Maize transcription factor ZmbHLH99 gene and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a corn transcription factor ZmbHLH99 gene and application thereof. The nucleotide sequence of the corn transcription factor ZmbHLH99 gene provided by the invention is as shown in SEQ ID NO (Sequence Identity Number 1). Research results show that compared with ND101, after the corn transcription factor ZmbHLH99 gene is knocked out, the corn plant height and biomass can be remarkably increased, absorption of a corn root system to nitrogen is enhanced, the nitrogen accumulation amount in a corn body is increased, the nitrogen utilization efficiency is improved, corn ears are lengthened and thickened, and then the corn ear yield is increased.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genetic engineering, and particularly relates to a corn transcription factor ZmbHLH99 gene and its application. BACKGROUND

[0002] Corn is one of the most important food crops in China and even in the world, and occupies an important position in feed and industrial raw materials. Only by continuously improving the yield of corn can the national food security be guaranteed. However, in order to guarantee the continuous improvement of corn yield, a large amount of nitrogen fertilizer is put into corn production, which reduces the overall nitrogen fertilizer utilization efficiency and causes serious environmental non-point source pollution. Therefore, it is of great significance to carry out research on the molecular mechanism of corn for improving the absorption and utilization of nitrogen to improve the nitrogen utilization efficiency, guarantee the corn food security and reduce agricultural non-point source pollution.

[0003] In the process of regulating the expression of nitrate transporters to adapt to variable environmental nitrogen conditions, transcription factors play a crucial role. For example, the gene OsGRF4 plays an important role in regulating the expression of nitrogen absorption and carbon fixation genes, promoting the efficient use of nitrogen and the steady growth of rice. At present, the transcription factors that can effectively regulate the efficient use of nitrogen in corn include the transcription factors of the NLP family, among which ZmNLP6 and ZmNLP8 Heterologous overexpression can improve the nitrogen utilization efficiency of Arabidopsis, ZmNLP6 mainly by regulating the development of corn roots under low nitrogen to adapt to low nitrogen stress, ZmNLP8 can improve the activity of nitrite reductase in corn roots and thus improve the nitrogen utilization efficiency of corn. ZmNLP5 mainly regulate the reutilization of nitrogen in leaves to increase the greenness of corn leaves. However, these transcription factors do not directly improve the ability of corn roots to absorb nitrogen. Therefore, it is necessary to develop new transcription factors that can be used to directly improve the ability of corn roots to absorb nitrogen. SUMMARY

[0004] In order to develop a new transcription factor that can be used to directly improve the ability of corn roots to absorb nitrogen, the present application provides a corn transcription factor ZmbHLH99 gene and its application. The corn transcription factor ZmbHLH99 gene can directly improve the ability of corn roots to absorb nitrogen, realize the efficient use of nitrogen in corn, and improve the nitrogen utilization efficiency of corn. In order to achieve the above purpose, the technical scheme adopted by the present application is as follows.

[0005] The present application provides a corn transcription factor ZmbHLH99 gene for improving the nitrogen utilization efficiency of corn. The nucleotide sequence of the corn transcription factor ZmbHLH99 gene is shown in SEQ ID NO 1. The corn transcription factorZmbHLH99 The gene is a transcription factor of a bHLH family, and knocking out the transcription factor can improve the nitrogen absorption capacity of the corn root system, increase the biomass and ear yield of the corn. Moreover, the transcription factor can improve the nitrogen absorption capacity of the corn root system, realize high-efficiency nitrogen of the corn, improve the nitrogen utilization efficiency of the corn, and solve the problem that the transcription factor capable of effectively regulating high-efficiency nitrogen utilization in the prior art does not directly improve the nitrogen absorption capacity of the corn root system.

[0006] Preferably, the corn transcription factor ZmbHLH99 The amino acid sequence of the protein expressed by the gene is shown in SEQ ID NO2.

[0007] The application also provides the corn transcription factor ZmbHLH99 The gene is used for improving the ear yield of the corn.

[0008] Preferably, by enhancing the nitrogen absorption of the corn root system, increasing the nitrogen accumulation in the corn, improving the nitrogen utilization efficiency of the corn, making the corn ear longer and thicker, and further improving the ear yield of the corn.

[0009] Preferably, by improving the plant height and biomass of the corn, the ear yield of the corn is further improved.

[0010] Preferably, by reducing the expression of the corn transcription factor ZmbHLH99 The gene is used for improving the ear yield of the corn.

[0011] Preferably, by knocking out, inhibiting or silencing the expression of the corn transcription factor ZmbHLH99 The gene is used for improving the ear yield of the corn.

[0012] Preferably, the corn transcription factor ZmbHLH99 The gene is knocked out by using the CRISPR knockout technology, and then a corn mutant with improved ear yield is obtained.

[0013] Preferably, the target site of the corn transcription factor ZmbHLH99 The gene is edited by using the CRISPR / Cas9 gene editing technology.

[0014] The target site of the corn transcription factor ZmbHLH99 The sequence of the gene is shown in SEQ ID NO.3: ACTATTGGGAACCCAGATG (gRNA sequence).

[0015] Preferably, the target site of the corn transcription factor ZmbHLH99 The gene is connected into a transgenic vector to construct a recombinant expression vector; and the recombinant expression vector is transfected into corn plant material to be transformed, so as to obtain a gene editing site knockout corn plant with improved ear yield.

