosphorus starvation response, which activates the expression of phosphorus transporter genes (such as OsPT1 / 2 / 4 / 8) through a triple synergistic mechanism; inhibits the expression of phosphorus signal negative feedback factors (OsSPX1 / 2 / 3), and removes the inhibition of the SPX-PHR module on the phosphorus absorption pathway; and down-regulates the nitrogen absorption / synthesis genes (such as OsNRT2.1 / OsNIA1), to actively maintain the balance of nitrogen and phosphorus elements in the plant body.
[0051] In summary, the present application discloses that OSH45, as a new key transcription factor, plays a central role in the low-phosphorus adaptability regulation of rice: it can be induced under phosphorus deficiency, and after entering the nucleus, it regulates the expression of a series of downstream genes, up-regulates the phosphorus absorption and utilization pathway, and inhibits the negative regulation feedback, thereby enhancing the physiological response of the plant to low-phosphorus stress from multiple aspects. By genetically manipulating the activity of the OSH45 gene, the growth adaptability and phosphorus nutrient accumulation of rice in a low-phosphorus environment can be significantly improved. The technical scheme provides a new molecular breeding idea, and OSH45 can be used as a key target gene for breeding to cultivate new rice varieties with high efficiency of phosphorus fertilizer utilization and stronger adaptability to phosphorus-poor soil, which has important significance for the sustainable development of agriculture. BRIEF DESCRIPTION OF DRAWINGS
[0052] Figure 1 The expression pattern and subcellular localization of OSH45 gene;
[0053] Figure 1 In the present application, OSH45 is a key transcription factor involved in the regulation of plant phosphorus starvation response, and it is the first Homeobox family transcription factor confirmed to be involved in plant phosphorus starvation response.
[0054] A: Expression of OSH45 gene in wild-type rice seedlings under different phosphorus treatments; after 7-day-old seedlings were treated with normal phosphorus supply (200 μM Pi, CK) and phosphorus deficiency (0 μM Pi, -P) for 7 days, the transcription level of OSH45 was detected by qPCR. The numerical value is represented by mean ± error value SD (the samples for statistics are derived from 3 independent biological repeats); the results show that the expression of OSH45 is significantly up-regulated under phosphorus deficiency (the “-P” group in the column chart is relative to the “CK” group);
[0055] B: Relative expression of OSH45 in different tissues of rice seedlings. The expression level of OSH45 in root, stem base (base of the stem sheath), leaf sheath and leaf were determined by qPCR under normal phosphorus supply condition. Error bars represent SD (n=3) (Different lower case letters indicate significant difference between groups, ANOVA followed by Tukey's test, P<0.05);
[0056] C: Subcellular localization of OSH45 protein. The upper panel shows the GFP fluorescence signal detected after transient expression of 35S::OSH45-GFP fusion protein in the epidermal cells of N. benthamiana leaves. The lower panel shows the GFP fluorescence in the root tip cells of rice transgenic seedlings transformed with 35S::OSH45-GFP. Green fluorescence mainly appears in the nuclear region, indicating that OSH45 protein is localized in the nucleus (scale bar = 50 μm in the figure);
[0057] Figure 2 Construction of OSH45 transgenic lines and phenotype comparison;
[0058] Figure 2 In the middle:
[0059] A: Gene expression identification of OSH45 overexpression transgenic lines (OSH45-OE1 and OSH45-OE2). The expression level of OSH45 in 7-day-old seedlings was detected by qPCR. The results showed that the transcription level of OSH45 in transgenic lines was significantly higher than that in wild type, indicating that the foreign gene was successfully and efficiently expressed;
[0060] B: Schematic diagram of target sequence and mutation of osh45-1 and osh45-2 knockout mutants constructed by CRISPR / Cas9. The sequences of the two targeted sites on the OSH45 gene are labeled. The sequencing results of the mutants show that base deletion / insertion has occurred, resulting in a frameshift, thereby knocking out the function of OSH45;
[0061] C: Comparison of growth phenotypes of 21-day-old wild type (rice variety Nipponbare NIP), osh45 knockout mutant and OSH45 overexpression transgenic plants under different phosphorus supply conditions. The left side is the plant after 14 days of high phosphorus (HP) nutrient solution culture, and the right side is the plant after 14 days of low phosphorus (LP) nutrient solution culture. It can be seen directly that under low phosphorus conditions, the growth of OSH45 overexpression plants is obviously better than that of wild type, while osh45 mutants are slightly shorter. Scale = 5 cm;
[0062] D: Comparison of plant height of different genotypes. The plants were grown in high phosphorus (HP) and low phosphorus (LP) nutrient solution for 14 days, and the plant height was measured. The results showed that the plant height of OSH45 overexpression plants was significantly higher than that of wild type under low phosphorus conditions, while the plant height of osh45 mutants was significantly lower than that of wild type under low phosphorus conditions. The error bars represent SD (n=3) (Different lower case letters indicate significant difference between groups, ANOVA followed by Tukey's test, P<0.05); Figure 2Figure 1 shows the plant height of the plants treated as shown in C, the height of the above-ground part was measured, and the results were plotted in a histogram under high phosphorus (HP) and low phosphorus (LP) conditions; the results show that under LP conditions, the plant height of the OSH45-OE plants was significantly higher than that of the wild type (the "*" in the histogram indicates a significant difference compared with NIP, P < 0.05), and the osh45 mutant was slightly lower than the control;
[0063] Figure 1 shows the plant height of the plants treated as shown in C, the height of the above-ground part was measured, and the results were plotted in a histogram under high phosphorus (HP) and low phosphorus (LP) conditions; the results show that under LP conditions, the plant height of the OSH45-OE plants was significantly higher than that of the wild type (the "*" in the histogram indicates a significant difference compared with NIP, P < 0.05), and the osh45 mutant was slightly lower than the control; Figure 2 Figure 1 shows the plant height of the plants treated as shown in C, the height of the above-ground part was measured, and the results were plotted in a histogram under high phosphorus (HP) and low phosphorus (LP) conditions; the results show that under LP conditions, the plant height of the OSH45-OE plants was significantly higher than that of the wild type (the "*" in the histogram indicates a significant difference compared with NIP, P < 0.05), and the osh45 mutant was slightly lower than the control;
