MsLEA3 gene and application thereof

By editing the MsLEA3 gene of alfalfa using the CRISPR/Cas9 gene editing system, overexpression and gene-edited transgenic lines were constructed, solving the problem of insufficient salt tolerance in alfalfa, significantly improving salt tolerance, and promoting the application of alfalfa in saline-alkali land.

CN120905255AActive Publication Date: 2025-11-07INNER MONGOLIA UNIVERSITY

Patent Information

Application Number
CN202511453565.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-13
Publication Date
2025-11-07
Estimated Expiration
2045-10-13

AI Technical Summary

Technical Problem

Current technologies lack effective means to improve the salt tolerance of alfalfa, which limits its application in abiotic stress environments such as saline-alkali land.

Method used

Gene editing of the MsLEA3 gene in alfalfa was performed using the CRISPR/Cas9 genome editing system to construct overexpression and gene-edited transgenic lines, thereby increasing the expression level and activity of the MsLEA3 gene and enhancing the plant's salt tolerance.

Benefits of technology

This significantly improved the salt tolerance of alfalfa, leading to the development of new varieties with high salt resistance, and providing a theoretical basis for improving the application of alfalfa in production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905255A_ABST
    Figure CN120905255A_ABST
Patent Text Reader

Abstract

The invention provides an MsLEA3 gene and application thereof, and belongs to the technical field of plant genetic engineering. According to the invention, the alfalfa MsLEA3 gene is subjected to overexpression or gene editing is carried out on the MsLEA3 gene in alfalfa through a CRISPR / Cas9 system, so that an overexpression transgenic line of the alfalfa MsLEA3 gene or a gene editing transgenic line aiming at the alfalfa MsLEA3 gene is obtained. The salt tolerance of an overexpressed or gene-edited medicago sativa transgenic line of the MsLEA3 gene is remarkably improved, the MsLEA3 gene can be used for cultivating medicago sativa varieties with high salt resistance, a new theoretical basis and candidate genes are provided for cultivating new varieties of high-resistance leguminous forage, and the application of medicago sativa in production is greatly promoted.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a... MsLEA3 Genes and their applications. Background Technology

[0002] alfalfa ( Medicago sativa Alfalfa (L.) is one of the most important perennial leguminous forage crops, widely cultivated worldwide and hailed as the "King of Forages" and the "Queen of Feeds." In my country, alfalfa cultivation is mainly concentrated in the Northeast, North, and Northwest regions, which are highly susceptible to abiotic stresses such as drought, salinity, and cold, severely restricting the yield and quality of alfalfa. During evolution, plants have developed complex regulatory networks to cope with various abiotic stresses. Therefore, a deep understanding of the molecular mechanisms of alfalfa's stress response and the discovery of important regulatory genes are key research directions for the genetic improvement of alfalfa.

[0003] Late embryogenesis abundant proteins (LEA) are important stress-response proteins, functioning as protective proteins against dehydration under stress conditions. LEA proteins are highly hydrophilic and disordered, which contributes to their defensive function. High hydrophilicity allows LEA proteins to help plants survive by reducing water loss during dehydration, while their disordered nature enables them to form amphiphilic α-helical structures to cope with adverse conditions. Based on their conserved motifs, LEA proteins are divided into seven groups, with groups 1, 2, and 3 considered the major LEA groups, encompassing most members of the LEA protein family. Group 3 proteins contain typical disordered and α-helical structures and are closely related to plant tolerance to abiotic stresses. For example, MfLEA3 is involved in protecting catalase (CAT) activity and confers this protection on alfalfa (…). Medicago falcata Tolerance to various abiotic stresses.

[0004] Currently, there is a lack of technology to improve new varieties of alfalfa. If the salt tolerance of alfalfa can be improved through molecular genetics and gene editing, it will greatly promote the application of alfalfa in production and has very important practical significance for molecular breeding research of forage grasses. Summary of the Invention

[0005] The purpose of this invention is to provide a MsLEA3 Genes that regulate alfalfa MsLEA3 Genes can enhance the salt tolerance of alfalfa, which can be used to breed highly salt-tolerant alfalfa varieties, greatly promoting the application of alfalfa in production.

[0006] To achieve the above objectives, the present invention provides a method for regulating the salt tolerance of alfalfa. MsLEA3 Genes, the ones mentioned MsLEA3The polynucleotide sequence of the gene is shown as SEQ ID NO. 3.

[0007] The application also provides an MsLEA3 protein for regulating salt tolerance of Medicago sativa, wherein the amino acid sequence of the MsLEA3 protein is shown as SEQ ID NO. 4.

[0008] The application also provides a polynucleotide mutant for regulating salt tolerance of Medicago sativa, wherein a preparation method of the polynucleotide mutant comprises: performing gene editing on the MsLEA3 gene by using a gene editing binary vector of a CRISPR / Cas9 genome editing system, wherein the gene editing binary vector expresses sgRNA, the sgRNA targets a target point 1 and a target point 2 on the MsLEA3 gene, and a polynucleotide mutant is obtained. The sequence of the target point 1 is shown as SEQ ID No. 7. The sequence of the target point 2 is shown as SEQ ID No. 8.

[0009] Preferably, the gene editing binary vector comprises p a 6401 vector and p a 5CBC vector.

[0010] The application also provides a biological material containing the MsLEA3 gene, wherein the biological material comprises one of an expression cassette, a recombinant vector or a recombinant microorganism.

[0011] The application also provides the MsLEA3 gene, the MsLEA3 protein, the polynucleotide mutant or the biological material in the application.

[0012] Preferably, the method for improving salt tolerance of plants is to improve the expression amount and / or activity of the gene shown as SEQ ID NO. 3, or to introduce the gene editing binary vector into Medicago sativa to perform gene editing on the MsLEA3 gene. MsLEA3

[0013] The application also provides the MsLEA3 gene, the MsLEA3 protein, the polynucleotide mutant or the biological material in the application.

[0014] Preferably, the plant comprises a dicotyledonous plant.

