Gene of rice indica-japonica intersubspecific hybrid sterile locus HS12 and application thereof

Abstract

The invention discloses a gene of a rice indica-japonica intersubspecific hybrid sterile locus HS12 and application thereof, and belongs to the field of plant genetic engineering. The locus is positioned at the tail end of a long arm of a chromosome 12, is positioned between molecular markers Sy55 and Sy8, and comprises four fertility related genes iTx1, iTx2, iAd1 and jAd2. By functional knockout or inhibition of expression of the gene iTx1 and / or iTx2, iAd1 and / or jAd2 are / is transferred, a wide-compatibility rice material can be created, meanwhile, a molecular marker for detecting HS12 is further provided and used for filial generation detection and auxiliary breeding, indica-japonica hybrid sterility can be effectively overcome, and the setting rate of offspring is increased.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering, and particularly relates to a gene for controlling a hybrid sterility locus HS12 between indica and japonica subspecies of rice and application thereof. BACKGROUND

[0002] Rice is the staple food of more than 60% of the population in China, and therefore, improving rice yield is of great significance to the national food security. Utilization of hybrid vigor is an important way to improve rice yield. Indica and japonica are two subspecies of Oryza sativa cultivated in Asia, and indica-japonica hybrid rice has a stronger hybrid vigor than the currently popular indica hybrid rice. Utilization of the indica-japonica hybrid vigor is an important strategy for further improving rice yield. However, there is reproductive isolation between indica and japonica, and the F1 hybrids thereof generally exhibit hybrid sterility, which is a problem to be solved for breeding indica-japonica hybrid rice. Therefore, cloning of the genes for controlling the indica-japonica hybrid sterility and research on the biological functions of the genes can provide theoretical support and technical guidance for breeding indica-japonica hybrid rice.

[0003] The indica-japonica hybrid sterility is controlled by multiple independent loci, and a single locus often causes semi-sterility of the hybrid, and the effects of multiple such loci are superimposed to cause the fertility of the indica-japonica hybrid to decrease exponentially, resulting in almost complete sterility. So far, only a few loci such as S5, Sa and RHS12 / Se / pf12 for controlling the indica-japonica hybrid sterility have been cloned, and the utilization of these loci cannot completely solve the problem of the indica-japonica hybrid sterility. Therefore, it is necessary to further explore new loci and clone genes to provide new genetic targets for overcoming the problem of the indica-japonica hybrid sterility. SUMMARY

[0004] In order to solve the problems in the prior art, the application provides a hybrid sterility locus HS12 between indica and japonica subspecies of rice and four key genes, discloses a “poison-antidote” mechanism, and can solve the problem of hybrid sterility in the offspring of indica-japonica hybrid rice, specifically, pollen (male gamete) or embryo sac (female gamete) abortion occurs.

[0005] In one aspect, the application provides a hybrid sterility locus HS12 between indica and japonica subspecies of rice, which is located at the distal end of the long arm of chromosome 12, is located between molecular markers Sy55 and Sy8, and comprises four fertility-related genes iTx1, iTx2, iAd1 and jAd2.

[0006] The amino acid sequence of the protein encoded by the gene iTx1 is shown as SEQ ID NO. 9, the amino acid sequence of the protein encoded by the gene iTx2 is shown as SEQ ID NO. 10, the amino acid sequence of the protein encoded by the gene iAd1 is shown as SEQ ID NO. 11, and the amino acid sequence of the protein encoded by the gene jAd2 is shown as SEQ ID NO. 12.

[0007] Specifically, the nucleotide sequence of the gene iTx1 is shown as SEQ ID NO. 5, the nucleotide sequence of the gene iTx2 is shown as SEQ ID NO. 6, the nucleotide sequence of the gene iAd1 is shown as SEQ ID NO. 7, and the nucleotide sequence of the gene jAd2 is shown as SEQ ID NO. 8.

[0008] In one aspect, the application provides the use of the indica-japonica subspecies hybrid sterility locus HS12 in overcoming the sterility of indica-japonica subspecies hybrids or the decrease in seed setting rate of the offspring of indica-japonica hybrid rice or in breeding indica-japonica hybrid rice lines with fertility compatibility.

