MsLEA3 gene and application thereof
Editing the MsLEA3 gene of alfalfa using the CRISPR/Cas9 gene editing system solved the problem of insufficient salt tolerance in alfalfa, significantly improved its salt tolerance, and promoted the breeding of highly salt-tolerant varieties.
Patent Information
- Application Number
- CN202511453565.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-13
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2045-10-13
AI Technical Summary
Current technologies lack effective means to improve the salt tolerance of alfalfa, which limits its application in abiotic stress environments such as saline-alkali land.
Gene editing of the MsLEA3 gene in alfalfa was performed using the CRISPR/Cas9 genome editing system to construct MsLEA3 gene overexpression or mutants, thereby improving its salt tolerance.
It significantly improved the salt tolerance of alfalfa, promoted the breeding of highly salt-resistant alfalfa varieties, and provided a theoretical basis for improving the application of plants in saline-alkali land.
Smart Images

Figure CN120905255B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a... MsLEA3 Genes and their applications. Background Technology
[0002] alfalfa ( Medicago sativa Alfalfa (L.) is one of the most important perennial leguminous forage crops, widely cultivated worldwide and hailed as the "King of Forages" and the "Queen of Feeds." In my country, alfalfa cultivation is mainly concentrated in the Northeast, North, and Northwest regions, which are highly susceptible to abiotic stresses such as drought, salinity, and cold, severely restricting the yield and quality of alfalfa. During evolution, plants have developed complex regulatory networks to cope with various abiotic stresses. Therefore, a deep understanding of the molecular mechanisms of alfalfa's stress response and the discovery of important regulatory genes are key research directions for the genetic improvement of alfalfa.
[0003] Late embryogenesis abundant proteins (LEA) are important stress-response proteins, functioning as protective proteins against dehydration under stress conditions. LEA proteins are highly hydrophilic and disordered, which contributes to their defensive function. High hydrophilicity allows LEA proteins to help plants survive by reducing water loss during dehydration, while their disordered nature enables them to form amphiphilic α-helical structures to cope with adverse conditions. Based on their conserved motifs, LEA proteins are divided into seven groups, with groups 1, 2, and 3 considered the major LEA groups, encompassing most members of the LEA protein family. Group 3 proteins contain typical disordered and α-helical structures and are closely related to plant tolerance to abiotic stresses. For example, MfLEA3 is involved in protecting catalase (CAT) activity and confers this protection on alfalfa (…). Medicago falcata Tolerance to various abiotic stresses.
[0004] Currently, there is a lack of technology to improve new varieties of alfalfa. If the salt tolerance of alfalfa can be improved through molecular genetics and gene editing, it will greatly promote the application of alfalfa in production and has very important practical significance for molecular breeding research of forage grasses. Summary of the Invention
[0005] The purpose of this invention is to provide a MsLEA3 Genes that regulate alfalfa MsLEA3 Genes can enhance the salt tolerance of alfalfa, which can be used to breed highly salt-tolerant alfalfa varieties, greatly promoting the application of alfalfa in production.
[0006] To achieve the above objectives, the present invention provides a method for regulating the salt tolerance of alfalfa. MsLEA3 Genes, the ones mentioned MsLEA3The polynucleotide sequence of the gene is shown as SEQ ID NO. 3.
[0007] The application also provides an MsLEA3 protein for regulating salt tolerance of Medicago sativa, wherein the amino acid sequence of the MsLEA3 protein is shown as SEQ ID NO. 4.
[0008] The application also provides a polynucleotide mutant for regulating salt tolerance of Medicago sativa, wherein a preparation method of the polynucleotide mutant comprises: performing gene editing on the MsLEA3 gene by using a gene editing binary vector of a CRISPR / Cas9 genome editing system, wherein the gene editing binary vector expresses sgRNA, the sgRNA targets target point 1 and target point 2 on the MsLEA3 gene, and the polynucleotide mutant is obtained.
[0009] The sequence of the target point 1 is shown as SEQ ID No. 7.
[0010] The sequence of the target point 2 is shown as SEQ ID No. 8.
[0011] Preferably, the gene editing binary vector comprises p 6401 vector and p 5CBC vector.
[0012] The application also provides a biological material containing the MsLEA3 gene, wherein the biological material comprises one of an expression cassette, a recombinant vector or a recombinant microorganism.
[0013] The application also provides the MsLEA3 gene, the MsLEA3 protein, the polynucleotide mutant or the biological material in the application of improving salt tolerance of plants.