[0064] Figure 3 Figure 1 shows the plant height of the plants treated as shown in C, the height of the above-ground part was measured, and the results were plotted in a histogram under high phosphorus (HP) and low phosphorus (LP) conditions; the results show that under LP conditions, the plant height of the OSH45-OE plants was significantly higher than that of the wild type (the "*" in the histogram indicates a significant difference compared with NIP, P < 0.05), and the osh45 mutant was slightly lower than the control;
[0065] Figure 3 Figure 1 shows the plant height of the plants treated as shown in C, the height of the above-ground part was measured, and the results were plotted in a histogram under high phosphorus (HP) and low phosphorus (LP) conditions; the results show that under LP conditions, the plant height of the OSH45-OE plants was significantly higher than that of the wild type (the "*" in the histogram indicates a significant difference compared with NIP, P < 0.05), and the osh45 mutant was slightly lower than the control;
[0066] Figure 1 shows the plant height of the plants treated as shown in C, the height of the above-ground part was measured, and the results were plotted in a histogram under high phosphorus (HP) and low phosphorus (LP) conditions; the results show that under LP conditions, the plant height of the OSH45-OE plants was significantly higher than that of the wild type (the "*" in the histogram indicates a significant difference compared with NIP, P < 0.05), and the osh45 mutant was slightly lower than the control;
[0067] Figure 1 shows the plant height of the plants treated as shown in C, the height of the above-ground part was measured, and the results were plotted in a histogram under high phosphorus (HP) and low phosphorus (LP) conditions; the results show that under LP conditions, the plant height of the OSH45-OE plants was significantly higher than that of the wild type (the "*" in the histogram indicates a significant difference compared with NIP, P < 0.05), and the osh45 mutant was slightly lower than the control;
[0068] Figure 1 shows the plant height of the plants treated as shown in C, the height of the above-ground part was measured, and the results were plotted in a histogram under high phosphorus (HP) and low phosphorus (LP) conditions; the results show that under LP conditions, the plant height of the OSH45-OE plants was significantly higher than that of the wild type (the "*" in the histogram indicates a significant difference compared with NIP, P < 0.05), and the osh45 mutant was slightly lower than the control;
[0069] C: potassium (K); D: iron (Fe); E: manganese (Mn); F: copper (Cu);
[0070] The results show that in the content of these elements, the osh45 mutant and the OSH45-OE plants have no significant difference from the wild type, indicating that the genetic improvement of OSH45 mainly affects the absorption of phosphorus elements, and does not cause abnormal absorption of other elements.
[0071] Figure 4 Figure 1 shows the plant height of the plants treated as shown in C, the height of the above-ground part was measured, and the results were plotted in a histogram under high phosphorus (HP) and low phosphorus (LP) conditions; the results show that under LP conditions, the plant height of the OSH45-OE plants was significantly higher than that of the wild type (the "*" in the histogram indicates a significant difference compared with NIP, P < 0.05), and the osh45 mutant was slightly lower than the control;
[0072] Figure 4 Figure 1 shows the plant height of the plants treated as shown in C, the height of the above-ground part was measured, and the results were plotted in a histogram under high phosphorus (HP) and low phosphorus (LP) conditions; the results show that under LP conditions, the plant height of the OSH45-OE plants was significantly higher than that of the wild type (the "*" in the histogram indicates a significant difference compared with NIP, P < 0.05), and the osh45 mutant was slightly lower than the control;
[0073] A: Effect of OSH45 overexpression on the global transcriptional response; left bar chart compares the number of differentially expressed genes in wild type under low P (-P) vs. high P (HP) treatment (1881 PSI genes up-regulated and 1489 PSS genes down-regulated, respectively); right bar chart is the number of differentially expressed genes in OSH45-OE plants under the same treatment comparison (283 up-regulated and 177 down-regulated); the number of transcriptionally changed genes in OSH45 overexpression plants under low P stress is much less than that in wild type, indicating that OSH45 reduces the sensitivity of the plants to the change of P supply;
[0074] B: Expression regulation profile of genes related to P-starvation response in OSH45 overexpression plants; Venn diagram shows the overlap of PSI gene set in wild type and the up-regulated gene set in OSH45-OE plants under normal P condition: about 38% of PSI genes are up-regulated in OSH45-OE; similarly, about 25% of PSS genes are down-regulated in OSH45-OE. This result directly indicates that OSH45 activates a part of genes that should be expressed under P deficiency, and suppresses a part of genes that should be down-regulated under P deficiency, thus making the plants in a "P-starvation response" state;
[0075] C: Clustered heat map of differentially expressed genes (PSR gene expression pattern); horizontal axis is samples under different treatments (wild type HP, wild type -P, OSH45-OE HP); color represents the expression level of genes (red high, blue low); the result shows that genes up-regulated in wild type under P deficiency are also highly expressed in OSH45-OE samples (corresponding to red area in the heat map); on the contrary, some genes down-regulated in wild type under P deficiency are also at low expression level in OSH45-OE; this further proves that OSH45 overexpression makes the plants similar to those experiencing P deficiency, thus improving the tolerance;
[0076] D: GO enrichment analysis of 706 PSI genes differentially up-regulated in OSH45-OE lines compared to wild type; the result shows that biological processes such as "phosphate ion transport", "protein phosphorylation" are significantly enriched;
[0077] E: GO enrichment analysis of 366 PSS genes differentially down-regulated in OSH45-OE lines compared to wild type. The result shows that biological processes such as "amino acid transport", "phloem development" are significantly enriched.