[0009] Specifically, the use comprises the following steps: functionally knocking out or inhibiting the expression of the gene iTx1 and / or the gene iTx2 of the indica-japonica subspecies hybrid sterile rice and / or introducing any one or any two of the following genes: the gene iAd1 and the gene jAd2.

[0010] Specifically, the method for functionally knocking out or inhibiting the expression is gene editing technology, such as CRISPR / Cas9 technology.

[0011] In one aspect, the application also provides a method for preparing a wide compatibility rice material, comprising the following steps:

[0012] (1) functionally destroying or knocking out the gene iTx1 and / or the gene iTx2 in a rice material containing the gene iTx1 and the gene iTx2 to obtain a modified material, and screening the offspring to obtain a wide compatibility rice material;

[0013] or, (2) introducing the gene iAd1 and / or the gene jAd2 into a rice material, and screening and breeding to obtain a wide compatibility rice material;

[0014] or, (3) simultaneously performing the modification of step (2) in the modified material obtained in (1), and screening and breeding to obtain a wide compatibility rice material.

[0015] Specifically, the method for functionally knocking out or inhibiting the expression is gene editing technology, such as CRISPR / Cas9 technology.

[0016] In one aspect, the application utilizes the preparation method in cultivating indica-rice hybrid fertility compatible rice line, the rice material constructed by the method is crossed with japonica line to produce fertile hybrid.

[0017] In another aspect, the application provides a molecular marker for identifying whether there is a hybrid sterility locus HS12 between indica and japonica subspecies of rice in a rice material, the molecular marker is Sy55 and Sy8, the forward primer sequence of the molecular marker Sy55 is shown as SEQ ID NO. 1, the reverse primer sequence is shown as SEQ ID NO. 2, the forward primer sequence of the molecular marker Sy8 is shown as SEQ ID NO. 3, and the reverse primer sequence is shown as SEQ ID NO. 4.

[0018] Specifically, the molecular marker is used for detection of hybrid offspring or molecular marker assisted selection breeding.

[0019] Beneficial technical effects:

[0020] (1) The application first clones the HS12 locus and four key genes iTx1, iTx2, iAd1 and jAd2, fills the research blank of indica-japonica hybrid sterility new site, and provides a new genetic target for breeding;

[0021] (2) The application provides an efficient solution to indica-japonica hybrid sterility, significantly improves the seed setting rate of hybrid offspring through gene editing and transfer technology, and helps to cultivate strong advantage indica-japonica hybrid rice;

[0022] (3) The molecular marker can accurately detect the locus HS12, accelerate the screening of hybrid offspring, improve the breeding efficiency, reduce the cost, and explain the mechanism of “poison-antidote”, which provides a new theoretical basis for rice breeding. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 is the construction and genomic composition of HS12 near-isogenic line NIL12, wherein A is the construction process of NIL12, and B is the genomic composition of NIL12.

[0024] Figure 2This section describes the identification and fine mapping of pollen abortion phenotypes caused by the HS12 locus. A represents the plant typology comparison of KY131, NIL12, and their hybrid F1 (scale bar: 20 cm); B represents pollen grains from I2-KI stained KY131, NIL12, and their hybrid F1, with red arrows indicating aborted pollen; the percentages below indicate pollen fertility (scale bar: 100 micrometers); C represents the gamete transmission rate of F1 after testcrosses with KY131 by both male and female parents; D represents the number of individual plants of each genotype in the F2 population; E represents H... The fine mapping of S12 shows that the region of HS12 has 9 and 10 candidate genes in the japonica and indica rice genomes, respectively; F indicates the sequence differences between japonica and indica rice in the coding regions of the four genes that make up HS12; green and blue bars represent the exons of alleles in japonica and indica rice, respectively; white bars represent the sequences before the start codon and after the stop codon; horizontal lines represent introns; * indicates premature termination, the allele of Ad2 in indica rice terminates prematurely, the alleles of Tx1 and Ad1 in japonica rice terminate prematurely, and Tx2 is completely deleted in japonica rice.