[0016] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention provides a maize transcription factor for regulating maize ear yield. ZmbHLH99 Gene. The maize transcription factor provided by this invention ZmbHLH99 The gene is a bHLH family transcription factor. Knocking out this transcription factor enhances the nitrogen uptake capacity of maize roots, increasing maize biomass and ear yield. Furthermore, this transcription factor improves the nitrogen uptake capacity of maize roots, achieving nitrogen efficiency and improving nitrogen use efficiency in maize. This addresses the problem in existing technologies where transcription factors effectively regulating nitrogen use in maize do not directly improve the nitrogen uptake capacity of maize roots.

[0017] 2. This invention screened a transcription factor using yeast single-hybrid screening library technology. zmbhlh99 Genes were further used to obtain mutant materials through CRISPR / Cas9 gene knockout technology. ZmbHLH99OE Agrobacterium-mediated overexpression of materials ZmbHLH99 Studies have found transcription factors ZmbHLH99 Negative regulation of nitrogen uptake in maize, knockout ZmbHLH99 Later, during the seedling stage, it can significantly increase the biomass of maize roots, increase the total nitrogen accumulation of plants, and improve the root system's ability to absorb nitrate; at the same time, two years of field trials further demonstrate that gene knockout... ZmbHLH99 Compared to ND101, it significantly increased maize plant height and biomass, increased nitrogen accumulation in maize, resulting in longer and thicker ears, thereby increasing ear yield, and overexpressing the gene. ZmbHLH99 The opposite is true afterwards. Genes Figure 1 Functional analysis and field trial analysis provide important genetic resources and theoretical guidance for breeding new nitrogen-efficient maize varieties. Attached Figure Description

[0018] ZmbHLH99 This invention provides a method for yeast one-hybrid screening. Figure 2 Gene interaction diagram.

[0019] ZmbHLH99 In this invention Figure 3 Agarose gel electrophoresis image of the full-length PCR product of the gene.

[0020] ZmbHLH99 In this invention Figure 4 Gene amino acid sequence analysis of protein domain diagrams.

[0021] Figure 5 This is a schematic diagram of the GFP-ZmbHLH99 recombinant plasmid structure in this invention.

[0022] Figure 6 This is a subcellular localization map of the ZmbHLH99 protein in this invention.

[0023] Figure 7 This is a schematic diagram of the MBP-ZmbHLH99 recombinant plasmid structure in this invention.

[0024] Figure 8 This is a Western blot image of the MBP-ZmbHLH99 protein used in this invention.

[0025] ZmbHLH99 In this invention Figure 9 Identification diagram of gene knockout material types.

[0026] ZmbHLH99 In this invention Figure 10 Gene expression level map of gene overexpression materials.

[0027] ZmbHLH99 In this invention Figure 11 Phenotypic diagram of nitrogen treatment in hydroponically cultured transgenic materials.

[0028] ZmbHLH99 In this invention Figure 12 Biomass diagram of transgenic material subjected to nitrogen treatment in hydroponics.

[0029] ZmbHLH99 In this invention Figure 13 A graph showing the nitrogen accumulation of transgenic materials under hydroponic nitrogen treatment.

[0030] ZmbHLH99 In this invention Figure 14 Hydroponic nitrogen treatment of transgenic materials 15 NO3 - Absorption rate graph.

[0031] ZmbHLH99 In this invention Figure 15 Hydroponic nitrogen treatment of transgenic material for root tip NO3 - Flow velocity graph.

[0032] ZmbHLH99 In this invention Figure 16 Phenotypic diagram of transgenic materials treated with nitrogen fertilizer in the field.

[0033] ZmbHLH99 In this invention Figure 17 Plant height of transgenic materials during the tasseling stage after nitrogen fertilizer treatment in the field.

[0034] ZmbHLH99 In this invention Figure 18 Biomass diagram of transgenic materials during the tasseling stage under nitrogen fertilizer treatment in the field.

[0035] ZmbHLH99 For the present application Figure 19 Figure 1 is a graph showing the nitrogen accumulation amount of the transgenic material at the tasseling stage under the nitrogen fertilizer treatment in the field.

[0036] ZmbHLH99 For the present application Figure 20 Figure 2 is a graph showing the ear phenotype of the transgenic material under the nitrogen fertilizer treatment in the field.

[0037] ZmbHLH99 For the present application Figure 21 Figure 3 is a graph showing the ear length of the transgenic material under the nitrogen fertilizer treatment in the field.

[0038] ZmbHLH99 For the present application Figure 22 Figure 4 is a graph showing the ear thickness of the transgenic material under the nitrogen fertilizer treatment in the field.

[0039] ZmbHLH99 For the present application Figure 1 Figure 5 is a graph showing the single ear yield of the transgenic material under the nitrogen fertilizer treatment in the field. DETAILED DESCRIPTION

[0040] The present application will be described in detail below with reference to the drawings and specific examples, but should not be understood as a limitation of the present application. If not specifically stated, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, if not specifically stated, can be obtained from commercial channels.

[0041] Example 1: Discovery and cloning of the maize transcription factor ZmbHLH99 (ZmbHLH99 protein) and its encoding gene I. Discovery of ZmbHLH99 protein and its encoding gene A yeast single-hybrid screening library test was performed on the maize root cDNA yeast library after low-nitrogen stress treatment, and the results are shown in Figure 1. ZmbHLH99 A bHLH family transcription factor ZmbHLH99, i.e. maize transcription factor ZmbHLH99, was obtained by searching the maize database MaizeGDB.

[0042] The amino acid sequence of the ZmbHLH99 protein is shown in SEQ ID NO 2, which consists of 611 amino acid residues.