[0078] Figure 5 Analysis of changes in biological processes caused by OSH45 overexpression;
[0079] Figure 5 In summary:
[0080] A: Functional enrichment of specific differentially expressed genes in OSH45 overexpression lines; the differentially up-regulated genes in OSH45-OE plants under high phosphate conditions relative to wild type were classified using GO enrichment analysis method, and the significantly enriched functional categories were represented by bubble chart; the results showed that among the genes differentially up-regulated in OSH45-OE compared with wild type, biological processes such as "phosphate ion transport" and "plant defense response" were significantly enriched; this indicates that the role of OSH45 activates the pathways related to phosphate uptake and homeostasis;
[0081] B: Cluster heat map of phosphate signal and phosphate transport related differentially expressed genes; the horizontal axis represents samples under different treatments (wild type HP, OSH45-OE HP); the color represents the expression level of the gene (red high, blue low); the results show that phosphate transporter related genes are differentially up-regulated in OSH45-OE samples compared with wild type; on the contrary, the expression of SPX genes is inhibited in OSH45-OE. This further proves that OSH45 overexpression promotes phosphate uptake.
[0082] Figure 6 To verify the regulatory effect of OSH45 on the expression of key phosphate nutrition related genes;
[0083] Figure 6 In the middle:
[0084] A-D: Expression levels of phosphate transporter genes OsPT1, OsPT2, OsPT4, and OsPT8 in OSH45 overexpression plants, osh45 mutants, and wild type (WT) (qPCR results); the results show that under high phosphate conditions, the transcription levels of OsPT1 / 2 / 4 / 8 in OSH45-OE plants are higher than those in WT, while in osh45 loss-of-function lines, the expression of some transporter genes is lower than that in WT (such as OsPT1 and OsPT8, which are significantly down-regulated); the asterisk indicates significant difference compared with WT (*P<0.05, **P<0.01);
[0085] E-G: Expression of genes encoding phosphate signal negative regulatory proteins OsSPX1, OsSPX2, and OsSPX3 in OSH45-OE, osh45 mutant, and WT plants (qPCR); this indicates that OSH45 has an inhibitory effect on SPX, thereby relieving its negative feedback on phosphate deficiency signal;
[0086] H: Expression of nitrogen metabolism related genes in OSH45 overexpression lines; the transcription level of high affinity nitrate transporter OsNRT2.1 in OSH45-OE plants compared with wild type; the results show that these genes are down-regulated in OSH45-OE, supporting the negative regulatory effect of OSH45 on nitrogen uptake. DETAILED DESCRIPTION
[0087] The present application will be further described in conjunction with specific examples, but the present application is not limited to the following examples.
[0088] Example 1: Isolation and cloning of OSH45 gene
[0089] The OSH45 gene involved in the present application is derived from the japonica rice variety Nipponbare (Oryza sativa L. cv. Nipponbare). First, the nucleic acid sequence information of OSH45 gene was obtained by searching the rice genome database (RAP-DB database number Os08g0292900, corresponding to MSU annotated gene LOC_Os08g19650). The gene contains 6 exons, encoding a transcription factor protein containing a homeobox domain. In order to clone the coding sequence of OSH45, rice seedling root tissue was selected, and total RNA was extracted using Trizol method. After removing genomic DNA by DNase I treatment, mRNA was reverse transcribed into cDNA using a reverse transcription kit. According to the known sequence of OSH45 open reading frame (ORF), specific primers were designed:
[0090] OSH45-F: ATGGGCGGCGGCGGCGAGGCGGA;
[0091] OSH45-R: CTACGAATTGTTATCACCTGCATTACT;
[0092] The full-length ORF of OSH45 (837 bp long) was amplified by high-fidelity PCR using cDNA as template. After purification, the PCR product was cloned into T vector for sequencing, and the results verified that the obtained sequence was completely consistent with the published OSH45 sequence (SEQ ID NO: 1). Thus, the coding sequence cloning of rice OSH45 gene was successfully obtained.
[0093] Example 2: OSH45 is a phosphate starvation response gene
[0094] In order to clarify that OSH45 is a phosphate starvation response gene, gene expression analysis under different culture conditions was carried out. Rice seedlings grown under normal phosphate conditions (HP; 200 μM KH2PO4) for 7 days were transferred into normal phosphate conditions and phosphate starvation (-P; 0 μM KH2PO4) conditions for 7 days, respectively. The rice hydroponic method: hydroponic culture was carried out in a phytotron, and the nutrient solution was replaced every 3 days. The solution formula is shown in Table 1 below.
[0095] Table 1, rice nutrient solution formula
[0096]
[0097]
[0098] The culture conditions are as follows: light time, 7:00-18:00; light intensity, 250-300 μmol m -2 s -1 ; temperature control, 28-30 °C during the day and 20-22 °C at night; relative humidity, 50%-60%; pH value, approximately 5.6 (adjust the pH of the nutrient solution with 2M HC1). When the phosphorus is reduced, the reduced KH2PO4 is replaced with an equimolar amount of KCl.
[0099] After the RNA is extracted, cDNA is obtained by reverse transcription. Quantitative detection finds that the expression of OSH45 is induced by phosphorus deficiency in the roots, and the specific process is as follows:
[0100] (1) Extract total RNA of rice using Invitrogen TRIzol reagent
[0101] 1) Collect rice root tissue samples, grind them uniformly with liquid nitrogen, and transfer 200-500 mg of the samples to a 1.5 mL centrifuge tube.
[0102] 2) Add 500 μL of Trizol (Invitrogen) to the centrifuge tube, immediately vortex to mix, and stand on ice for 10 min.
[0103] 3) Add 100 μL of CHCl3 to the centrifuge tube, vortex to mix, and stand for 10 min.
[0104] 4) Centrifuge at 12,000 rpm at 4 °C for 15 min, carefully remove the supernatant, avoid touching the lower liquid and the precipitate, and transfer to a new 1.5 mL centrifuge tube.
[0105] 5) Add an equal volume of isopropanol, 200 μL, mix by shaking, and stand on ice for 10-15 min.