[0025] Figure 3 This describes the mechanism by which HS12 controls pollen fertility in the F1 generation of indica-japonica hybrids. A represents the pollen fertility of three independent knockout families (1#, 2#, and 3#) obtained by knocking out iTx1 in F1 using CRISPR / Cas9 technology (scale bar: 100 micrometers); B represents the segregation ratio of the HS12 genotype in its self-pollinated population after knocking out iTx1 in F1; C represents the pollen fertility of three independent knockout families (1#, 2#, and 3#) obtained by knocking out iTx2 in F1 using CRISPR / Cas9 technology (scale bar: 100 micrometers); D represents the segregation ratio of the HS12 genotype in its self-pollinated population after knocking out iTx2 in F1; and E represents the hemizygous iAd1 transgenic... Changes in pollen fertility in F1 caused by the iAd1 transgene, scale bar: 100 micrometers; F indicates the change in the segregation ratio of the HS12 genotype in the self-pollinated population caused by the hemizygous iAd1 transgene; G indicates that the homozygous iAd1 transgene completely restores the pollen fertility of F1 to normal, scale bar: 100 micrometers; H indicates that the homozygous iAd1 transgene restores the segregation ratio of the HS12 genotype in the self-pollinated population to normal; I indicates the staining status of aborted pollen in F1 with I2-KI; J indicates the staining status after knocking out jAd2 in F1; K indicates the pollen fertility of the jAd2 and iTx1 double mutant; L indicates the pollen fertility of the jAd2 and iTx2 double mutant; red scissors indicate gene knockout, and the numbers below the image indicate pollen fertility rate.

[0026] Figure 4is the HS12 regulation of female fertility and seed set, where A represents the seed set of wild type F1; B represents the seed set of F1 with jAd2 knocked out; C represents the seed set of F1 with both jAd2 and iTx1 knocked out; D represents the seed set of F1 with both jAd2 and iTx2 knocked out; E represents the seed set of F1 with jAd2 knocked out by homozygous iAdl transgene, scale bar: 3 cm, asterisk indicates unseeded floret; F represents Figure 4 A-E genetic materials corresponding to female fertility; G represents the change of segregation ratio of HS12 genotype in the selfed population of F1 with jAd2 knocked out compared to that in the selfed population of wild type F1; H represents the transmission pattern of female and male gametes of F1 with jAd2 knocked out, red cross indicates gamete abortion or absence of individuals with specific genotype, red scissors indicates gene knockout.

[0027] Figure 5 is the HS12 control of female fertility and seed set of NIL12, where A represents the ear of KY131 and NIL12 at maturity, scale bar: 3 cm; B represents the seed set of KY131 and NIL12; C represents the female fertility of KY131 and NIL12.

[0028] Figure 6 is the HS12 regulation of seed set of NIL12 by dosage effect, where A represents the seed level and seed set of NIL12 with iTx1 knocked out; B represents the seed level and seed set of NIL12 with iTx2 knocked out, asterisk indicates unseeded floret, scale bar: 3 cm; C represents the expression level of iAdl in its overexpression genetic material; D represents the effect of overexpression of iAdl on seed set of NIL12; E represents the expression level of iAdl in its overexpression genetic material; F represents the effect of overexpression of jAd2 on seed set of NIL12. DETAILED DESCRIPTION

[0029] The present application will be further described with reference to the following non-limiting Examples. The advantages and features of the present application will become apparent from the descriptions.

[0030] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, where particular ranges of values are given, understand that every intervening value, between the lower and upper limit of that range and any other stated or intervening value in that stated range, is encompassed. The upper and lower limits of these intervening values can independently be included or excluded in the range, and each smaller range that falls within the integer ranges enumerated and any other stated or intervening values are also encompassed. These smaller ranges and other values are not disclosed separately in the specification for the sake of brevity.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as those commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All documents mentioned herein are incorporated by reference to disclose and describe in full the methods and / or materials useful in connection to the documents. In case of conflict between the content of the specification and that of any document incorporated herein by reference, the content of the specification prevails.