[0043] The amino acid sequence shown in SEQ ID NO 2 is as follows: MVMKMEHEDNGAIGGTDGTWTEDDRALGAAVLGADAFAYLTKGGGAISEGLVATSLPGDLQNKLQELVESESPGTSWNYAIFWQLSRTKSGDLVLGWGDGCCREPRDGELGAAASAGSEDSKQRMRKRALQRLHIAFGVADEEDYSPGIDQVTDTEMFFLASMYFAFPRHAGGPGQAFAAGIPIWVPNSERKVVPANYCYRGFLANAAGFRTIVLVPFESGVLELGSTQHIAESSGTVQTVRSVFAGTSGNKSAVQRHEAERSPGLAKIFGKDLNLGRPSVGLAVGVSNSKVDERTWEQRSAVGGTSLLPSVQKGLQNFSWSQARGLNSHQQKFGNGVLIVSNNEGAHRNNGAVDSPSAAQFQLQKAPQLQKLSVVQKTPQLVNQQPMQAQVPRQIDFSAGSSSKPGVLVTRAGVLDGESAEVDGLCKEEGPPPVMEDRRPRKRGRKPANGREEPLNHVEAERQRREKLNQRFYALRAVVPNISKMDKASLLGDAITYITDLQKKLKEMETERERLLESGMVDPRERAPRPEVDIQVVQDEVLVRVMSPMENHPVKKVFQAFEEAEVRVGESKVTSNNNGTAVHSFIIKCPGTEQQTREKVIAAMSRAMSS*.

[0044] Two, ZmbHLH99 Cloning of the gene (corn transcription factor ZmbHLH99 gene) The corn leaf RNA was extracted using the Aidley kit (the kit was purchased from Beijing Aidley Biotechnology Co., Ltd., and the extraction was performed according to the provided instructions), and the first-strand cDNA was synthesized using the M-MLV reverse transcription kit (purchased from Takara Company, and the operation was performed according to the kit instructions), and the obtained first-strand cDNA was used as a template for amplifying ZmbHLH99 the full-length of the gene. According to the sequence of the ZmbHLH99 gene, two specific primers were designed for PCR amplification, and a PCR product was obtained.

[0045] Among them, the Planta Max Super-Fidelity DNA Polymerase kit of Nuoyan was used to amplify Figure 2 the full-length of the gene sequence.

[0046] The specific primers mentioned above include upstream primer F1 and downstream primer R1.

[0047] The nucleotide sequence of the upstream primer is shown in SEQ ID NO 3: 5'-atggccatggaggccagtgaattcATGGTCATGAAGATGGAG-3'.

[0048] The nucleotide sequence of the downstream primer R1 is shown in SEQ ID NO 4: 5'-ctgcagctcgagctcgatggatccACTGCTCATCGCGCGAGAC-3'.

[0049] The 10 μL PCR reaction system includes: 5 μL of 2×Phanta Max Buffer, 0.2 μL of dNTP Mix (10 mM), 1 μL of cDNA, 0.2 μL of Phanta Max Super-Fidelity DNA Polymerase, 0.4 μL of upstream primer F1, 0.4 μL of downstream primer R1, and 2.8 μL of ddH2O.

[0050] The PCR amplification program was as follows: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 15 s, 72℃ for 40 s, 35 cycles; final extension at 72℃ for 5 min (10 reaction systems in total).

[0051] The PCR products were electrophoresed on a 1.5% agarose gel as follows: ZmbHLH99 As shown. After electrophoresis, the target band was cut under UV light and recovered using an agarose gel DNA recovery kit (purchased from Kangwei Biotechnology Co., Ltd., the operation steps were followed according to the kit's instruction manual). The purified fragment was then obtained. The recovered fragment was recombinated and ligated into the pGADT7 vector. The 10 μL recombination reaction system consisted of: the recovered fragment... ZmbHLH99 1 μL of gene fragment, 5 μL of pGADT7, 2 μL of 5×CEII Buffer, 1 μL of Exnase® II, and ddH2O were added to a final volume of 10 μL; ligation was performed in a 37℃ metal bath for 30 min. 5 μL of the ligation product was taken and transformed into *E. coli* DH5α using the heat shock method (referring to J. Sambrook et al., *Molecular Cloning: A Laboratory Manual* (3rd edition), Science Press, 2002). Positive clones were screened in LB agar containing 50 mg / L ampicillin, and 5 clones were selected for sequencing (sequencing was performed by Beijing BGI Sequencing Co., Ltd.) to obtain the desired full-length gene CDS. ZmbHLH99 Gene. Sequencing results showed that the gene sequence was 1836 bp in length, encoding a complete ORF reading frame of 611 amino acids.

[0052] wherein, ZmbHLH99 The nucleotide sequence of the gene is shown as SEQ ID NO 1 :

[0053] Example 2: Characterization of ZmbHLH99 protein I. ZmbHLH99 protein sequence analysis Analyzing using the NCBI website Figure 3 The full-length protein sequence of the gene. The amplified full-length gene sequence was translated into an amino acid sequence and entered into the NCBI website for CD-Search analysis. ZmbHLH99 The sequence of amino acids from position 60 to position 245 is a conserved domain of the bHLH-MYC family transcription factor, and the sequence of amino acids from position 450 to position 516 is a DNA-binding site domain of the transcription factor. The prediction shows that the protein is 611 amino acids long and contains two typical transcription factor protein structures.