[0106] 6) Centrifuge at 12,000 rpm at 4 °C for 10 min, discard the supernatant, use 500 μL of 70% ethanol (prepared with DEPC water) to blow up the precipitate, centrifuge at 12,000 rpm for 3 min, and discard the supernatant. Repeat the blowing of the precipitate with 70% ethanol, and finally remove as much liquid as possible from the centrifuge tube.
[0107] 7) Blow dry the precipitate to transparency in the clean bench with the maximum wind speed, add 50 μL of DEPC water, stand at 4 °C for 10 min until the RNA is completely dissolved in water.
[0108] 8) Detect the RNA concentration and quality using the Nano Drop (ND-2000) instrument, immediately perform the reverse transcription experiment, or store at -80 °C.
[0109] (2) Reverse transcription experiment
[0110] PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time) (Cat No. RR047A) from Takara. The detailed procedure is as follows: TM RT reagent Kit with gDNA Eraser (Perfect Real Time) (Cat No. RR047A) from Takara. The detailed procedure is as follows:
[0111] 1) Remove genomic DNA: The reaction system is as follows. The RNA concentration of each sample was determined using a Nanodrop 2000 ultramicro spectrophotometer, and the RNA (1 μg) of each sample was mixed with RNase-Free dH2O. The gDNA Eraser enzyme and buffer were then aliquoted into each sample tube, gently mixed, and then placed in a PCR instrument for 5 min at 42°C. Immediately after the reaction was completed, the sample was removed and placed on ice.
[0112] Reaction system for removing genomic DNA
[0113]
[0114] 2) Reverse transcription reaction: The reaction system is as follows. Four reagents were prepared into a Master Mix, and then 10 μL was aliquoted into each sample tube from step 1). After gentle mixing, the reaction was immediately performed at 37°C for 15 min (reverse transcription reaction), 85°C for 5 s (inactivate reverse transcriptase), and 4°C for 2 min. qPCR experiments were performed or stored at -20°C for long-term storage.
[0115] Reverse transcription reaction system
[0116]
[0117] (3) RT-qPCR experiments
[0118] qPCR experiments were performed using Roche 480 SYBR Green I Master, and the real-time fluorescence quantitative PCR instrument was Roche 480 II. The reaction system is as follows:
[0119] RT-qPCR reaction system
[0120]
[0121] Mix the above reaction system, pipette the sample into a 384-well quantitative plate, cover the sealing film, and perform PCR reaction. The program is set as follows:
[0122]
[0123] The primer information for quantitative expression analysis in the RT-qPCR experiment is as follows. The internal reference gene for quantification is OsACTIN (Os03g0718100). The method is used to analyze the relative expression levels of genes.
[0124] ACTIN-qRT-F: CAACACCCTCTGCTATGTAC
[0125] ACTIN-qRT-R: CATCACCAGAGTCCAACACAA
[0126] OSH45-qRT-F:GGTGTAGGGACTTGCCGTTA
[0127] OSH45-qRT-R:TTTTCTTTTGCACCCCAATG
[0128] The results showed that OSH45 expression levels were significantly induced under phosphorus starvation conditions. Figure 1 OSH45 is expressed in all tissues of rice: its expression level is higher in leaves than in roots, leaf sheaths, and stem base. Figure 1 (B).
[0129] The expression of OSH45 in rice root tissue after 7 days of treatment under normal phosphorus conditions (with OsACTIN as an internal reference) was 1. The relative expression of OSH45 in rice root tissue after 7 days of treatment under phosphorus starvation (-P; 0 μM KH2PO4) conditions was 1.5. The expression level of OSH45 in roots was significantly upregulated under phosphorus deficiency treatment compared to normal conditions (P<0.01). Figure 1 (A). Therefore, we can conclude that OSH45 is a typical phosphorus deficiency response gene.
[0130] Example 3: Construction of OSH45 overexpression vector
[0131] To achieve overexpression and subcellular localization tracking of the OSH45 gene in plants, this embodiment constructs a 35S promoter-driven OSH45-GFP fusion expression vector. The specific steps are as follows: Using cDNA from the root tissue of Nipponbare as a template, the CDS sequence of OSH45 (with the stop codon removed) was amplified using KOD-FX (TOYOBO). The PCR reaction system is as follows:
[0132] PCR reaction system
[0133]
[0134]
[0135] Amplification procedure: pre-denaturation, 95°C, 5 min; denaturation, 95°C, 10 s; annealing, 58°C, 10 s; extension, 68°C, 1 min / kb, 30 cycles of amplification; 68°C post-extension for 5 min. The PCR product was electrophoresed on a 1% agarose gel, and then the target band was recovered using a gel recovery kit (TIANGEN, DP219) according to the instructions. The linearized pCAMBIA1300-eGFP vector was digested with BamHI and XbalI, and then the target fragment was ligated into the vector using a seamless cloning kit (Vazyme, item number: C112-02). The resulting recombinant expression vector was named pCAMBIA1300-35S::OSH45-GFP, i.e., an OSH45 overexpression vector. Plasmid digestion and sequencing showed that the OSH45-GFP fusion gene sequence was correct (i.e., consistent with SEQ ID NO: 1), the reading frame was correct, and it was consistent with the expected design. The resulting OSH45 overexpression vector was named, which was amplified and purified in E. coli and used in subsequent genetic transformation experiments. The primers used to construct the vector are as follows:
[0136] OSH45-GFP-inF: GAGCTCGGTACCCGGGGATCCATGGGCGGCGGCGGCGAGGCGGA OSH45-GFP-inR: GCTCACCATGTCGACTCTAGACGAATTGTTATCACCTGCATTACT.