[0032] Example 1, Construction and phenotypic identification of HS12 near-isogenic lines

[0033] In this experiment, KY131 (a japonica variety) and 9311 (an indica variety) were used as the recipient parent and the donor parent, respectively, to construct a set of near-isogenic lines (NILs) (Fig. 1A). Figure 1 One of the lines, NIL12, only has the 9311 fragment inserted at the end of the long arm of chromosome 12 (Fig. 1B). Figure 1 The plant morphology of this line is basically the same as KY131 (Fig. 1C). Figure 2 The pollen fertility of NIL12 was 96.1 ± 1.4%, and that of KY131 was 94.5 ± 3.6% as determined by I2-KI staining (Fig. 1D). Both NIL12 and KY131 have completely normal pollen fertility, but their hybrid F1 showed pollen semi-sterility, with pollen fertility of only 46.3 ± 3.7% (Fig. 1E). About half of the pollen had insufficient starch accumulation and was significantly lighter in color when stained with I2-KI (Fig. 1F). Figure 2 This phenomenon indicates that there is a locus controlling pollen semi-sterility in indica / japonica hybrids in the region covered by the indica chromosome fragment in NIL12. Since it is located at the end of the long arm of chromosome 12, it is named HS12 (Hybrid sterility locus on chromosome 12).

[0034] Example 2, Genetic analysis and fine mapping of the HS12 locus

[0035] To determine the type of pollen that aborts in the hybrid F1 of NIL12 / KY131 (i.e., whether the aborted pollen inherits the indica allele or the japonica allele), we conducted a gamete transmission rate analysis of F1, i.e., crossing F1 (genotype: indica / japonica heterozygous, i / j) as the male parent with KY131 (genotype: japonica homozygous, j / j), and then detecting the genotype of the resulting hybrid at the HS12 locus. The results showed that 98.5% of the individuals carried the heterozygous genotype (i / j), and only 1.5% of the individuals carried the japonica homozygous genotype (j / j) (Fig. 2). Figure 2As shown in Figure C), this indicates that 98.5% of the pollen from F1 inherited the indica allele at the HS12 locus, while only 1.5% inherited the japonica allele. This suggests that aborted pollen in F1 inherited the japonica allele at the HS12 locus. Further analysis of the genotype segregation ratio of HS12 in the F2 population showed that homozygous japonica genotypes (j / j) were extremely rare, while the number of heterozygous genotypes (i / j) and homozygous indica genotypes (i / i) were roughly equal, with the ratio of each genotype deviating significantly from 1:2:1. Figure 2 As shown in Figure D), this further corroborates that the aborted pollen in F1 inherited the japonica type allele. In addition, we also observed that the transmission rate of japonica type female gametes in F1 was 37.1%, which was lower than the transmission rate of indica type female gametes at 62.9%, suggesting that HS12 may also affect the fertility of some japonica type female gametes.

[0036] To locate the HS12 site, an F2 population of KY131 / NIL12 was constructed, and 240 individuals from this population were used to initially locate HS12 between molecular markers Sy26 and Sy29. Based on this, 2600 F2 individuals were used for further fine mapping of HS12, ultimately locating it between molecular markers Sy55 and Sy8. The sequence of molecular marker Sy55 is as follows:

[0037] Sy55-F: CGGTCAAACCTGTTTAGAAAAGTC (SEQ ID NO. 1);

[0038] Sy55-R: CTTTAGGGGCTGTTTGGTTCT (SEQ ID NO.2),

[0039] The sequence of the molecular marker Sy8 is as follows:

[0040] Sy8-F: ACGTCCATCCATTCTGGGTT (SEQ ID NO.3);

[0041] Sy8-R: GCTAGCTTCTTCCATCGTGC (SEQ ID NO. 4).

[0042] Locational interval sequence analysis showed that the physical length of japonica rice between Sy55 and Sy8 was 83.1 kb, while the corresponding physical length of indica rice was 105 kb due to two larger fragment insertions. Figure 2 (As shown in E). Besides the three transposons, japonica and indica rice contain 9 and 10 candidate genes, respectively, within this interval. Among them, the indica allele of candidate gene 1 frames shift and terminates prematurely relative to its japonica allele; the japonica alleles of candidate genes 4 and 7 frames shift and terminate prematurely relative to their indica alleles; and candidate gene 8 is unique to indica rice and is completely absent in japonica rice.Figure 2 The nucleotide sequence of the indica allele of candidate gene 4 (renamed iTx1) is shown as SEQ ID NO. 5, the encoded protein sequence is shown as SEQ ID NO. 9, the nucleotide sequence of candidate gene 8 (renamed iTx2) is shown as SEQ ID NO. 6, the encoded protein sequence is shown as SEQ ID NO. 10, the nucleotide sequence of the indica allele of candidate gene 7 (renamed iAd1) is shown as SEQ ID NO. 7, the encoded protein sequence is shown as SEQ ID NO. 11, and the nucleotide sequence of the japonica allele of candidate gene 1 (renamed jAd2) is shown as SEQ ID NO. 8, the encoded protein sequence is shown as SEQ ID NO. 12.