[0054] II. Subcellular localization of ZmbHLH99 Subcellular localization of ZmbHLH99 protein was studied using protoplasts. Based on the multiple cloning site of the expression vector pSuper1300-GFP and... ZmbHLH99 Designing amplification of the coding region sequence of the gene ZmbHLH99 Using forward and reverse primers for the entire coding region of the gene, the pSuper promoter::ZmbHLH99-GFP recombinant vector was obtained, specifically using the method obtained in Example 1. ZmbHLH99 Using the gene as a template, PCR amplification was performed using upstream primer F1 and downstream primer R1 to obtain a sample containing... Xba The product of gene and vector homologous arms; utilizing Figure 4 The pSuper1300-GFP vector was digested with enzyme I, and the resulting vector framework was recovered and purified. The pSuper promoter::ZmbHLH99-GFP recombinant vector was obtained by ligating the purified PCR product with the vector framework. The recombinant vector is shown below. Xba As shown, the pSuper1300-GFP vector will be placed in... ZmbHLH99 Cleavage at the I restriction site, ligation ZmbHLH99 The recombinant vector was obtained by sequencing the gene while keeping the other sequences of pSuper1300-GFP unchanged.

[0055] The primers are as follows: The nucleotide sequence of upstream primer F2 is shown in SEQ ID NO 5: 5'-TACACCAAATCGACTCTAGAATGGTCATGAAGATGGAG-3'.

[0056] (Highlighted are the XbaI restriction sites); The nucleotide sequence of the downstream primer R2 is shown in SEQ ID NO 6: 5'- ATAGGTACCCGGGCTCTAGAACTGCTCATCGCGCGAGAC-3'.

[0057] (Highlights are the enzyme cutting sites of XbaI).

[0058] The corn protoplast isolation and transformation method is as follows: Enzymatic solution: 1.5% (w / v) Cellulase R10, 0.2% (w / v) Macerozyme R10, 0.4M mannitol, 20mM KCl, 20mM MES (pH 5.7) and 10mM CaCl2. The Cellulase R10 and Macerozyme R10 are purchased from Onozuka, and other reagents are purchased from Sigma-Aldrich.

[0059] WI solution: 20mM KCl, 0.5M mannitol and 4mM MES (pH 5.7).

[0060] W5 solution: 125mM CaCl2, 154mM NaCl, 5mM KCl and 2mM MES (pH 5.7).

[0061] MMg solution: 0.4M mannitol, 15mM MgCl2 and 4mM MES (pH 5.7).

[0062] 40% (w / v) PEG transformation solution (10mL): 0.2M mannitol, 100mM CaCl2 and 4g PEG 4000.

[0063] Plant corn yellowing seedlings, and place the corn after germination in a dark room for culture, and take out when two leaves one heart. Use a blade to cut the thick area in the middle of the leaf into a strip with a width of 1mm and a length of about 1cm, quickly transfer the cut strip into and immerse in the enzymatic solution, avoid light, vacuum for 0.5h, and avoid light and stand for enzymolysis for 6h; add W5 solution with the same volume as the enzymatic solution, filter the enzymatic solution with a 200 mesh nylon membrane to remove the unenzymolysis residues, and then filter twice with a 400 mesh cell sieve, and the filtrate is the corn protoplast; centrifuge at 700rpm for 5min, and discard the supernatant. Resuspend the protoplasts with W5 solution and centrifuge at 700rpm for 2min, discard the supernatant, resuspend the protoplasts with W5 solution, and place on ice for 30min; suck the W5 solution, and resuspend the protoplasts with MMg solution, and adjust the final concentration of the protoplasts to about 2×10 5Protoplasts were used for transformation at a rate of 100 μL / mL. 100 μL of protoplasts were transferred to a 2 mL round-bottom centrifuge tube, and 2 μg of P-super promoter::ZmbHLH99-GFP recombinant plasmid was added. The tube was gently tapped to mix. 110 μL of PEG transformation buffer was added to the centrifuge tube, and the tube was quickly and gently tapped to mix. The tube was incubated at room temperature for 5 min. The reaction was terminated by adding 800 μL of W5 solution to the centrifuge tube. The tube was centrifuged at 700 rpm for 2 min, the supernatant was discarded, and the protoplasts were resuspended in W5 solution. The protoplasts were transferred to a culture plate and incubated at room temperature under low light for 10 h.

[0064] Among them, the maize transformation seedlings were of the maize inbred line ND101, which originated from the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University.

[0065] Protoplasts cultured overnight were centrifuged at 700 rpm for 2 min, the WI solution was removed, and 110 μL of WI solution was added and gently mixed. A small amount of protoplasts was aspirated from a pipette tip with the tip cut off and placed on a glass slide. GFP expression was observed under a laser confocal microscope. The results showed that GFP green fluorescence signal was observed in the nuclei of the protoplasts. Figure 5 Genes are located in the cell nucleus, such as ZmbHLH99 As shown.

[0066] Overnight stays refer to stays of 14 hours or more, or 12 hours or more.

[0067] III. Purification of ZmbHLH99 Protein The one obtained in Example 1 EcoR Using the gene as a template, PCR amplification was performed using upstream primer F3 and downstream primer R3 to obtain a product containing the homologous arm of the ZmbHLH99 gene and the vector; using BamH I and ZmbHLH99 The vector pMAL-C2X was digested with enzyme I, and the purified product was recovered to obtain... Figure 6 Gene fragment and pMAL-C2X linear vector; ligation of gene fragment and linear vector yields MBP-ZmbHLH99 recombinant plasmid as follows: EcoR As shown, pMAL-C2X is about to... BamH I and ZmbHLH99 DNA fragment replacement between I restriction sites EcoR The recombinant plasmid was obtained by keeping the gene and other sequences of pMAL-C2X unchanged.