[0014] Preferably, the method for improving salt tolerance of plants is to improve the expression amount and / or activity of the gene shown as SEQ ID NO. 3, or to introduce the gene editing binary vector into Medicago sativa to perform gene editing on the MsLEA3 gene. MsLEA3
[0015] The application also provides the MsLEA3 gene, the MsLEA3 protein, the polynucleotide mutant or the biological material in the application of cultivating plants with salt tolerance.
[0016] Preferably, the plants comprise dicotyledonous plants.
[0017] The present invention also provides a method for improving the salt tolerance of alfalfa, the method comprising introducing the gene-editing binary vector into alfalfa, or overexpressing the gene-editing binary vector in alfalfa. MsLEA3 Gene.
[0018] Compared with the prior art, the present invention has the following beneficial effects:
[0019] This invention provides MsLEA3 Genes, the ones mentioned MsLEA3 The gene comes from alfalfa, and is expressed through overexpression of alfalfa. MsLEA3 Genes or effects on alfalfa MsLEA3 Gene editing was performed to obtain alfalfa. MsLEA3 Gene overexpression transgenic lines or targeting alfalfa MsLEA3 Gene-edited transgenic lines. Through salt tolerance experiments on the obtained transgenic lines, it was found that the salt tolerance of overexpressed or gene-edited alfalfa transgenic lines was significantly improved. These lines can be used to breed alfalfa varieties with high salt tolerance, providing a new theoretical basis and candidate genes for breeding new leguminous forage varieties with high salt resistance, and greatly promoting the application of alfalfa in production. Attached Figure Description
[0020] Figure 1 In Example 1 MsLea3 The results of the phylogenetic tree analysis.
[0021] Figure 2 In Example 2 MsLea3 The results of gene expression pattern analysis in alfalfa, where A represents... MsLea3 The relative expression levels of the gene in the roots, stems, leaves, and flowers of alfalfa 'Zhongmu 1' are given, with B representing the expression level of the gene in alfalfa 'Zhongmu 1' under NaCl stress. MsLea3 The relative expression level of genes, C being the expression level of alfalfa 'Zhongmu No. 1' plants under 0℃ low temperature stress. MsLea3 The relative expression level of the gene, D represents the expression level of alfalfa 'Zhongmu 1' under mannitol stress. MsLea3 The relative expression level of the gene, E being the expression level of alfalfa 'Zhongmu 1' plants treated with SA (salicylic acid). MsLea3 The relative expression levels of genes, F represents the expression levels of alfalfa 'Zhongmu 1' plants under ABA (abscisic acid) treatment. MsLea3 The relative expression level of genes.
[0022] Figure 3 alfalfa in Example 3 MsLea3 Results of gene-edited transgenic lines; where A is alfalfa. MsLea3Gene editing transgenic line positive seedling verification results, wherein M represents 1000 bp DNA Marker, 26, 25, 24, 23, 22, 21, 20, 19, 17, 13 and 1 represent Medicago sativa MsLea3 Gene editing transgenic line numbers, - represents WT (wild-type Medicago sativa 'Zhongmo No. 1' plant) negative control; B is Medicago sativa MsLea3 Sequencing results of target points of gene editing transgenic lines.
[0023] Figure 4 Medicago sativa in Example 3 MsLea3 Gene overexpression transgenic line positive seedling verification results, wherein M represents 1000 bp DNA Marker, and numbers 8, 10, 11, 12, 13, 15, 16, 19, 20 represent Medicago sativa numbered 8, 10, 11, 12, 13, 15, 16, 19, 20 respectively MsLea3 Gene overexpression transgenic line positive seedling verification results, CK- (ddH2O) represents a negative control obtained by amplifying water as a template, and CK- represents a negative control obtained by amplifying DNA of WT (wild-type Medicago sativa 'Zhongmo No. 1' plant) as a template.
[0024] Figure 5 Medicago sativa in Example 3 MsLea3 Gene overexpression line quantitative results, wherein ck represents the quantitative results of WT (wild-type Medicago sativa 'Zhongmo No. 1' plant), and 1~21 represent the quantitative results of positive plants of gene editing lines numbered 1~21 respectively.