[0043] Example 3, gene cloning of HS12 locus

[0044] Two gene editing primers, Primer 1 and Primer 2 (Primer 1: TCACTCTACAACAATATGTG (SEQ ID NO. 13); Primer 2: CGAAAGGCAAGAGTTGGAAT (SEQ ID NO. 14)) targeting the coding region of iTx1 were developed and recombined into a CRISPR / Cas9 vector using INFUSION recombinase. After transforming the sequenced correct vector into Agrobacterium, it was introduced into F1 by Agrobacterium-mediated transformation. Sequencing analysis of iTx1 in the transformed plants identified three independent lines (denoted as F1-itx1 KO ), of which F1-itx1 KO -1# and F1-itx1 KO -2# had 1 and 7 base deletions at Primer 1, and F1-itx1 KO -3# had 2 base deletions at Primer 2. All three lines had frameshift and premature termination mutations in iTx1. Pollen fertility investigation showed that the pollen fertility of the three lines was restored to normal levels (F1-itx1 Figure 3 The genotype segregation ratio was detected using the molecular marker Sy8 which is tightly linked to the HS12 locus, and the results showed that the genotype segregation ratio of the HS12 locus in the selfed populations of the three lines was restored to 1:2:1 (F1-itx1 Figure 3 B). These results indicate that iTx1 plays a role in inducing pollen abortion, and knocking out the gene can completely eliminate the pollen abortion phenomenon caused by the HS12 locus.

[0045] Using the same strategy, two gene-editing primers, Primer3 and Primer4, targeting iTx2 were also developed (Primer3: AGGGGGAAAGAGTAAGAACC (SEQ ID NO.15); Primer4: GAGGATTTGGTTTTGTAAAG (SEQ ID NO.16). Using CRISPR / Cas9 technology and Agrobacterium-mediated transgenic strains, three independent knockout lines (denoted as F1-itx2) were created. KO ), of which F1-itx2 KO The -1# strain had a two-base deletion at Primer3, while the F1-itx2 strain... KO -2# and F1-itx2 KO The -3# line showed a one-base deletion and insertion at Primer4, respectively. All three lines exhibited frameshift and premature termination mutations in iTx2. We found that knocking out iTx2 also restored pollen fertility in F1. Figure 3 As shown in C), it can also restore the normal 1:2:1 genotype segregation ratio at the HS12 locus (as shown in C). Figure 3 As shown in Figure D), this indicates that iTx2 also plays a role in inducing pollen abortion. The above experiments show that iTx1 and iTx2 work together to induce pollen abortion, and knocking out either of them can eliminate the pollen abortion phenomenon caused by HS12 in indica-japonica crosses.

[0046] Furthermore, we amplified the iAd1 genome fragment from indica rice 9311 using primers Primer5 (CCGGCGCGCCAAGCTTCCGCAAGGGAAGAAATCAA (SEQ ID NO. 17)) and Primer6 (GAATTCCCGGGGATCCTCTGCGTTGCGTTACGACTG (SEQ ID NO. 18)). This fragment contains a 2.5 kb iAd1 genome sequence, along with 2.7 kb upstream of the start codon and 1.2 kb downstream of the stop codon. Using the INFUSION recombinase, this fragment was recombined between the HindIII and BamHI restriction sites of the pCUBi1390 vector, thus constructing the complementary vector of iAd1 (denoted as pCUBi1390-iAd1). After transferring the vector with a completely correct sequence into the F1 generation using Agrobacterium-mediated transgenic technology, we screened and obtained three independent transgenic lines containing a single copy of the hemizygous iAd1 transgene (denoted as F1-iAd1(+ / -), where + indicates transgene positive, - indicates transgene negative, and + / - indicates the transgene is hemizygous). Pollen fertility studies showed that they all exhibited approximately 75% pollen fertility.Figure 3 As shown in Figure E), the segregation of HS12 loci genotypes in their self-crossed populations conformed to a ratio of 1:3:2. Figure 3 (As shown in F1). Furthermore, we screened the self-pollinated progeny of these three lines for plants carrying the homozygous iAd1 transgene and the indica-japonica heterozygous HS12 (equivalent to F1) (denoted as F1-iAd1(+ / +), where + / + indicates the transgene is homozygous). These plants exhibited completely normal pollen fertility. Figure 3 As shown in G), the segregation ratio of the HS12 genotype in the self-pollinated populations of these individual plants also completely recovered to 1:2:1. Figure 3 (As shown in H). These results indicate that iAd1 protects pollen through its gametophyte mechanism, and homozygous iAd1 transgenes can completely restore pollen fertility in F1.