[0068] The primers are as follows: The nucleotide sequence of upstream primer F3 is shown in SEQ ID NO 7: 5'-GAGGGAAGGATTTCAGAATTCATGGTCATGAAGATGGAG-3'.

[0069] (highlighted as BamH the enzyme cutting site of I); The nucleotide sequence of the downstream primer R3 is shown in SEQ ID NO 8: 5'- GCAGGTCGACTCTAGAGGATCCACTGCTCATCGCGCGAG -3'.

[0070] (highlighted as BL21 the enzyme cutting site of I).

[0071] The recombinant plasmid was transformed into E. coli by heat shock transformation method Figure 7 , and after overnight culture at 37°C, a positive single colony was inoculated into 2 mL of LB liquid medium containing ampicillin antibiotic, and incubated overnight at 37°C, 200 rpm. The bacterial solution after overnight culture was inoculated into 100 mL of LB liquid medium containing ampicillin antibiotic, and incubated at 37°C, 200 rpm until the OD 600 of the bacterial solution reached 0.8. The bacterial solution was transferred to a 28°C shaker, and after about 15 min of cooling, IPTG was added to a final concentration of 0.6 mM, and induced at 28°C, 100 rpm for 6 h. The bacterial solution was collected in a 50 mL round-bottom tube, centrifuged at 4°C, 4000 rpm for 15 min, and the supernatant was discarded to collect the bacterial body. Protein lysis buffer 10 mL was added, the bacterial body was resuspended, and lysozyme was added to a final concentration of 100 μg / mL. After mixing, the round-bottom tube was transferred to an ice box for heat conduction during ultrasonic disruption, and the ultrasonic disrupter program was set as follows: power 30%, 10 min, interval 5 s ultrasonic 5 s. Centrifuged at 4°C, 12000 rpm for 20 min. The supernatant was transferred to a clean 15 mL centrifuge tube, 100 μL of MBP-beads equilibrated with protein lysis buffer was added, and Triton X-100 was added to a final concentration of 0.5% (v / v). After mixing, the tube was incubated in a 4°C rotary instrument for 4 h. After incubation, centrifuged at 4000 rpm for 5 min, and the supernatant was discarded. The beads were washed with lysis buffer 3 times. The beads were collected by centrifugation and transferred to a clean 1.5 mL EP tube. Elution buffer was added, and eluted at room temperature for 15 min. After elution for 3 times, the supernatant was transferred to a clean 1.5 mL EP tube. 5 μL was taken for protein electrophoresis and western blot test as shown in ZmbHLH99 , and the purified protein was added to a final concentration of 15% (v / v) glycerol. After mixing, it was aliquoted into centrifuge tubes and stored at -80°C.

[0072] wherein the protein lysis buffer is 20 mM Tris-HCl (pH 7.5), 1 mM EDTA (pH 8.0), 2.3 g NaCl, and water is added to 200 mL.

[0073] Elution buffer: 0.36 g Maltose to 100 mL lysis solution.

[0074] Example 3: ZmbHLH99 Knockout materials and overexpression plant nitrogen treatment phenotype I, zmbhlh99 Obtaining of knockout materials and overexpression plants The vectors and all materials used in this part of the experiment were entrusted to the Center for Crop Functional Genomics and Molecular Breeding, China Agricultural University, and were created using ND101 as the donor material. The gene knockout material ZmbHLH99OE CAU-PREID No. CAU-91-157; gene overexpression material ZmbHLH99 CAU-PREID No. CAU-76-147. The specific query website is as follows: http: / / 202.112.170.206:8080 / gene / search.html.

[0075] II, zmbhlh99 Identification of knockout materials and overexpression plants (1) Identification by receiving the created transgenic material from the Center for Crop Functional Genomics and Molecular Breeding, China Agricultural University. The T2 and above gene knockout Figure 8 , DNA of the plant was extracted by CTAB method for identification. Primers were designed near the target gRNA, and the upstream primer CR-ZmbHLH99F and the downstream primer CR-ZmbHLH99R were used to amplify the target band, and the product was then sent to the company for sequencing (sequencing work was completed by Beijing Huada Sequencing Company). The identification results are as follows zmbhlh99_1 , two types of mutations were identified, knockout mutant zmbhlh99_2 is a mutation that knocks out one base, resulting in early termination of protein expression; mutant ZmbHLH99OE is a mutation that inserts one base, resulting in early termination of protein expression.

[0076] Among them, the detection primer is as follows: The nucleotide sequence of the upstream primer CR-ZmbHLH99F is as shown in SEQ ID NO 9: 5'-GGAGTTGCTGACGAGGAGG-3'.

[0077] The nucleotide sequence of the downstream primer CR-ZmbHLH99R is as shown in SEQ ID NO 10: 5'-GCTCACAATCAACACACC-3'.

[0078] (2) The T2 and above ZmbHLH99For overexpression materials, RNA was extracted from maize leaves using the Adley kit (purchased from Beijing Adley Biotechnology Co., Ltd., extraction was performed according to the provided instructions), and first-strand cDNA was synthesized using the M-MLV reverse transcription kit (purchased from Takara, performed according to the kit instructions). The obtained first-strand cDNA was used as a template for real-time quantitative PCR using upstream primer OE-ZmbHLH99F and downstream primer OE-ZmbHLH99R to detect the gene. Figure 9 The expression level, the detection results are as follows ZmbHLH99 Genes in overexpressed materials ZmbHLH99 Its expression level far exceeds that of the donor material ND101.