[0137] Example 4: Construction of an osh45 mutant vector
[0138] To clarify the function of OSH45 in regulating phosphorus uptake and utilization, an osh45 mutant vector was constructed using the CRISPR / Cas9 system. The specific method is as follows:
[0139] (1) Design target sites: find sequences in which the 20th base upstream of NGG in the ORF sequence region of the OSH45 gene is G or A (A and G are the transcription start bases of U3 and U6 promoters, respectively), and preferentially select them as target sequences; in order to improve the mutation efficiency, two target sites (sequences are T1: AGAAGCGAGCGATCCCTAA TGG ; T2: TGGAAGCAGTAATGGCATGC TGG ) were designed in the functional domain of the OSH45 gene (sequence 1). Blast alignment was performed in the rice genome sequence to check the specificity of the target site sequence in the rice genome.
[0140] (2) Synthesis of target site linker primers:
[0141]
[0142] Dissolve the synthetic linker primer to 10 μM stock solution, take 10 μL of each OSH45-U3-F and OSH45-U3-R linker primer stock solution and mix with 80 μL of ddH2O to make target linker T1, take 10 μL of each OSH45-U6a-F and OSH45-U6a-R linker primer stock solution and mix with 80 μL of ddH2O to make target linker T2, dilute the linkers to a concentration of 1 μM. After denaturation at 95 °C for 1 min, cool to room temperature to complete annealing.
[0143] (3) Enzymatic digestion of gRNA vector: Take 1 μg of the target plasmid (pYLgRNA-OsU3 or pYLgRNA-OsU6a), add 10 U of EcoR31 I (Thermo Scientific), 2.5 μL of 10x CutSmart Buffer, and make up to 25 μL of reaction system with nuclease-free water, and incubate at room temperature for 20 min, then deactivate the enzyme at 70 °C for 5 min, and store at -20 °C for later use.
[0144] (4) gRNA expression cassette ligation reaction: Ligate the annealed target linkers obtained in step (2) with the corresponding OsU3-gRNA or OsU6a-gRNA vector (i.e., PYLgRNA-OsU#vector) obtained in step (3), and the reaction system is as follows, ligate at room temperature (20-28 °C) for 10-15 min.
[0145] gRNA expression cassette ligation reaction system
[0146]
[0147] (5) Amplification of gRNA expression cassette: First round of amplification: Take 1 μL of the ligation product obtained in step (4) as the PCR reaction template, use U-F and gRNA-R as linker primers at 0.2 μM each, and use KOD-FX (TOYOBO) high-fidelity polymerase for the first round of amplification, with the following amplification program: 95 °C for 2 min; 95 °C for 10 s, 60 °C for 15 s, 68 °C for 20 s, 25 cycles; finally 68 °C for 5 min. Take 4 μL for electrophoresis. Second round of amplification: Take 1 μL of the first round of PCR reaction product, dilute 10-fold with ddH2O, and take 1 μL as the PCR reaction template, use the specific primers B1’+B2 for T1-U3 and B2’+BL for T2-U6a to amplify, and perform the second round of PCR reaction, with the following amplification program: 95 °C for 2 min; 95 °C for 10 s, 58 °C for 15 s, 68 °C for 20 s, 15 cycles; finally 68 °C for 5 min. Check the size of the PCR product by electrophoresis, and recover the PCR product by gel cutting. Primers are as follows:
[0148] U-F: CTCCGTTTTACCTGTGGAATCG
[0149] gRNA-R: CGGAGGAAAATTCCATCCAC
[0150] B1': TTCAGAggtctcTctcgACTAGTGGAATCGGCAGCAAAGG
[0151] B2: AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC
[0152] B2': TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG
[0153] BL: AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC
[0154] (6) Connecting gRNA expression cassette with pYLCRISPR / Cas9-MH plasmid: using cutting and connecting method, the PCR product recovered from the gel in step (5) was connected with pYLCRISPR / Cas9-MH plasmid, and the enzyme cutting system was as follows: after mixing the reaction system, it was incubated at 37°C for 10 min, then 0.5 μL 10×NEB T4 DNA ligase buffer and ~35U T4 DNA ligase were added for variable temperature cycle enzyme cutting and connection. The reaction process was: 37°C for 2 min, 10°C for 3 min, 20°C for 5 min, 15 cycles; finally 37°C for 2 min.
[0155] pYLCRISPR / Cas9-MH vector connection reaction system
[0156]
[0157] (7) The connection product in step (6) was transformed into E. coli DH5α using chemical heat shock method, and positive clones were selected by bacterial liquid PCR (targeted gRNA expression cassette and vector connection without sequence mutation by one generation sequencing, which belonged to positive clones). The obtained was named as osh45 mutant vector, which was amplified and purified in E. coli and used for subsequent genetic transformation experiments.
[0158] Example 5: Rice transgene
[0159] (1) Agrobacterium-mediated rice genetic transformation method was used to introduce the OSH45 overexpression vector obtained in Example 3 and the osh45 mutant vector obtained in Example 4 into the rice genome. Agrobacterium strain EHA105 was used as a mediated vector in this embodiment. The EHA105 competent cells stored at -80°C were placed on ice and allowed to thaw naturally. Then 200 ng of the plasmid to be transformed was added in a clean bench, mixed slowly with a pipette gun, and placed on ice for 20 min. It was quickly frozen in liquid nitrogen for 2 min, immediately taken out and placed in a 37°C metal bath for heat shock for 5 min. 500 μL of antibiotic-free LB liquid medium was added, and the culture was incubated at 28°C, 180 rpm, and slowly shaken for 3 h. 200 μL of bacterial solution was spread on YEP solid medium containing double antibiotics, and incubated at 28°C for 36-48 h. Single colonies growing on the medium were picked and inoculated into YEP liquid medium containing antibiotics (streptomycin and kanamycin), and incubated at 28°C, 250 rpm for 5 h. The bacterial solution was detected by PCR, and positive clones were selected and transferred to 10 mL of YEP liquid medium containing corresponding antibiotics, and incubated at 28°C, 240 rpm for 12-16 h. The bacteria were preserved for future use.