[0015] The application also provides a method for improving salt tolerance of Medicago sativa, wherein the method comprises introducing the gene editing binary vector into Medicago sativa, or overexpressing the MsLEA3 gene in Medicago sativa.​

[0016] Compared with the prior art, the present invention has the following beneficial effects: This invention provides MsLEA3 Genes, the ones mentioned MsLEA3 The gene comes from alfalfa, and is expressed through overexpression of alfalfa. MsLEA3 Genes or effects on alfalfa MsLEA3 Gene editing was performed to obtain alfalfa. MsLEA3 Gene overexpression transgenic lines or targeting alfalfa MsLEA3 Gene-edited transgenic lines. Through salt tolerance experiments on the obtained transgenic lines, it was found that the salt tolerance of overexpressed or gene-edited alfalfa transgenic lines was significantly improved. These lines can be used to breed alfalfa varieties with high salt tolerance, providing a new theoretical basis and candidate genes for breeding new leguminous forage varieties with high salt resistance, and greatly promoting the application of alfalfa in production. Attached Figure Description

[0017] Figure 1 In Example 1 MsLea3 The results of the phylogenetic tree analysis.

[0018] Figure 2 In Example 2 MsLea3 The results of gene expression pattern analysis in alfalfa, where A represents... MsLea3 The relative expression levels of the gene in the roots, stems, leaves, and flowers of alfalfa 'Zhongmu 1' are given, with B representing the expression level of the gene in alfalfa 'Zhongmu 1' under NaCl stress. MsLea3 The relative expression level of genes, C being the expression level of alfalfa 'Zhongmu No. 1' plants under 0℃ low temperature stress. MsLea3 The relative expression level of the gene, D represents the expression level of alfalfa 'Zhongmu 1' under mannitol stress. MsLea3 The relative expression level of the gene, E being the expression level of alfalfa 'Zhongmu 1' plants treated with SA (salicylic acid). MsLea3 The relative expression levels of genes, F represents the expression levels of alfalfa 'Zhongmu 1' plants under ABA (abscisic acid) treatment. MsLea3 The relative expression level of genes.

[0019] Figure 3 alfalfa in Example 3 MsLea3 Results of gene-edited transgenic lines; where A is alfalfa. MsLea3 The results of positive seedling verification of gene-edited transgenic lines are shown, where M represents a 1000bp DNA marker, and 26, 25, 24, 23, 22, 21, 20, 19, 17, 13, and 1 represent alfalfa, respectively. MsLea3The number of gene editing transgenic lines, - represents the negative control of WT (wild type alfalfa 'Zhongmo No. 1' plant); B is alfalfa MsLea3 The sequencing results of the target points of the gene editing transgenic lines.

[0020] Figure 4 The number of gene editing transgenic lines, - represents the negative control of WT (wild type alfalfa 'Zhongmo No. 1' plant); B is alfalfa MsLea3 The positive seedling verification results of the gene overexpression transgenic lines, wherein M represents 1000bp DNA Marker, and 8, 10, 11, 12, 13, 15, 16, 19, 20 represent alfalfa with numbers 8, 10, 11, 12, 13, 15, 16, 19, 20 respectively MsLea3 The positive seedling verification results of the gene overexpression transgenic lines, CK- (ddH2O) represents the negative control amplified with water as the template, and CK- represents the negative control amplified with the DNA of WT (wild type alfalfa 'Zhongmo No. 1' plant) as the template.

[0021] Figure 5 The number of gene editing transgenic lines, - represents the negative control of WT (wild type alfalfa 'Zhongmo No. 1' plant); B is alfalfa MsLea3 The quantitative results of the gene overexpression lines, wherein ck represents the quantitative results of WT (wild type alfalfa 'Zhongmo No. 1' plant), and 1~21 represent the quantitative results of the positive plants of the gene editing lines with numbers 1~21 respectively.

[0022] Figure 6 The number of gene editing transgenic lines, - represents the negative control of WT (wild type alfalfa 'Zhongmo No. 1' plant); B is alfalfa MsLea3 The number of gene editing transgenic lines, - represents the negative control of WT (wild type alfalfa 'Zhongmo No. 1' plant); B is alfalfa MsLea3 The physiological and biochemical index detection results of the gene overexpression lines before and after 250mM NaCl stress; wherein A is the NBT and DAB staining results before and after 250mM NaCl stress; B is the survival rate result after 250mM NaCl stress; C is the superoxide dismutase (SOD) activity detection result before and after 250mM NaCl stress; D is the catalase (CAT) activity detection result before and after 250mM NaCl stress; E is the peroxidase (POD) activity detection result before and after 250mM NaCl stress; F is the conductivity detection result before and after 250mM NaCl stress; G is the proline (Pro) content detection result before and after 250mM NaCl stress.

[0023] Figure 7 The number of gene editing transgenic lines, - represents the negative control of WT (wild type alfalfa 'Zhongmo No. 1' plant); B is alfalfa MsLea3 The number of gene editing transgenic lines, - represents the negative control of WT (wild type alfalfa 'Zhongmo No. 1' plant); B is alfalfa MsLea3 The phenotype diagram of the gene overexpression lines after 250mM NaCl stress, wherein WT is the wild type alfalfa 'Zhongmo No. 1' plant, Ed is alfalfa MsLea3 The number of gene editing transgenic lines, - represents the negative control of WT (wild type alfalfa 'Zhongmo No. 1' plant); B is alfalfaMsLea3 Gene overexpression lines. Detailed Implementation

[0024] This invention provides a method for regulating the salt tolerance of alfalfa. MsLEA3 Genes, the ones mentioned MsLEA3 The polynucleotide sequence of the gene is shown in SEQ ID NO.3.

[0025] In this invention, the MsLea3 The nucleotide sequence (579 bp) of the gene is (SEQ ID NO.3). MsLea3 The gene is derived from alfalfa variety Zhongmu 1.

[0026] The present invention also provides a MsLEA3 protein for regulating salt tolerance in alfalfa, the amino acid sequence of which is shown in SEQ ID NO.4.