[0079] The detection primers are as follows: The nucleotide sequence of the upstream primer OE-ZmbHLH99F is shown in SEQ ID NO 11: 5'- GACCTCATTGCTACCGAGT -3'.

[0080] The nucleotide sequence of the downstream primer OE-ZmbHLH99R is shown in SEQ ID NO 12: 5'-GTCCACTGCTCCGTTGTTG-3'.

[0081] three, ZmbHLH99 Overexpression plants are sensitive to nitrogen stress By performing homozygous knockout obtained in step two zmbhlh99 Mutants of genes ZmbHLH99OE Plants, homozygous overexpression ZmbHLH99OE When ND101 plants and control plants were subjected to controlled nitrogen hydroponics treatments (normal nitrogen treatment: SN; low nitrogen stress treatment: LN), overexpression was observed. ZmbHLH99 Compared to the control plant ND101, the plants were more sensitive to low nitrogen stress; knockout zmbhlh99 Mutants of genes Figure 10 The plants were less sensitive compared to the control. ZmbHLH99 As shown.

[0082] Seven days after low nitrogen treatment, maize plants were harvested from control plants (ND101) and homozygous knockout plants. zmbhlh99 Mutants of genes ZmbHLH99OE Plants, homozygous overexpression Figure 11 The plant's roots were wiped dry with absorbent paper, placed in an envelope, and dried in a 75℃ oven for 2 days. The dry weight of the roots was then measured. The results are as follows: ZmbHLH99 As shown.

[0083] The results showed that, under normal nitrogen treatment and low nitrogen stress, analysis of plant root biomass revealed homozygous knockout.zmbhlh99 Mutants of the gene ZmbHLH99OE Plants had larger root biomass compared to control plants ND101, homozygous overexpression ZmbHLH99 Plants were the opposite.

[0084] IV. After nitrogen treatment ZmbHLH99 Determination of total nitrogen accumulation in the root system of transgenic materials Test plant (homozygous knockout zmbhlh99 Mutants of the gene ZmbHLH99OE Plants, homozygous overexpression Figure 12 Plants and control plants ND101) after the corresponding test treatment, when waiting for the appearance of the phenotype, randomly select 9 corn seedlings of the same size under each treatment condition, 3 as a repeat, a total of 3 biological repeats. The surface of the root sample is cleaned with deionized water, the underground root system is taken, the water is absorbed with absorbent paper, then the sample is packed into an envelope bag, put into an oven, 105℃ fixation 30min, then 75℃ drying to constant weight, weighing, then grinding, passing through a 200 mesh sieve. Take 0.1g of ground sample into a digestion tube, add nitrogen fixation tablets and 5mL of concentrated sulfuric acid, place in a digestion furnace at 410℃ for 1h, then cool to room temperature, and put into a Kjeldahl nitrogen determination instrument for determination.

[0085] The specific method of total nitrogen content refers to Bremner (1982). Each determination needs to use sucrose and ammonium sulfate to determine the blank value and recovery rate. Take 0.1g of sucrose and follow the above steps to determine the blank value. Take 0.1g of (NH4)2SO4 and follow the above steps to determine the recovery rate. The N content of (NH4)2SO4 is theoretically 21.2%.

[0086] The recovery rate of nitrogen content determined by Kjeldahl nitrogen determination instrument is calculated as follows: Recovery rate = (actual N content / 21.2) x 100%; In the above formula, the unit of recovery rate is %; Plant nitrogen content = (V2-V1) C x 0.014 x 103 / M x recovery rate N%; In the above formula, the unit of plant nitrogen content is mg / g; 1mol L -1 0.014g N per 1mL; V2: the volume of hydrochloric acid used for titration, unit: mL; V1: the volume of hydrochloric acid used for blank titration, unit: mL; C: the concentration of hydrochloric acid standard solution, unit: mol L -1 ; M: sample mass, unit: g; Plant nitrogen accumulation = plant nitrogen content x sample biomass; In the above formula, the unit of plant nitrogen accumulation is mg; the unit of plant nitrogen content is mg / g; the unit of sample biomass is g.

[0087] The results are as follows ZmbHLH99 As shown, regardless of whether under normal nitrogen treatment or low nitrogen treatment, homozygous knockout of ND101 plants compared to the control plants... zmbhlh99 Mutants of genes ZmbHLH99OE The plants exhibited higher nitrogen accumulation and homozygous overexpression. ZmbHLH99 The plant accumulates less nitrogen.

[0088] V. After nitrogen treatment Figure 13 Measurement of nitrate uptake rate in roots of transgenic materials Plants with uniform growth after 6 days of nitrogen treatment were placed in a 0.1 mM CaSO4 solution for 1 min to equilibrate, and then transferred to a solution containing 0.05 mM and 4 mM Ca(II)2. 15 The roots were placed in a 299% (atom) solution of NO3 for 30 minutes. After treatment, the roots were washed in deionized water for 1 minute to remove any residual Ca2+ on the surface. 15 NO3)2, after blotting the water from the root surface with tissue paper, place it in a 120℃ oven for 30 minutes, then dry it at 75℃ until dry. After drying, grind the sample, pass it through a 100-mesh sieve, accurately weigh 0.02 mg of the sieved sample, wrap it in a tin cup, and then analyze the sample using a stable isotope mass spectrometer (Vario PYRO cube ISOprime 100, Cheadle Hulme, UK). 15 Nitrogen content determination.