[0047] The jAd2 gene from japonica rice is homologous to the iAd1 gene mentioned above. To analyze whether jAd2 also participates in the HS12 system, a gene editing primer Primer7 (Primer7: CTGCTGGAGCGACGACGACG (SEQ ID NO.19)) targeting jAd2 was designed. Using CRISPR / Cas9 technology, jAd2 was knocked out in F1 cells, resulting in two knockout lines (denoted as F1-jad2) where a single base was inserted at Primer7, leading to frameshift and premature termination. KO Pollen fertility studies showed that knocking out jAd2 in F1 did not change the proportion of pollen abortion, but it exacerbated the degree of pollen abortion. Aborted pollen in F1 stained lighter with I2-KI, indicating insufficient starch accumulation in aborted pollen. After knocking out jAd2 in F1, the previously lightly stained aborted pollen became almost completely unstainable. Figure 3 (As shown in I and J). To analyze whether jAd2 is an essential gene for pollen development or another "antidote" gene for the HS12 system, jAd2 and either iTx1 or iTx2 were simultaneously knocked out in F1 (referred to as F1-jad2, respectively). KO ;itx1 KO and F1-jad2 KO ;itx2 KO The results showed that double mutants of jAd2 and iTx1 or iTx2 all had normal pollen fertility. Figure 4 (As shown in K and L), this indicates that jAd2 is another "antidote" gene in the HS12 system, rather than an essential gene for pollen development. It is important to note that pollen that inherits jAd2 will still fail to produce offspring, but knocking out this gene will exacerbate the failure of these pollen. Therefore, jAd2 only provides a certain degree of protection for pollen; it is a weakly functional "antidote" gene.

[0048] Example 4, HS12 regulates female gamete fertility of F1

[0049] It was also observed during the implementation that, compared with F1, F1-jad2 KO significantly decreased from 80.7 ± 4.7% to 32.3 ± 4.5% (A and B in Figure 4 Figure 2). Since the pollen is excessive for each floret, pollen semi-sterility does not significantly affect the seed setting rate, while there is only one female gamete in each floret, and the abortion of which directly affects the seed setting rate, so it is speculated that the decrease in the seed setting rate of F1-jad2 KO may be due to female gamete abortion. To verify this guess, the female gamete fertility of F1-jad2 KO , F1-jad2 KO (knock out jAd2 in F1), F1-jad2 KO ; iTx1 KO (knock out jAd2 and iTx1 at the same time), F1-jad2 KO ; iTx2 KO (knock out jAd2 and iTx12 at the same time), F1-jad2 KO ; iAd1 KO (knock out jAd2 and iAd1 at the same time) was investigated, and the results were as expected. F1-jad2 KO female gametes showed obvious semi-sterility (F in Figure 4 Figure 2). In addition, it was found that the HS12 genotype showed a more extreme proportion in the selfed population of F1-jad2 KO : only indica homozygous genotypes, and no homozygous japonica and heterozygous genotypes (G in Figure 4 Figure 2), which indicates that knocking out jAd2 in F1 causes selective abortion of female gametes that have inherited japonica alleles (H in Figure 4 Figure 2), so we speculate that jAd2 may also have a protective effect on female gametes. To prove this guess, we investigated the seed setting rate and female gamete fertility of two double mutants F1-jad2 KO ; itx1 KO and F1-jad2 KO ; itx2 KO , and the results showed that they all showed normal female gamete fertility and seed setting rate (C, D and F in Figure 4 Figure 2), which indicates that the female gamete abortion caused by knocking out jAd2 is caused by iTx1 and iTx2, that is, iTx1 and iTx2 can also induce female gamete abortion in F1, and jAd2 can protect female gametes that have inherited japonica alleles in F1.