[0027] In the present application, the amino acid sequence (192AA) of the MsLEA3 protein is MAATMLTSNTLFQTSNSFPNVPSLTLPKPSRVFLASNWRNASEGTKNTSLSWAYTSSTKTRRYADGTAGKAGETVNAGIDDIKQFGQDADEKTKDAASSIADKAKENTDKTVEAVGSAGDKAKDYAFDANDKTKEAIGSATDKAKEGFEAATKNTQEAAGSATEALKNAGDQAKEAVEGALDAAKDAVAGKE (SEQ ID NO. 4).

[0028] The present application relates to a polynucleotide mutant for regulating salt tolerance of Medicago sativa, and a preparation method thereof. MsLEA3 The gene is derived from chromosome 2 Chr2 of Medicago sativa 'Zhongmoyi No. 1'.

[0029] The present application also provides a polynucleotide mutant for regulating salt tolerance of Medicago sativa, and a preparation method thereof. MsLEA3 The preparation method comprises the following steps: performing gene editing on the gene by using a gene editing binary vector of a CRISPR / Cas9 genome editing system, wherein the gene editing binary vector expresses sgRNA, and the sgRNA targets target point 1 and target point 2 on the gene. MsLEA3 The sequence of the target point 1 is shown as SEQ ID No. 7, and the sequence of the target point 2 is shown as SEQ ID No. 8.

[0030] As an optional implementation, the CRISPR / Cas9 genome editing system comprises an expression vector, and the expression vector comprises a p6401 vector and a p5CBC vector. p 6401 vector and p 5CBC vector. The preparation method of the polynucleotide mutant comprises the following steps: obtaining a p5CBC-DT1T2 fragment with the target point 1 and the target point 2 by bridge PCR amplification by using a p5CBC empty plasmid and primers SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 12 and SEQ ID NO. 11 used for constructing the editing vector; MsLea3 using a Golden Gate reaction to perform enzyme cutting on the p5CBC-DT1T2 fragment with the target point 1 and the target point 2 and the p6401 vector by using a restriction enzyme Bsa I, and performing connection by using a T4 DNA ligase, so as to form the gene editing binary vector p5CBC-p6401- MsLea3 ; the gene editing binary vector p5CBC-p6401- MsLea3 expresses sgRNA targeting the gene. MsLea3 MsLea3 ​The two sgRNAs of the gene, sgRNA1 (targeting target 1) and sgRNA2 (targeting target 2), are edited. MsLEA3 Targets 1 and 2 on the gene were used to obtain polynucleotide mutants.

[0031] This invention establishes a CRISPR / Cas9 genome editing system based on alfalfa (Wang Tao et al., patent application number 202110884895.X), and designs and constructs a system targeting... MsLEA3 Gene editing vectors were used to transform the alfalfa variety 'Zhongmu 1' using Agrobacterium-mediated transformation, achieving the desired genetic modification. MsLea3 Editing the target sites in the gene significantly improved the salt tolerance of gene-edited alfalfa.

[0032] The present invention also provides a product containing the aforementioned MsLEA3 Gene-derived biological materials, wherein the biological materials include one of the following: expression cassette, recombinant vector, or recombinant microorganism.

[0033] The present invention also provides the above. MsLEA3 The application of the gene, the MsLEA3 protein, the polynucleotide mutant, or the biomaterial in improving plant salt tolerance.

[0034] In this invention, the method of improving plant salt tolerance is to improve the salt tolerance shown in SEQ ID NO.3. MsLEA3 Gene expression levels and / or activity, or the introduction of the gene-editing binary vector into alfalfa pairs. MsLEA3 Gene editing is performed. In this invention, the aforementioned... MsLEA3 Gene expression levels and / or activity are preferably measured using an overexpression method. During the process... MsLEA3 For gene overexpression, the preferred vector is pCAM1307; BamH I and Xba I. Double enzyme digestion was used to ligate the pCAM1307 vector and the target fragment. The overexpression lines showed relatively high survival rates and exhibited some salt tolerance.

[0035] The present invention also provides the above. MsLEA3 The use of the gene, the MsLEA3 protein, the polynucleotide mutant, or the biological material in the cultivation of salt-tolerant plants.

[0036] In this invention, the plant is preferably a dicotyledonous plant, and the dicotyledonous plant is preferably alfalfa. As an optional embodiment, the alfalfa variety is 'Zhongmu No. 1'.

[0037] The present invention also provides a method for improving the salt tolerance of alfalfa, the method comprising introducing the gene-editing binary vector into alfalfa, or overexpressing the gene-editing binary vector in alfalfa.MsLEA3 gene.

[0038] The present application constructs two different alfalfa transgenic lines based on MsLea3 gene, including an alfalfa transgenic line overexpressing MsLea3 gene and a gene-edited alfalfa transgenic line of MsLea3 gene, which MsLea3 gene produces a frameshift mutation in the gene-edited alfalfa transgenic line, and the MsLea3 gene does not function in the gene-edited line. The alfalfa transgenic line overexpressing MsLea3 gene and the gene-edited alfalfa transgenic line of MsLea3 gene constructed by the present application are subjected to salt tolerance experiments, and it is found that MsLea3 gene-edited line and the overexpression line have a higher survival rate after salt stress compared with wild-type alfalfa, MsLea3 gene-edited line and MsLea3 gene overexpression line have a higher survival rate after stress, MsLea3 gene overexpression line has a survival rate of 83% after salt stress, MsLea3 gene-edited line has a survival rate of 86% after salt stress, and the control wild-type alfalfa has a survival rate of 70% after salt stress, MsLea3 gene overexpression line and MsLea3 gene-edited line have a higher survival rate after salt stress than wild-type alfalfa. MsLea3 The gene-edited alfalfa transgenic line of MsLea3 gene has higher SOD, POD, and CAT enzyme activities, indicating that salt tolerance is mainly enhanced by increasing SOD, POD, and CAT enzyme activities, and compared with wild-type alfalfa,

[0039] In the following examples of the present application, the experimental material alfalfa 'Zhongmo No. 1' is an alfalfa variety known in the prior art, which was kindly donated by Professor Lin Qing of the School of Life Sciences, Inner Mongolia University.