[0089] The results are as follows ZmbHLH99 As shown, homozygous knockout of ND101 plants compared to the control under different nitrogen treatments zmbhlh99 Mutants of genes ZmbHLH99OE The plant's root system absorbs more per unit time. 15 NO3 - homozygous overexpression ZmbHLH99 The amount of nutrients absorbed by the plant's root system per unit time. 15 NO3 - less.

[0090] VI. After nitrogen treatment ZmbHLH99 NO3 in the root tip of genetically modified material - Measurement of flow rate Root system NO3 - The flow rate was measured using non-destructive ion micrometer (NMT) at a distance of 700 µm from the root tip. - The absorption rate. The specific experimental procedure is as follows: nitrogen-treated maize seedlings were used as control plants ND101 and homozygous knockout plants. zmbhlh99 Mutants of genes Figure 14The root tips of the main roots of plants and homozygous overexpressing ZmbHLH99OE were cut and equilibrated in equilibration solution for 15 min. The equilibrated root tips were then fixed in new petri dishes, and 5 mL of test buffer was added. The samples were placed under a microscope, and the microscope and microelectrode were adjusted so that the distance between the tip of the microelectrode and the test surface was about 5 mm. Measurements were then taken, and data were read after the data stabilized. The test time was 10 min, and NO3 was recorded every 6 s. - For flow rate, to reduce experimental error, the average flow rate was calculated using five values ​​read within 30 seconds. NO3 - Flow velocity data were analyzed using imFluxes software (imfluxes.com, Xuyue (Beijing) Sci. & Tech. Co., Ltd., Beijing, China).

[0091] The results are as follows ZmbHLH99 As shown, homozygous knockout under different nitrogen treatments zmbhlh99 Mutants of genes ZmbHLH99OE NO3 in the roots of the plants compared to the control plant ND101 - A higher flow rate indicates a stronger ability to absorb nitrate ions, and homozygous overexpression. ​ plant root system NO3 - The flow rate is low, and the root system's absorption capacity is weak.

[0092] The equilibrium solution consisted of 0.1 mM NH4NO3, 0.1 mM KCl, 0.1 mM CaCl2, and 0.3 mM MES, with a pH of 6.0.

[0093] Test buffer: 4 mM Ca(NO3)2 and 0.05 mM Ca(NO3)2.

[0094] Example 4: Field Trial Measurement ZmbHLH99 Phenotypic and yield traits of knockout materials and overexpressing plants one, ZmbHLH99 Knockout materials and nitrogen-treated field plant phenotypes By applying the homozygous knockout obtained in step two of implementation case 3 ZmbHLH99 Mutants of genes zmbhlh99 Plants, homozygous overexpression ZmbHLH99OE Field trials were conducted on ND101 plants and control plants.

[0095] Field phenotype and yield experiments were carried out at the Hebei Wuqiao Experimental Station of China Agricultural University (37°36'N, 116°28'E). The field fertilization scheme was in accordance with the nitrogen fertilizer (Control: N 225 kg / ha; LN: N 75 kg / ha) application, and other fertilizers were kept consistent. The field fertilization was applied as a basal fertilizer at one time. The sowing plots were set up in different nutrient plots, with a row length of 2.5 m, a row spacing of 0.6 m, a plant spacing of 0.25 m, single and double seed sowing, manual thinning at the three-leaf stage to ensure 10 uniform maize plants per row, and three plots in different nutrient plots as three replicates. Field phenotype observation and statistics were carried out at the tasseling stage and the harvest stage, respectively. At the tasseling stage, representative plants with consistent growth vigor were dug out and placed in flowerpots for photography.

[0096] The results of the field experiment are shown in Table 4. Figure 15 Under normal nitrogen and low nitrogen treatment, the mutant plants with homozygous knockout of the gene ZmbHLH99 had plant height significantly higher than the control plants ND101; at the same time, the homozygous overexpression plants zmbhlh99 had plant height significantly lower than the control plants ND101. ZmbHLH99OE Two,

[0097] Determination of nitrogen accumulation in knockout materials and overexpression plants after field nitrogen treatment ZmbHLH99 According to the test scheme described in step one of case 4, the plant height of the maize plants in the treatment plot was determined at the tasseling stage, and 30 maize plants were randomly selected from each treatment for plant height determination. The results of the experiment are shown in Table 5.

[0098] Under normal nitrogen and low nitrogen treatment, the mutant plants with homozygous knockout of the gene Figure 16 had plant height significantly higher than the control plants ND101; at the same time, the homozygous overexpression plants ZmbHLH99 had plant height significantly lower than the control plants ND101. zmbhlh99 Further, 6 maize plants were randomly selected from each treatment for sampling at the harvest stage, and the samples were placed in an oven at 70 degrees Celsius for drying before biomass determination. The results of the experiment are shown in Table 6. ZmbHLH99OE Under normal nitrogen and low nitrogen treatment, the mutant plants with homozygous knockout of the gene Figure 17 had biomass significantly higher than the control plants ND101; at the same time, the homozygous overexpression plants ZmbHLH99 had biomass significantly lower than the control plants ND101. zmbhlh99 ZmbHLH99OE Three, Determination of nitrogen accumulation in knockout materials and overexpression plants after field nitrogen treatment

[0099] ZmbHLH99 The results of the experiment are shown in Table 7. ​The test scheme described in step two of the implementation case 4 was processed, and after the biomass of different corn materials in the processing plot was measured at the harvest period, the remaining samples were crushed and sieved to measure the total nitrogen accumulation. The specific method is described in step four of the implementation case 3.