[0160] (2) Rice genetic transformation
[0161] 1) Rice callus induction and differentiation
[0162] The wild type NIP mature seeds of rice were artificially shelled and placed in a 50 mL sterile centrifuge tube. 20 mL of 70% alcohol aqueous solution (prepared with sterile water) was poured in and mixed to disinfect for 2 min. The alcohol solution was slowly poured out, 30 mL of 30% sodium hypochlorite solution was added, and soaked for 30 min. The sodium hypochlorite solution was slowly poured out, and the seeds were washed with sterile distilled water for 4-6 times. Finally, 30 mL of sterile water was added and the seeds were slowly shaken on a shaker for 30 min. After pouring out the sterile water, the seeds were placed on sterile filter paper to remove the water, and then the seeds were placed on mature embryo induction medium, 15-30 seeds per dish. The culture dish was sealed with medical tape, and then transferred to a 28°C light incubator for culture for 3-4 weeks. The culture dish was opened in a clean bench, and the naturally divided light yellow and dense spherical embryogenic calli were picked up with tweezers and transferred to new subculture medium, and incubated in a 28°C incubator. The subculture was carried out for 1 week.
[0163] 2) Co-culture and selection of resistant calli
[0164] Select Agrobacterium monoclonal in 10 mL of YEP liquid medium containing streptomycin (50 mg / L) and kanamycin (50 mg / L), 28°C, 250 rpm shaking culture for 16 h or so, until OD600 is 0.8-1.0; 4,000 rpm room temperature centrifugation for 10 min to discard the supernatant. Use 30 mL of bacteria containing 200 μmol / L acetyl-syringone (As) to resuspend the bacteria, the final concentration of the bacteria is OD600 is 0.01. Infection of japonica rice: select 80-100 uniform rice callus, put into the corresponding Agrobacterium suspension, shake on a horizontal shaker for 5 min. Take out the callus, place on sterile paper, place for 30-40 min, remove the water. The callus is placed on the co-culture medium with a sterile filter paper, and then placed in a 25°C incubator after sealing with medical tape, dark culture for 3 days. Selection culture: take out the callus, wash with sterile water for 5-6 times, each time placed on a horizontal shaker, wash with sterile water containing 280 mg / L carbenicillin sodium (Carb) for 2 times, each time placed on a shaker for 30 min, finally the callus is placed on sterile paper to remove water; transfer the dried callus to the selection medium (containing 280 mg / L carbenicillin sodium and corresponding selection resistance), 28°C incubator, light culture for 14 days. The callus grown on the resistant medium is transferred to the same selection medium for the second round of screening, 28°C incubator, dark culture for two weeks.
[0165] 3) Induction of differentiation and rooting of resistant callus
[0166] Select 3-5 light yellow resistant callus from different calli, and move into a differentiation tank containing differentiation medium, and seal the bottle opening with sealing film. Place in a constant temperature incubator, 25°C, light culture (16 hours / day), and differentiate into seedlings after about 40 days. According to the experimental needs, when the seedlings grow to about 3 cm, cut off the old roots and callus from the base of the seedlings with scissors, and move to the rooting medium for seedling strengthening (about 1 week) (all steps need to be operated under sterile conditions).
[0167] 4) Transgenic material transplanting and identification
[0168] Transfer the transgenic seedlings to the greenhouse, open the lid of the differentiation tank, add an appropriate amount of sterile water, and place in the greenhouse for hardening for 2-3 days. Select 1-2 seedlings from each callus, wash off the root agar, and transplant to a small hole plate in the greenhouse for water culture and subsequent identification. After 1 week of culture under normal conditions, take 1 cm long leaves to extract genomic DNA, and use the resistance screening marker gene and variation of genomic sequence to identify the transgenic seedlings and screen successful transformation lines. The resistance screening marker gene primers are as follows:
[0169] HYG-F: CGAGTACTTCTACACAGCCATC
[0170] HYG-R: TAGCGAGAGCCTGACCTATT
[0171] The method for extracting the crude genomic DNA of rice is as follows: prepare 2 mL centrifuge tubes, add 200 μL of quick extraction solution (see the table below for the formula) and a zirconium oxide grinding bead with a diameter of 5 mm to each tube; cut 2-3 mm of tissue from the leaf tip into the centrifuge tube and label it; use a biological sample homogenizer Tissue Lyser II (QIAGEN) to grind the sample for 2 min at a vibration frequency of 20-22 times / min; stand in a 65 °C oven for half an hour, centrifuge at room temperature at 12000 g for 10 min, and the supernatant is the crude genomic DNA extraction sample of rice.
[0172] 10x quick extraction solution formula (1L)
[0173]
[0174] The expression level of the exogenous OSH45 gene in the T0 plants was detected by qPCR. Finally, a plurality of OSH45 overexpression rice plants with high expression level and stable traits were obtained and named as OSH45-OE1 and OSH45-OE2. The OSH45 expression levels of the two overexpression lines are shown in FIG. 1A. Figure 2
[0175] For screening of the osh45 mutant transgenic positive seedlings, the genomic DNA of wild type and transgenic seedlings was amplified by PCR using gene-specific primers and then sequenced. The sequencing results were subjected to sequence alignment, and those different from the wild type sequence were mutant materials. The information of the gene-specific primers is as follows:
[0176]
[0177] Two homozygous knockout mutants containing different frameshift mutations were obtained by sequencing verification and were named as osh45-1 (SEQ ID NO: 3) and osh45-2 (SEQ ID NO: 4), as shown in FIG. 1B. These transgenic plants all grew normally under greenhouse conditions and were subjected to subsequent steps. Figure 2
[0178] Note: The end of SEQ ID NO: 2-SEQ ID NO: 4 is terminated.