[0040] In the following examples, the p6401 vector and p5CBC are described in the article "ZHU, F., YE, Q., CHEN, H., DONG, J. & WANG, T. 2021. Multigene editing reveals that MtCEP1 / 2 / 12 redundantly regulate lateral root and nodule number in Medicago truncatula. J. Exp. Bot." and were kindly donated by Professor Dong Jiangli of the School of Biological Sciences, China Agricultural University.

[0041] In the following examples, the plasmid pCAM1307, disclosed in the Chinese patent CN 116640201 A: Application of MfERF026 gene in regulating growth and development and stress tolerance of alfalfa. 2023.08.25, was preserved in the laboratory.

[0042] In the following examples, the formulations of each medium are as follows: The MSBK medium formula is: MS basal medium 4.43 g / L, sucrose 30 g / L, kinetin 1 mg / L, 6-BA 0.5 mg / L, Timetin 150 mg / L, Hygromycin B 5 mg / L and plant gel 3 g / L, pH 5.8~6.0.

[0043] The SH9 medium formula is: In addition to the basic medium: MgSO4·7H2O 185 mg / L, KNO3 2830 mg / L, (NH4)2SO4 463 mg / L, CaCl2·2H2O 166 mg / L, KH2PO4 400 mg / L, MnSO4·H2O 10 mg / L, H3BO3 5.0 mg / L, ZnSO4·7H2O 1.0 mg / L, KI 1.0 mg / L, Na2MoO4·2H2O 0.1 mg / L, CuSO4·5H2O 0.2 mg / L, CoCl2·6H2O 0.1 mg / L, EDTA-FeNa 140 mg / L, thiamine hydrochloride 5.0 mg / L, pyridoxine hydrochloride 5.0 mg / L, nicotinic acid 5.0 mg / L and myo-inositol 100 mg / L, it also contains: sucrose 20 g / L, Timetin 150 mg / L, Hygromycin B 5 mg / L and plant gel 3 g / L, pH 5.8~6.0.

[0044] The MSO medium formula is: MS basal medium 2.22 g / L, sucrose 5 g / L and plant gel 3 g / L.

[0045] In the following examples, the formulation of the 1 / 2 Hogrange solution is as follows: Ca(NO3)2·4H2O 4mmol / L, KNO3 5mmol / L, NH4NO3 1mmol / L, KH2PO4 1mmol / L, MgSO4·7H2O 2mmol / L, KI 5µmol / L, H3BO3 100µmol / L, MnSO4·H2O 100µmol / L, ZnSO4·7H2O 30µmol / L, Na2MoO4·2H2O 1µmol / L, CuSO4·5H2O 0.1µmol / L, CoCl2·6H2O 0.1µmol / L, FeSO4·7H2O 50µmol / L, and Na2EDTA 50µmol / L, pH 5.8~6.0.

[0046] Unless otherwise specified, the test methods used in the following examples are conventional test methods; the materials and reagents used are commercially available unless otherwise specified.

[0047] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments thereof.

[0048] Example 1 alfalfa MsLea3 Acquisition of genes Total RNA extraction from alfalfa 'Zhongmu 1': Total RNA was extracted from alfalfa 'Zhongmu 1' using liquid nitrogen grinding and the Trizol RNA extraction reagent from Takara Bio.

[0049] cDNA was synthesized by reverse transcription according to the instructions of the Takara Bio Reverse Transcription Kit (catalog number: RR047A).

[0050] by MsLea3 -F (SEQ ID NO.1) and MsLea3 Using -R (SEQ ID NO.2) as a primer, PCR was performed using cDNA synthesized by reverse transcription as a template.

[0051] The MsLea3 The -F sequence is: ATGGCAGCAACAATGTTGAC (SEQ ID NO.1).

[0052] The MsLea3 The sequence of -R is: TTACTCCTTCCCAGCCACG (SEQ ID NO.2).

[0053] PCR conditions are as follows: pre-denaturation 95℃ 5min; denaturation 98℃ 10sec; annealing 58℃ 30sec; extension 68℃ 1min, denaturation to extension 30 cycles; post-extension 68℃ 10min; 4℃ storage.

[0054] The PCR reaction system is shown in Table 1 as follows: Table 1 PCR reaction system

[0055] After the PCR reaction, the SanPrep column DNA gel recovery kit from Shenguo Bioengineering Co., Ltd. was used to recover the target fragment, and the operation was carried out according to the method of the kit instruction.

[0056] The Medicago sativa obtained by the above method MsLea3 The recovered fragment was connected to the T vector pMD19T (TAKARA, item number 6013), and a single clone was picked for sequencing. MsLea3 The nucleotide sequence of the gene is shown in SEQ ID NO. 3, and the amino acid sequence encoded thereby is shown in SEQ ID NO. 4.

[0057] MsLea3The nucleotide sequence of the gene (579 bp) is ATGGCAGCAACAATGTTGACAAGTAACACACTCTTCCAAACCTCAAACTCATTCCCTAATGTCCCTTCACTCACCCTTCCTAAACCCTCCAGGGTCTTCTTAGCTTCCAACTGGAGAAATGCATCGGAAGGAACAAAAAACACTTCACTCAGTTGGGCTTACACTTCTTCTACAAAGACAAGAAGATACGCAGATGGAACAGCCGGCAAAGCCGGAGAAACGGTGAACGCAGGCATAGATGACATCAAACAATTCGGACAAGATGCAGATGAAAAGACAAAGGACGCTGCGAGTTCAATTGCGGATAAAGCAAAAGAAAACACAGACAAGACTGTAGAGGCAGTAGGAAGTGCTGGAGACAAGGCAAAAGATTATGCTTTTGATGCAAATGACAAAACCAAGGAAGCAATAGGTTCTGCTACTGATAAGGCAAAAGAAGGATTTGAGGCAGCAACGAAGAACACACAGGAGGCTGCTGGGTCAGCGACAGAGGCTCTGAAGAATGCAGGAGATCAGGCAAAGGAGGCGGTGGAAGGAGCGTTGGACGCGGCCAAGGATGCCGTGGCTGGGAAGGAGTAA (SEQ ID NO. 3).