[0100] The determination results are shown in Table 4. Figure 18 Under normal nitrogen treatment and low nitrogen treatment, the mutant plants homozygously knocking out the gene have higher total nitrogen accumulation than the control plants ND101, and the homozygous overexpression plants accumulate less nitrogen. ZmbHLH99 zmbhlh99 Four, ZmbHLH99OE The ear phenotypes of the knockout materials and the overexpression plants after field nitrogen treatment The corn plants in the processing plot were harvested at the harvest period, dried, and photographed, and the ear length, ear width, and ear yield were counted. 30 corn ears were randomly selected from each treatment for determination and data counting.

[0101] The determination results are shown in Table 4. ZmbHLH99 Under different nitrogen treatments, The gene knockout makes the corn ear longer and thicker, Figure 19 The phenotype is opposite after the gene overexpression. ZmbHLH99 ZmbHLH99 Five, The determination of nitrogen treatment ear traits of knockout materials and overexpression plants

[0102] The corn plants in the processing plot were harvested at the harvest period, dried, and photographed, and the ear length, ear width, and ear yield were counted. 30 corn ears were randomly selected from each treatment for determination and data counting. ZmbHLH99 The determination results of ear length are shown in Table 5. The determination results of ear width are shown in Table 6.

[0103] Under different nitrogen treatments, Figure 20 The gene knockout makes the corn ear longer and thicker, Figure 21 The phenotype is opposite after the gene overexpression. ZmbHLH99 ZmbHLH99 The homozygous overexpression plants accumulate less nitrogen.

[0104] Six, ZmbHLH99 The determination of yield of knockout materials and overexpression plants after field nitrogen treatment The corn plants in the processing plot were harvested at the harvest period, dried, and photographed, and the ear length, ear width, and ear yield were counted. 30 corn ears were randomly selected from each treatment for determination and data counting.

[0105] The determination results of ear yield are shown in Table 7. Figure 22 Under different nitrogen treatments,​ZmbHLH99 After gene knockout, the yield of corn ear is obviously increased; ZmbHLH99 After gene overexpression, the yield of corn ear is obviously reduced compared with control plant ND101.

[0106] From the above, the transcription factor ZmbHLH99 negatively regulates the nitrogen absorption of corn root system, and knockout ZmbHLH99 After knockout, the biomass of corn root system at seedling stage can be obviously increased, the total nitrogen accumulation of plant is increased, and the absorption capacity of root system to nitrate is improved; meanwhile, two years of field test further show that, after knockout of the gene ZmbHLH99 compared with control plant ND101, the corn plant height, biomass and nitrogen accumulation in corn body can be obviously increased, the corn ear is lengthened and thickened, and the yield of corn ear is increased, and after overexpression of the gene ZmbHLH99 the above-mentioned is opposite. The function analysis and field test analysis of the corn transcription factor ZmbHLH99 provide important gene resources and theoretical guidance for breeding new corn varieties with high nitrogen efficiency.

[0107] It should be noted that, when the numerical range is involved in the present application, it should be understood that each numerical range of two endpoints and any numerical value between the two endpoints can be selected, and in order to prevent redundancy, the present application describes the preferred embodiments.

[0108] Although the preferred embodiments of the present application have been described, those skilled in the art can make further changes and modifications to these embodiments once they know the basic creative concept, and these changes and modifications all fall within the scope of all changes and modifications of the present application.

Claims

1. A maize transcription factor for improving nitrogen use efficiency in maize ZmbHLH99 gene characterized in that, The maize transcription factor ZmbHLH99 The nucleotide sequence of the gene is shown as SEQ ID NO 1.

2. The maize transcription factor of claim 1 ZmbHLH99 gene characterized in that, The maize transcription factor ZmbHLH99 The amino acid sequence of the protein of the gene expression is shown in SEQ ID NO 2.

3. The maize transcription factor of claim 1 ZmbHLH99 Use of the gene in increasing ear yield in maize.

4. Use according to claim 3, characterized in that, By enhancing the absorption of nitrogen in corn root system, increasing the accumulation of nitrogen in corn, improving the nitrogen utilization efficiency of corn, making the corn ear length and width, and then improving the yield of corn ear.

5. Use according to claim 3, characterized in that, By improving the plant height and biomass of corn, and then improving the yield of corn ear.

6. Use according to claim 3, characterized in that, By reducing the expression of the maize transcription factor ZmbHLH99 gene to increase ear yield in maize.

7. Use according to claim 6, characterized in that, by knocking out, inhibiting, or silencing the expression of the corn transcription factor ZmbHLH99 to increase corn ear yield.

8. Use according to claim 7, characterized in that, knocking out the corn transcription factor using CRISPR knockout technology ZmbHLH99 gene, thereby obtaining a corn mutant with improved corn ear yield.

9. Use according to claim 8, characterized in that, Site-directed editing of the corn transcription factors using CRISPR / Cas9 gene editing technology ZmbHLH99 target sites of genes; The corn transcription factor ZmbHLH99 The sequence of the target site of the gene is shown as SEQ ID NO.

3.

10. Use according to claim 9, characterized in that, incorporating the target site of the gene into a transgenic vector ZmbHLH99 constructing a recombinant expression vector; transfecting the recombinant expression vector into the corn plant material to be transformed to obtain a corn ear yield-increased gene editing site-specific knockout corn plant.

Images