[0179] Example 6: Hydroponic low-phosphorus stress treatment and phenotype observation
[0180] To compare the growth performance of different genotypes under sufficient and deficient P conditions, we set up a hydroponic experiment to simulate P stress environment. The hydroponic solution was modified 1 / 2 Kimura standard solution (see Table 1 for solution formula in Example 2), and the pH was adjusted to 5.6. Two P levels were set: high P (HP, 200 μΜ KH2PO4) and low P (LP, 10 μΜ KH2PO4). The K+concentration in the solution was kept constant by replacing KH2PO4with an equimolar amount of KCl. The seeds of transgenic OSH45-OE lines, osh45 mutants and wild type NIP were germinated on the medium, and after 7 days of culture, the healthy seedlings with similar size were transferred to the above-mentioned solution for pre-culture. First, the seedlings were cultured under complete nutrition (HP) for 7 days to adapt to the hydroponic environment, and then the seedlings of different genotypes were transferred to the solution of HP or LP for further culture for 14 days. The fresh culture solution was replaced every 3 days during this period, and sufficient aeration of the solution was maintained. At the end of the treatment, the growth status of the plants in each treatment (C) was photographed, and the agronomic traits of the plants were measured, including plant height, leaf number, root length, etc. The results are as described in the foregoing summary: under LP treatment, the OSH45 overexpression plants grew better than the controls, while the osh45 mutants performed similarly or slightly worse than the wild type controls (C-D). Figure 2 Figure 2
[0181] Example 7: Determination of plant P content and other nutrient indicators
[0182] To quantify the effect of OSH45 on plant P nutrient uptake, we determined and analyzed the tissue P concentration of different plants in this example. The culture conditions were referred to Example 6, and plants of different genotypes were selected that had grown normally under high P (HP, 200 μΜ KH2PO4) conditions for 21 days. The aboveground (stem and leaf) tissues were taken, dried at 65°C to constant weight, and the samples were ground. Inorganic P (Pi) determination: 0.05 g of fresh leaf tissue was weighed, and Pi was extracted with 0.5 M H2SO4solution, and the supernatant was filtered through a medium-speed qualitative filter paper. The classic ammonium molybdate-ascorbic acid colorimetric method was used to determine the Pi concentration in the extract: ammonium molybdate and ascorbic acid were added to the extract to generate a blue complex, and the absorbance was measured at 880 nm, and the Pi content (expressed in mg Pi / g fresh weight) was calculated according to the standard curve. The detection results are shown in Figure 3 A, OSH45 overexpression lines significantly increased the Pi concentration in rice leaves.
[0183] Total phosphorus and multi-element determination: about 0.1 g of dried tissue sample was weighed, and digested in a microwave digestion instrument using 68% HNO3(v / v) and 30% H2O2, with a ratio of 5:1. The solution was diluted to 40 mL. The concentrations of potassium, iron, manganese, copper and other elements were analyzed by inductively coupled plasma optical emission spectrometer (ICP-OES). The detection results are shown in Figure 3 B-F, there was no significant difference in the content of other elements between genotypes except for total phosphorus concentration.
[0184] Biomass determination: at the end of each treatment, the aboveground part of the plant was cut and dried at 80°C to constant weight, and then weighed to calculate the average dry weight. As shown in Figure 2 E, the dry weight of OSH45-OE plants was significantly higher than that of wild type under low phosphorus (LP, 10 μM KH2PO4) conditions (t-test P<0.01) (as shown in Figure 2 E of FIG. 6). These experimental results verified the important role of OSH45 in plant phosphorus nutrition from different angles.
[0185] Example 8: qPCR verification of expression changes of key genes
[0186] To verify the results of transcriptome screening and understand the specific genes regulated by OSH45, this example used real-time fluorescent quantitative RT-qPCR technology to detect the expression differences of key phosphorus nutrition related genes in different materials. The test plants were wild type NIP, osh45 mutant and OSH45-OE transgenic line seedlings. The treatment conditions included normal high phosphorus (200 μM Pi) and phosphorus deficiency (0 μM Pi treatment for 7 days). Total RNA was extracted from the roots and leaves of the treated seedlings, and cDNA templates were obtained by reverse transcription. Several genes significantly regulated in the transcriptome analysis were selected for qPCR: phosphorus transport genes such as OsPT1, OsPT2, OsPT4, OsPT8, genes encoding phosphorus signal negative regulatory proteins such as OsSPX1, OsSPX2, OsSPX3, and nitrate transport protein genes such as OsNRT2.1. The qPCR results were highly consistent with the transcriptome data: under high phosphorus conditions, the expression of OsPT1 / 2 / 4 / 8 in OSH45-OE plants was 2-5 times higher than that in wild type, and the expression of OsSPX1 / 2 / 3 was significantly reduced to 20%-40% of that in wild type; in osh45 mutant, the expression of some phosphorus transport genes (such as OsPT1) decreased by about 30% compared with wild type. These data further support the regulatory effect of OSH45 on these key genes Figure 6). In addition, the expression of nitrogen metabolism gene OsNRT2.1 was also detected, and it was found that it was significantly down-regulated in OSH45 overexpression lines (about 50% of the level of wild type), which confirmed the inhibitory effect of OSH45 on nitrogen pathway. Thus, the qPCR verification experiment fully proved that OSH45 realized the function of improving phosphorus utilization by affecting the expression of a large number of downstream genes.
[0187] Example 9: Transcriptome sequencing analysis
[0188] In order to globally understand the transcriptional regulation network mediated by OSH45, high-throughput RNA sequencing (RNA-seq) was performed in this embodiment. The test samples were wild type NIP and OSH45-OE transgenic plants, and the root tissues were cultured for 7 days under high phosphorus (HP) and phosphorus deficiency (-P) conditions, a total of 4 treatment groups, 3 biological replicates in each group. After extracting total RNA, a cDNA library was constructed, and an Illumina sequencing platform was used for 150 bp double-end sequencing. The obtained raw reads were subjected to quality control, aligned to the rice reference genome, and the DESeq2 software was used to screen the differentially expressed genes (DEGs), with the judgment standard being Fold Change≥2 and false discovery rate FDR<0.05. The results are as follows: under high phosphorus conditions, OSH45 overexpression led to the differential expression of 2406 genes, of which 1421 were up-regulated and 985 were down-regulated; under phosphorus deficiency conditions, the number of differential genes was 1439 (824 up-regulated and 615 down-regulated) Figure 4 of A). Further comparison found that OSH45 overexpression significantly affected the transcriptional response of plants to phosphorus deficiency: 3370 genes in wild type were expressed to change under phosphorus deficiency, while only 460 in OSH45-OE Figure 4 of A). Especially among the 1881 phosphorus deficiency up-regulated (PSI) genes in wild type, 708 (about 38%) were already up-regulated in OSH45-OE Figure 4 of B-C); these 708 differentially expressed genes were enriched in biological processes such as “defense response” and “phosphorus ion transport” Figure 4 of D). Among the 1489 phosphorus deficiency down-regulated (PSS) genes in wild type, 366 (about 25%) were inhibited in OSH45-OE plants Figure 4 of B-C), and these 366 differentially expressed genes were enriched in biological processes such as “amino acid transport” and “negative regulation of mitotic cell cycle” Figure 4 of E).