[0058] MsLea3 The amino acid sequence encoded by the gene (192 AA) is MAATMLTSNTLFQTSNSFPNVPSLTLPKPSRVFLASNWRNASEGTKNTSLSWAYTSSTKTRRYADGTAGKAGETVNAGIDDIKQFGQDADEKTKDAASSIADKAKENTDKTVEAVGSAGDKAKDYAFDANDKTKEAIGSATDKAKEGFEAATKNTQEAAGSATEALKNAGDQAKEAVEGALDAAKDAVAGKE (SEQ ID NO. 4).

[0059] The sequencing results were analyzed by constructing a phylogenetic tree using the maximum likelihood method by MEGA software, as shown in Figure 1 MsLea3 The highest similarity with MsLEA3-1 (EU665182.1), and thus named​MsLea3 .

[0060] Example 2 alfalfa MsLea Gene expression pattern analysis (1) Select wild-type alfalfa 'Zhongmu No. 1' that has grown normally to flowering. Collect roots, stems, leaves and flowers, wrap them in tin foil, mark the tissues, quick-freeze with liquid nitrogen and store at -80℃.

[0061] RNA was extracted from the processed alfalfa samples, and cDNA was obtained by reverse transcription. This cDNA was then used as a template for further processing. MsLea3 qRT-F (sequence shown in SEQ ID NO.5) and MsLea3 qRT-R (sequence shown in SEQ ID NO.6) was used as the primer, and the procedure was performed according to the instructions of the TAKARA Biotech Real-Time Fluorescence Kit (catalog number: RR047Q).

[0062] MsLea3 The sequence of qRT-F is: CTCAGTTGGGCTTACACTTCTTCTAC (SEQ ID NO.5).

[0063] MsLea3 The sequence of qRT-R is: TATGCCTGCGTTCACCGTTT (SEQ ID NO.6).

[0064] (2) Plant materials were selected from wild-type alfalfa 'Zhongmu No. 1' that had grown normally for four weeks. The plants were grouped according to treatment methods including salt, low temperature, drought, SA (salicylic acid), and ABA (abscisic acid). 'Zhongmu No. 1' alfalfa was treated with 250 mM NaCl, 300 mM mannitol, 1 mM SA, and 100 μM ABA for 0 h, 2 h, 4 h, 8 h, 12 h, 24 h, and 48 h. The 0℃ low temperature stress treatment involved placing the alfalfa in a 0℃ plant low-temperature incubator for 0 h, 2 h, 4 h, 8 h, 12 h, 24 h, and 48 h. At different stress time points, the treated alfalfa plants (roots, stems, and leaves) were wrapped in aluminum foil, labeled with the stress conditions and stress time, and then flash-frozen in liquid nitrogen and stored at -80℃.

[0065] RNA was extracted from the processed alfalfa samples, and cDNA was obtained by reverse transcription. This cDNA was then used as a template for further processing. MsLea3 qRT-F (sequence shown in SEQ ID NO.5) and MsLea3 qRT-R (sequence shown in SEQ ID NO.6) was used as the primer, and the procedure was performed according to the instructions of the TAKARA Biotech Real-Time Fluorescence Kit (catalog number: RR047Q).

[0066] Results are shown as A in Figure 2 , MsMYBS3 The relative expression of the gene in the leaves of wild-type alfalfa 'Zhongmu No. 1' was the highest; Figure 2 B~F in represent the relative expression of the gene in alfalfa under different stress treatments of NaCl stress, 0℃ low temperature stress, mannitol stress, SA treatment and ABA treatment, respectively. MsMYBS3 According to B~F in Figure 2 , the alfalfa MsMYBS3 gene can respond to NaCl, 0℃ low temperature and drought (mannitol) stress, and respond to SA and ABA treatment induced expression.

[0067] Example 3 Alfalfa MsLea3 Gene editing strain and alfalfa MsLea3 Gene overexpression strain 3.1 Construction of gene editing vector p5CBC-6401- MsLea3 According to Chinese patent 202110884895.X: Alfalfa CRISPR / Cas9 genome editing system and its application The gene editing method in the construction of alfalfa MsLea3 gene editing vector.

[0068] Specifically includes: Gene editing target design According to the alfalfa MsLea3 gene sequence (SEQ ID NO. 3), the target list was generated through the online target prediction website (http: / / crispor.tefor.net / ), and the target 1 was selected as 5'-CCGGAGAAACGGTGAACGC-3'(SEQ ID NO. 7), and the target 2 was selected as 5'-GACGCTGCGAGTTCAATTG-3'(SEQ ID NO. 8).

[0069] Construction of sgRNA module According to target 1 (SEQ ID NO. 7), Beijing Liuhexuahua Gene Technology Co., Ltd. synthesized MsLea3 -DT1-BsF (SEQ ID NO. 9) primer and MsLea3 -DT1-F0 (SEQ ID NO. 10) primer; according to target 2 (SEQ ID NO. 8), synthesized MsLea3 -DT2-BsR (SEQ ID NO. 11) primer and MsLea3 -DT2-R0 (SEQ ID NO. 12) primer.

[0070] MsLea3 The sequence of DT1-BsF is ATATATGGTCTCGCTTGCCGGAGAAACGGTGAACGCGTT (SEQ ID NO. 9), wherein the 18th to 36th nucleotides are designed Mslea3 Target 1 sequence; MsLea3 The sequence of DT1-F0 is GCCGGAGAAACGGTGAACGCGTTTTAGAGCTAGAAATAGC (SEQ ID NO. 10), wherein the 2nd to 20th nucleotides are designed Mslea3 Target 1 sequence; MsLea3 The sequence of DT2-BsR is ATTATTGGTCTCGAAACCAATTGAACTCGCAGCGTCC (SEQ ID NO. 11), wherein the 18th to 36th nucleotides are designed Mslea3 Reverse complement of target 2 sequence; MsLea3 The sequence of DT2-R0 is AACCAATTGAACTCGCAGCGTCCAATTTAATGGTTCGCTTGTA (SEQ ID NO. 12), wherein the 4th to 22nd nucleotides are designed Mslea3 Reverse complement of target 2 sequence.