[0050] Since the female gametes carrying the japonica allele are protected by jAd2, it is necessary to further study which gene protects the female gametes carrying indica alleles. Since the allele of jAd2 in indica rice is prematurely terminated, it may not have the function of protecting female gametes, so it is speculated that female gametes carrying indica alleles may be protected by iAd1. In order to verify this guess, the complementary vector pCUBi1390-iAd1 of iAd1 constructed in Example 3 is transgenic to F1-jad2 KO , and transgenic plants with homozygous iAd1 (indicated as F1-jad2 KO ; iAd1 (+ / +) ) are obtained by screening, and fertility investigation shows that iAd1 transgene restores the seed setting rate and female gamete fertility of F1-jad2 KO to normal level (as shown in E and F of Figure 5 ), which shows that iAd1 indeed has the function of protecting female gametes.

[0051] Example 5, HS12 regulates the seed setting rate and female gamete fertility of homozygous genotype individuals

[0052] Unlike other hybrid sterile sites that have been cloned, HS12 also causes fertility decline when in a homozygous state, which is manifested as about 60% female gamete sterility in indica rice homozygous genotype in japonica rice genome background (as shown in C of Figure 5 ), resulting in a seed setting rate of about 40% (as shown in B of Figure 5 ), and the ear phenotype of KY131 and NIL12 (HS12 in indica homozygous state) after maturation is shown in A of Figure 6 . In order to explain this phenomenon, first, in the self-crossing population of F1-itx1 KO and F1-itx2 KO created in the previous work, strains with HS12 in indica homozygous state (i.e. NIL12 genotype) but with homozygous knockout of iTx1 and iTx2 (indicated as NIL12-itx1 KO and NIL12-itx2 KO ) are obtained by screening, and fertility investigation shows that NIL-itx1 KO and NIL-itx2 KO both have normal seed setting rate (as shown in A and B of Figure 6 ), which shows that the decrease in seed setting rate caused by female gamete abortion of NIL12 is caused by the "poison" genes iTx1 and iTx2.

[0053] All female gametes from NIL12 contain the "antidote" gene iAd1 (because iAd1 is homozygous in NIL12), but the "poison" gene still causes 60% of female gametes to abort, a stark contrast to the normal fertility of F1 female gametes containing iAd1. Considering that the two poison genes iTx1 and iTx2 are heterozygous in F1 but homozygous in NIL12, it is hypothesized that the homozygous iTx1 and iTx2 in NIL12 may produce more "toxicity," with the excessive "poison" dose exceeding the protective effect of the "antidote" gene iAd1 on female gametes, thus leading to the abortion of most female gametes. To verify this hypothesis, it was investigated whether reducing the dose of the "poison" gene in NIL12 would lead to an increase in its fruit set rate. Therefore, NIL12 was compared with NIL12-itx1... KO and NIL12-itx2 KO Heterozygous knockout lines of iTx1 and iTx2 were constructed through hybridization. Figure 6 The Chinese representation is NIL12-iTx1 / itx1 KO and NIL12-iTx2 / itx2 KO As expected, the seed setting rates of both heterozygous knockout lines were significantly higher than those of NIL12, but significantly lower than those of the homozygous knockout line NIL-iTx1. KO and NIL-iTx2 KO ( Figure 6 (As shown in A and B).