[0189] In this embodiment, the biological change processes triggered by OSH45 overexpression were analyzed. By performing GO enrichment analysis on the differentially up-regulated genes in OSH45 overexpression plants compared with wild type, it was found that these differential genes were significantly enriched in biological processes such as “phosphorus ion transport” and “plant defense response”Figure 5 A). Further cluster heat map analysis of the screened phosphate signal and transport related genes showed that phosphate transporter related genes (such as OsPT1 / 2 / 4 / 8) were significantly up-regulated in OSH45 overexpression lines, while SPX domain phosphate signal negative regulation genes (such as OsSPX1 / 2 / 3) were inhibited Figure 5 B).
[0190] The present application outlines a model of the action of OSH45: OSH45 is induced to express under low phosphorus, directly or indirectly activates phosphate transport and utilization pathway genes as a transcription factor, while inhibiting negative regulation genes such as SPX and part of nitrogen assimilation genes, and ultimately realizes the effect of improving phosphorus uptake and optimizing nutrient balance. The large-scale data provided in this embodiment further supports the value of OSH45 as a phosphorus efficient utilization regulatory factor.
[0191] Example 10: Fluorescence observation of rice roots
[0192] Take 7-day-old OSH45-OE seedling root tips of about 1 cm and place them on a glass slide for fluorescence observation with a laser confocal microscope. Confocal imaging uses a 25x water immersion objective lens. Argon ion laser excites fluorescent proteins at 488 nm. Fluorescence is detected in the range of 493-542 nm. The results are as follows Figure 1 C.
[0193] Example 11: Nicotiana benthamiana transient transformation and fluorescence observation
[0194] Nicotiana benthamiana was cultured in a 24°C light incubator with 14h light / 10h darkness and a relative humidity of about 70%. In the experiment, 5-6 week old tobacco leaves were selected for injection.
[0195] The OSH45 overexpression vector constructed in Example 3 was transformed into Agrobacterium strain and inoculated into 5mL YEP medium with corresponding resistance, 28°C 200rpm shaker for 18-20h, the concentration of Agrobacterium liquid was detected by spectrophotometer, OD600 to 0.8. 4,000rpm, centrifugal 15min, discard supernatant, add 5mL tobacco activation liquid, resuspend the bacterial body, room temperature standing culture 2-3h before injection. The formula of tobacco activation liquid (100mL): ddH2O 98mL, 1M MES 1mL, 1M MgCl2 1mL, 0.2M acetyl-syringone (AS) 100μL. Mix equal volumes of various activation liquids containing different bacterial bodies as injection combinations.
[0196] The thick leaves with good growth state were selected for injection. 1 mL of sterile syringe without needle was used to inject the lower epidermis of tobacco leaves to avoid damage to the leaves during injection. After injection, the injected leaf position was marked with a marker pen. The tobacco was placed in a culture dish, and appropriate amount of water was added. The tobacco was cultured in the dark for 1 day and then cultured in the light for 2-3 days. The specific sampling time was determined according to the protein expression intensity, and the conditions could be determined by pre-experiment. The tobacco leaves were cut for laser confocal microscope imaging. The results showed that the OSH45-GFP protein was mainly located in the nucleus of C). Figure 1
[0197] Finally, it should also be noted that the above only lists several specific embodiments of the present application. Obviously, the present application is not limited to the above embodiments, but can also have many variations. All variations that can be directly derived or inferred from the disclosed content by those of ordinary skill in the art should be considered within the scope of the present application.
Claims
1. A rice gene OSH45 having transcriptional regulatory activity, characterized in that: The nucleotide sequence is shown as SEQ ID NO:
1.
2. The gene of claim 1, wherein: Mutants, alleles and derivatives generated by adding, substituting, inserting and deleting one or more nucleotides in the nucleotide sequence shown as SEQ ID NO: 1 are also included.
3. The genetically encoded protein OSH45 according to claim 1, characterized by: The amino acid sequence is shown as SEQ ID NO:
2.
4. The protein of claim 3, wherein: Derivatives generated by adding, substituting, inserting and deleting one or more amino acids in the amino acid sequence shown as SEQ ID NO: 12 are also included.
5. The gene according to claim 1 or 2 is used for improving the phosphorus uptake of crops.
6. Use according to claim 5, characterized in that: For breeding of phosphorus nutrient tolerance; for genetic improvement of crops for improving phosphorus nutrient uptake and utilization.
7. The use according to claim 5 or 6, characterized in that: Overexpression of OSH45 gene positively regulates the phosphorus uptake capacity of crops; Knocking out OSH45 gene negatively regulates the phosphorus uptake capacity of crops.
8. Use according to claim 7, characterized in that: Using plant expression vectors containing the gene OSH45 to transform crops to achieve genetic improvement of crop phosphorus nutrient uptake and utilization; The plant expression vector containing the gene OSH45 includes Osh45 mutant vector and OSH45 overexpression vector.
9. A method of modulating the phosphorus uptake capacity of a crop, characterized in that: Using the gene OSH45 overexpression vector to transform crops to obtain transgenic crops, thereby regulating the phosphorus uptake capacity of crops.