[0071] Primer used for constructing p5CBC empty plasmid and editing vector MsLea3 -DT1-BsF (SEQ ID NO. 9), MsLea3 -DT1-F0 (SEQ ID NO. 10), MsLea3 -DT2-R0 (SEQ ID NO. 12), and MsLea3 -DT2-BsR (SEQ ID NO. 11) were amplified by bridge PCR to obtain the target-bearing MsLea3 -p5CBC-DT1T2 fragment (i.e., sgRNA module).

[0072] The PCR conditions are as follows: pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 15 sec; annealing at 60℃ for 30 sec; extension at 68℃ for 1 min, denaturation to extension for 30 cycles; post-extension at 68℃ for 5 min; recovery MsLea3 -p5CBC-DT1T2 fragment.

[0073] The amplification system is shown in Table 2 below; Table 2 MsLea3- p5CBC-DT1T2 reaction system

[0074] After the end of the bridge PCR reaction, the product was detected by 1% agarose gel electrophoresis, the gel block containing the target fragment was cut and the fragment was recovered by a gel recovery kit.

[0075] The recovered gel fragment was sent for sequencing, and the obtained MsLea3The sequence of the p5 CBC-DT1T2 fragment is as follows: ATATATGGTCTCGCTTGCCGGAGAAACGGTGAACGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTGCAAAATTTTCCAGATCGATTTCTTCTTCCTCTGTTCTTCGGCGTTCAATTTCTGGGGTTTTCTCTTCGTTTTCTGTAACTGAAACCTAAAATTTGACCTAAAAAAAATCTCAAATAATATGATTCAGTGGTTTTGTACTTTTCAGTTAGTTGAGTTTTGCAGTTCCGATGAGATAAACCAATAGAGTGTCGTTTTAGTAAAAAAAATTATTTTAAAATGAATATCATCACTTTTCAATATAGAATTATTATTTTACTTCCAATTATACCCTCTAATTAATTTCCAAAGCATTATACCAATAGTAAATAAAGTTAGTTTAGTAAAATTGTCATATCTTTTAACATTATTATTAGATTTCTTAATTTGTGTTTAAAAGCTTTAAACGATGATCATTTTTAAACAGAGAGTATAAAGTAGTAAAATAGTACTATTAGAAATGAATTGACGTGACATGCTATGAAAAGTCTGGAAGAGTATCGATAAAAGGCTACACTAGAGGTAGCTACTTATATGCGCAGGAACTGAAATCAAAAATGAAATAAAGGAGAAGGAAGATGCATGTTGTGTTATATAAGTGAAGGAGAAGGACTTGCATGTTGTGTTATATTTGCTTGTTTTAGTCCCACATCGACTGAAACAGAAAGTATCTCGGCGTTTATATACTACAAGCGAACCATTAAATTGGACGCTGCGAGTTCAATTGGTTTCGAGACCAATAAT (SEQ ID NO. 13).

[0076] MsLea3 The 18th-36th positions of the sequence of the p5 CBC-DT1T2 fragment are MsLea3 The 806th-824th positions of the sequence of the gene editing target 1 MsLea3 The 806th-824th positions of the sequence of the gene editing target 2.

[0077] Construction of gene editing binary vector Golden Gate reaction was used to construct p5CBC-p6401- MsLea3- p5CBC-DT1T2 fragment and p6401 vector were digested by restriction enzyme I and ligated by T4 DNA ligase, forming p5CBC-p6401- Bsa . MsLea3

[0078] Golden Gate reaction was used to construct p5CBC-p6401- MsLea3- p5CBC-DT1T2 fragment and p6401 vector were digested by restriction enzyme I and ligated by T4 DNA ligase, forming p5CBC-p6401-

[0079] Table 3 Golden Gate reaction system

[0080] After mixing according to the system in Table 3, the reaction procedure was as follows: first step: 37°C, 5h; second step: 50°C, 5min; third step: 80°C, 10min.

[0081] After the completion of Golden Gate reaction, the product was added to E. coli DH5a competent cells, and then the cells were placed in ice bath for 25min, heated at 42°C for 45s, and then added to LB liquid medium without antibiotics and cultured at 37°C and 150rpm for 45min. Subsequently, the bacterial solution was spread on LB solid medium containing Kanamycin (50mg / L) and cultured at 37°C in the dark for 12h. Single colonies were selected and inoculated into 400μL LB liquid medium containing Kanamycin (50mg / L) and cultured at 37°C and 230rpm for 6-8h, and then the bacterial solution was subjected to PCR identification.

[0082] Results verification: the above MsLea3 -DT1-F0 (SEQ ID NO. 10) and MsLea3 -DT2-R0 (SEQ ID NO. 12) were used as primers for amplification, and the positive clones had specific bands with a size of 811bp.

[0083] The positive clone plasmid was extracted, and the p5CBC-p6401- MsLea3 sequence in the constructed transformation vector was determined by sequencing, wherein the sequencing primers were the above primers MsLea3 -DT1-BsF (SEQ ID NO. 9) and MsLea3 -DT2-BsR (SEQ ID NO. 11).

[0084] The sequencing results showed that the p5CBC-p6401-​MsLea3 is used MsLea3 -p5CBC-DT1T2 fragment (SEQ ID NO. 13) is used to replace the fragment between the BsaI restriction enzyme cleavage sites of the vector p6401, and the other sequences of the vector p6401 are kept unchanged, to obtain the recombinant expression vector p5CBC-p6401. MsLea3 p5CBC-p6401 MsLea3 The vector expresses two sgRNAs of sgRNA1 (targeting target 1) and sgRNA2 (targeting target 2) targeting the MsLea3 gene.

[0085] 3.2 Construction of overexpression vector pCAM1307 MsLea The empty plasmid pCAM1307 (hereinafter referred to as p1307) is digested with NotI and EcoRI, and the enzyme digestion system is as shown in Table 4. After mixing, the linearized plasmid vector (p1307 linearized vector) is recovered after enzyme digestion at 37°C for 1 hour. BamH Xba Table 4 p1307 vector enzyme digestion system

[0086] The OE-F and OE-R primers are used to perform PCR amplification on the correct plasmid obtained by cloning the T carrier of Example 1, to obtain the OE- full-length cDNA with HpaI and EcoRI enzyme digestion sites, and the PCR conditions are the same as in Example 1.