[0054] Lowering the "poison" dosage can increase the fruit set rate. Could increasing the "antidote" dosage also increase the fruit set rate? To investigate this, primers were used to amplify the genomic fragments of iAd1 and jAd2, respectively. The amplified iAd1 fragment contained a 2.5kb iAd1 genomic sequence and a 1.2kb sequence downstream of the stop codon, while the amplified jAd2 fragment contained a 1.4kb iAd2 genomic sequence and a 1.8kb sequence downstream of the stop codon. Using the INFUSION recombinase, these two fragments were extended between the KpnI and BamHI restriction sites of the pCUBi1390 vector, and sequencing yielded correctly sequenced overexpression vectors of iAd1 and jAd2. Figure 6 The Chinese version is represented as pCUBi1390-iAd1 OE and pCUBi1390- jAd2 OE Using Agrobacterium-mediated transgenic technology, the two vectors were transgenic into NIL12, resulting in three independent overexpression lines. As expected, overexpression of either iAd1 or jAd2 in NIL12 significantly improved seed setting rate. ​ (C and D in the middle).

[0055] The above described embodiments are only to illustrate the preferred modes of the present application, and are not intended to limit the scope of the present application. Any modification and improvement made by those skilled in the art to the technical solutions of the present application without departing from the design spirit of the present application shall fall within the protection scope of the present application as defined by the claims.

Claims

1. A rice indica-japonica subspecies inter-subspecific hybrid sterile locus HS12, characterized in that, comprising four fertility-related genes iTx1, iTx2, iAd1 and jAd2; wherein the amino acid sequence of the protein encoded by the gene iTx1 is as shown in SEQ ID NO. 9, the amino acid sequence of the protein encoded by the gene iTx2 is as shown in SEQ ID NO. 10, the amino acid sequence of the protein encoded by the gene iAd1 is as shown in SEQ ID NO. 11, and the amino acid sequence of the protein encoded by the gene jAd2 is as shown in SEQ ID NO.

12.

2. The indica-japonica subspecies hybrid male sterile locus HS12 of claim 1, wherein, The nucleotide sequence of the gene iTx1 is as shown in SEQ ID NO. 5, the nucleotide sequence of the gene iTx2 is as shown in SEQ ID NO. 6, the nucleotide sequence of the gene iAd1 is as shown in SEQ ID NO. 7, and the nucleotide sequence of the gene jAd2 is as shown in SEQ ID NO.

8.

3. The use of the indica-japonica subspecies hybrid male sterile locus HS12 of any one of claims 1-2 in overcoming the sterility of indica-japonica subspecies hybrid rice or in increasing the seed setting rate of indica-japonica subspecies hybrid rice or in breeding a fertility-compatible rice line.

4. Use according to claim 3, characterized in that, comprising the following steps: functionally knocking out or inhibiting the expression of the gene iTx1 and / or the gene iTx2 of the indica-japonica subspecies hybrid male sterile rice, and / or introducing either or both of the genes iAd1 and jAd2.

5. Use according to claim 4, characterized in that, The method for functionally knocking out or inhibiting the expression is gene editing technology.

6. A method for preparing a broad-affinity rice material, characterized by, comprising the following steps: (1) functionally destroying or knocking out the gene iTx1 and / or the gene iTx2 in a rice material containing the gene iTx1 and the gene iTx2 to obtain a modified material, and screening the offspring to obtain a wide-compatible rice material; or, (2) introducing the gene iAd1 and / or the gene jAd2 into a rice material, and screening and breeding to obtain a wide-compatible rice material; or, (3) simultaneously performing the modification of step (2) in the modified material obtained in (1), and screening and breeding to obtain a wide-compatible rice material.

7. The production method according to claim 6, wherein The method for functionally knocking out or inhibiting the expression is gene editing technology.

8. Use of the method for producing according to any one of claims 6 to 7 in breeding a fertile indica-rice hybridity compatible rice line, characterized in that, The rice material constructed by the method of any one of claims 6-7 is crossed with a japonica rice line to produce a fertile hybrid.

9. A molecular marker for identifying the presence or absence of the indica-japonica subspecies hybrid sterility locus HS12 in a rice material, characterized in that, The molecular markers are Sy55 and Sy8, the forward primer sequence of the molecular marker Sy55 is as shown in SEQ ID NO. 1, the reverse primer sequence is as shown in SEQ ID NO. 2, the forward primer sequence of the molecular marker Sy8 is as shown in SEQ ID NO. 3, and the reverse primer sequence is as shown in SEQ ID NO.

4.

10. Use of a molecular marker according to claim 9, characterized in that, The molecular markers are used for detection of hybrid offspring or for marker-assisted selection breeding.

Images