[0087] MsLea3 MsLea3 The sequence of OE-F is CGGGATCCATGGCAGCAACAATGTTGAC (SEQ ID NO. 14); Bam Xba The sequence of OE-R is GCTCTAGACTCCTTCCCAGCCACG (SEQ ID NO. 15). MsLea The target fragment OE-

[0088] is recovered by a gel recovery kit. MsLea3 MsLea3 According to the molar ratio of the linearized p1307 plasmid vector: the target fragment OE- = 3:1, the above OE-

[0089] is recovered. MsLea3.

[0090] The target fragment OE- MsLea3 is recovered by a gel recovery kit. MsLea3 ​​​The full-length cDNA gene fragment was connected to p1307 linearized vector by T4 DNA ligase, and then transformed into E. coli competent cells DH5a. After plating, positive clones were picked for PCR detection. The positive clones verified by sequencing were expanded for culture, and the plasmid was extracted for standby use.

[0091] 3.3 Editing vector p5CBC-6401- MsLea3 and overexpression vector pCAM1307- MsLea3 Transform Agrobacterium EHA105 .

[0092] Take the gene editing vector p5CBC-p6401- MsLea3 and overexpression vector pCAM1307- MsLea3 Each 500 ng was added to 50 μL EHA105 competent cells. Frozen in liquid nitrogen for 5 min, heat shock at 28°C for 5 min, ice bath for 5 min, add 600 μL YEB liquid medium, 28°C, 200 rpm culture for 4 h. Take 80 μL and spread on YEB solid medium containing kanamycin (50 mg / L) and rifampicin (75 mg / L), 28°C, inverted culture for 2 days, then screen positive colonies.

[0093] The positive single colony was selected and expanded to OD600 of 0.6-0.8. The Agrobacterium solution was centrifuged at 2400 r / min at room temperature for 15 min, the supernatant was discarded, and the bacterial body was suspended to make the OD600 reach 0.2-0.3 to prepare the infection solution for standby use.

[0094] 3.4 Agrobacterium EHA105 mediated leaf disc method to transform Medicago sativa Plant material selection Muzi No. 1, and infection material selection three-leaf with good growth state for four to six weeks. Through EHA105Mediated leaf disc transformation of alfalfa, the invasion of the material using ultrapure water after washing, adding 30 mL hypochlorite rinse + 20 μL Tween-20, sterilization 8 minutes. The above prepared in 3.3 invasion of the liquid with three leaves mixed, 0.08-0.09Mpa vacuum infiltration blade 10 minutes, room temperature ultrasonic (40 kHz) treatment 5 min, vacuum infiltration blade 10 minutes again 0.08-0.09Mpa. Discard the agrobacterium suspension, on the sterile filter paper to absorb the agrobacterium on the surface of the leaf, on the co-culture medium, dark culture 24 hours. The explants were transferred to the selection medium, subcultured every 2 weeks, and the callus culture needed 5-6 weeks. The callus with good growth was transferred to MSBK medium for 14 days, and green embryoid appeared. The callus with green embryoid was transferred to SH9 medium for bud differentiation. Subculture every 4-6 weeks until the bud grows, usually 6-8 weeks in this medium. When the bud grows 2-3 fully expanded three leaves, transfer to MSO medium for rooting culture (if the growth of healthy seedlings is difficult to root within one month, add 1 mg / L IAA). The rooted plants were transplanted to vermiculite and perlite (1:1) soil for acclimation. The surviving plants were transferred to nutrient soil and vermiculite (2:3) culture.

[0095] 3.5 MsLea3 Detection of genetically edited alfalfa strains PCR and sequencing methods were used to verify the transgenic strains. The DNA of the leaves of the surviving transgenic plants was extracted for positive seedling verification, and the primers used were MsLea3 -DT1-BsF (SEQ ID NO. 9) and MsLea3 -DT2-BsR (SEQ ID NO. 11), and the PCR conditions were the same as in Example 1. The results are shown in A of Figure 3 , M is marker; 19-26, 17, 13, 1 are the PCR verification results of the plants obtained by genetic transformation, and except for 22, all are transgenic positive seedlings.

[0096] The leaf DNA of the 1, 13, and 17 strains preliminarily detected as positive strains was used for target detection, and the primers used were p6401- MsLEA3 -F: AATGGTGGTCAGTGAGAGTGTT (SEQ ID NO. 16) and p6401- MsLEA3 -R: GCAGCCTCCTGTGTGTTCTT (SEQ ID NO. 17), and the PCR conditions were the same as in Example 1. The MsLea3 target sequencing identification results of the genetically edited transgenic strains of alfalfa are shown in Figure 3As shown in B in the figure, C13, C1, and C17 represent the three edited lines 13, 1, and 17 used in the experiment. The results showed that each line produced two editing results. In line 13, one allele (C13-7) was deleted by 3 bp, and the other allele (C13-11) was inserted by one base. In line 1, one allele (C1-1) was inserted by one base, and the other allele (C1-10) was deleted by 70 bp. In line 17, one allele (C17-6) was deleted by 7 bp, and the other allele (C17-7) was deleted by 2 bp.

[0097] 3.6 MsLea3 Detection of gene overexpression lines in alfalfa Using PCR and Q-PCR methods to MsLea3 The gene overexpression transgenic lines were validated. RNA was extracted from leaves of surviving transgenic plants and reverse transcribed into cDNA for PCR identification. Figure 4 As shown, primers are used MsLea3 OE-F (SEQ ID NO.14) and 3×Flag-R (SEQ ID NO.18), PCR conditions were the same as in Example 1.

[0098] The sequence of 3×Flag-R is: CTACTTATCGTCATCGTCCTTGTA (SEQ ID NO.18) Leaf cDNA samples from lines that initially tested positive were selected, and quantitative real-time qRT-PCR was used to calculate the cDNA values ​​for each line. MsLea3 The relative expression level.

[0099] by MsLea3 qRT-F (SEQ ID NO.5) and MsLea3 qRT-R (SEQ ID NO.6) was used as the primer, and the procedure was performed according to the instructions of the TAKARA Biotech Real-Time Fluorescence Kit (catalog number: RR047Q).

[0100] like Figure 5 As shown, compared with the control ck(WT), MsLea3 Gene overexpression levels were significantly increased in all strains. These results demonstrate that... MsLea3 The gene has been transferred into the alfalfa genome and overexpressed. The expression levels were highest in strains 8, 13, and 20. Therefore, strains 8, 13, and 20, which had high expression levels, were selected for further research.

[0101] Example 4 MsLea3 Salt tolerance experiments of gene-edited and overexpression lines 4.1 Propagation of genetically modified alfalfa by cuttings The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. MsLea3 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. MsLea3 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions.

[0102] 4.2 Salt tolerance experiment of the transgenic strain The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. MsLea3 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. MsLea3 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. Figure 7 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions.

[0103] The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. MsLea3 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. MsLea3 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. Figure 6 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. Figure 6 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. Figure 6 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. Figure 6 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. Figure 6 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. Figure 6 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. MsLea3 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. MsLea3 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. MsLea3 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. MsLea3 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. MsLea3 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. MsLea3 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. MsLea3 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions. Figure 7 The plants of the wild type alfalfa, the gene overexpression strain and the gene editing strain were grown in the greenhouse under the same conditions.

[0104] By MsLea3 It can be seen that the leaves of the control group (WT) appear yellowing or wilting, MsLea3 The leaf damage degree of the gene editing strain and the overexpression strain after four weeks of stress is obviously lower than that of the control group (WT), and basically no leaf yellowing or wilting occurs, further proving that MsLea3 The gene overexpression strain and ​ The gene editing strain has stronger salt tolerance.

[0105] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which all belong to the protection scope of the present application.

Claims

1. A gene regulating salt tolerance in Medicago sativa, characterized in that, MsLEA3 The MsLEA3 The polynucleotide sequence of the gene is shown as SEQ ID NO.

3. ​ 2. A MsLEA3 protein for regulating salt tolerance of Medicago sativa, characterized in that, The amino acid sequence of the MsLEA3 protein is shown as SEQ ID NO.

4.

3. A polynucleotide mutant that regulates salt tolerance in alfalfa, characterized in that, The method for preparing the polynucleotide mutant comprises: performing gene editing on the gene in claim 1 by using a gene editing binary vector of a CRISPR / Cas9 genome editing system, wherein the gene editing binary vector expresses sgRNAs targeting target point 1 and target point 2 on the gene, to obtain the polynucleotide mutant. MsLEA3 The method for preparing the polynucleotide mutant comprises: performing gene editing on the gene in claim 1 by using a gene editing binary vector of a CRISPR / Cas9 genome editing system, wherein the gene editing binary vector expresses sgRNAs targeting target point 1 and target point 2 on the gene, to obtain the polynucleotide mutant. MsLEA3 The method for preparing the polynucleotide mutant comprises: performing gene editing on the gene in claim 1 by using a gene editing binary vector of a CRISPR / Cas9 genome editing system, wherein the gene editing binary vector expresses sgRNAs targeting target point 1 and target point 2 on The sequence of the target point 1 is shown as SEQ ID No.

7. The sequence of the target point 2 is shown as SEQ ID No.

8.

4. The polynucleotide mutant of claim 3, wherein The gene editing binary vector comprises p 6401 vector and p 5 CBC vector.

5. A biomaterial comprising the gene of claim 1 MsLEA3 characterized in that, The biological material comprises one of an expression cassette, a recombinant vector or a recombinant microorganism.

6. The use of the gene of claim 1, the MsLEA3 protein of claim 2, the polynucleotide mutant of claim 3 or 4, or the biological material of claim 5 for increasing salt tolerance in plants. MsLEA3 The use of the gene of claim 1, the MsLEA3 protein of claim 2, the polynucleotide mutant of claim 3 or 4, or the biological material of claim 5 for increasing salt tolerance in plants.

7. Use according to claim 6, characterized in that, The method for improving salt tolerance of plants is to improve the expression amount and / or activity of the gene as shown in SEQ ID NO. 3, or to introduce the gene editing binary vector as described in claim 3 into Medicago sativa L. to edit the gene. MsLEA3 The method for improving salt tolerance of plants is to improve the expression amount and / or activity of the gene as shown in SEQ ID NO. 3, or to introduce the gene editing binary vector as described in claim 3 into Medicago sativa L. to edit the gene. MsLEA3 The method for improving salt tolerance of plants is to improve the expression amount and / or activity of the gene as shown in SEQ ID NO. 3, 8. The use of the gene of claim 1, the MsLEA3 protein of claim 2, the polynucleotide mutant of claim 3 or 4, or the biological material of claim 5 for breeding salt-tolerant plants. MsLEA3 The use of the gene of claim 1, the MsLEA3 protein of claim 2, the polynucleotide mutant of claim 3 or 4, or the biological material of claim 5 for breeding salt-tolerant plants.

9. Use according to claim 8, characterized in that, The plant comprises a dicotyledon.

10. A method of increasing salt tolerance in Medicago sativa, comprising, The method comprises introducing the gene editing binary vector as described in claim 3 into Medicago sativa, or overexpressing the gene as described in claim 1 in Medicago sativa MsLEA3 genes.

Citation Information

Patent Citations

  • alfalfa CRISPR / Cas9 genome editing system and its applications

    CN113493803B

  • Application of regulating MfERF026 gene in growth and development and stress tolerance of medicago sativa

    CN116640201A

  • Plant yield improvement by group 3 LEA expression

    CN101268193A

  • Alfalfa zinc late-embryogenesis abundant protein and encoding gene and application thereof

    CN102477087A

  • Sickle-alfalfa chloroplast cold-response protein (MfcpCOR14) and coding gene and application thereof

    CN103145817A

Cited By

  • Method for cultivating low-antinutritional-factor and high-nutrition medicago sativa and application

    CN121575027A

  • Medicago sativa MsOCP3 gene and application thereof in regulation and control of salt tolerance

    CN121592670A