[0025] Figure 6 WT, Medicago sativa in Example 4 MsLea3 Gene editing lines and Medicago sativa MsLea3 Physiological and biochemical index detection results of gene overexpression lines before and after 250mM NaCl stress; wherein A is the NBT and DAB staining results before and after 250mM NaCl stress; B is the survival rate result after 250mM NaCl stress; C is the superoxide dismutase (SOD) activity detection result before and after 250mM NaCl stress; D is the catalase (CAT) activity detection result before and after 250mM NaCl stress; E is the peroxidase (POD) activity detection result before and after 250mM NaCl stress; F is the conductivity detection result before and after 250mM NaCl stress; G is the proline (Pro) content detection result before and after 250mM NaCl stress.
[0026] Figure 7 WT, Medicago sativa in Example 4 MsLea3 Gene editing lines and Medicago sativaMsLea3 Phenotypic diagrams of gene overexpression lines after 250mM NaCl stress, where WT represents wild-type alfalfa 'Zhongmu 1' plants and Ed represents alfalfa. MsLea3 Gene-edited lines. OE is alfalfa. MsLea3 Gene overexpression lines. Detailed Implementation
[0027] This invention provides a method for regulating the salt tolerance of alfalfa. MsLEA3 Genes, the ones mentioned MsLEA3 The polynucleotide sequence of the gene is shown in SEQ ID NO.3.
[0028] In this invention, the MsLea3 The nucleotide sequence (579 bp) of the gene is (SEQ ID NO.3). MsLea3 The gene is derived from alfalfa variety Zhongmu 1.
[0029] The present invention also provides a MsLEA3 protein for regulating salt tolerance in alfalfa, the amino acid sequence of which is shown in SEQ ID NO.4.
[0030] In this invention, the amino acid sequence (192AA) of the MsLEA3 protein is MAATMLTSNTLFQTSNSFPNVPSLTLPKPSRVFLASNWRNASEGTKNTSLSWAYTSSTKTRRYADGTAGKAGETVNAGIDDIKQFGQDADEKTKDAASSIADKAKENTDKTVEAVGSAGDKAKDYAFDANDKTKEAIGSATDKAKEGFEAATKNTQEAAGSATEALKNAGDQAKEAVEGALDAAKDAVAGKE (SEQ ID NO.4).
[0031] The present invention MsLEA3 The gene originates from chromosome 2 (Chr2) of alfalfa 'Zhongmu 1'.
[0032] This invention also provides a polynucleotide mutant that regulates salt tolerance in alfalfa, the preparation method of which includes: using a gene-editing binary vector of the CRISPR / Cas9 genome editing system to... MsLEA3 Gene editing is performed on the gene, wherein the gene editing binary vector expresses sgRNA, and the sgRNA targets the gene. MsLEA3 Targets 1 and 2 on the gene were used to obtain polynucleotide mutants; the sequence of target 1 is shown in SEQ ID No. 7; the sequence of target 2 is shown in SEQ ID No. 8.
[0033] As an optional implementation, the CRISPR / Cas9 genome editing system includes an expression vector, the expression vector comprising... p 6401 carrier and p 5CBC vector. The preparation method of the polynucleotide mutant includes the following steps: using the p5CBC empty vector plasmid and the primers SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.12 and SEQ ID NO.11 used to construct the editing vector, the mutant is amplified by bridging PCR to obtain the target mutant carrying target 1 and target 2. MsLea3 -p5CBC-DT1T2 fragment; using the Golden Gate reaction to deliver the fragment containing target 1 and target 2. MsLea3 The p5CBC-DT1T2 fragment and the p6401 vector were digested with the restriction endonuclease BsaI and then ligated using T4 DNA ligase to form the gene editing binary vector p5CBC-p6401- MsLea3 The gene-editing binary vector p5CBC-p6401- MsLea3 Expression targetingMsLea3 two sgRNAs of sgRNA1 (targeting target 1) and sgRNA2 (targeting target 2) of the gene, edit the target 1 and the target 2 on the gene, and obtain a polynucleotide mutant. MsLEA3 two sgRNAs of sgRNA1 (targeting target 1) and sgRNA2 (targeting target 2) of the gene, edit the target 1 and the target 2 on the gene, and obtain a polynucleotide mutant.
[0034] The present application establishes a Medicago sativa CRISPR / Cas9 genome editing system (Tao Wang et al., patent application number 202110884895.X), designs and constructs a genetic editing genetic transformation vector for the gene, and transforms Medicago sativa variety 'Zhongmo No. 1' by means of Agrobacterium mediation, thereby achieving editing of the target point in the gene. MsLEA3 The salt tolerance of the genetically edited Medicago sativa is significantly improved. MsLea3
[0035] The present application also provides a biological material containing the gene, wherein the biological material comprises one of an expression cassette, a recombinant vector or a recombinant microorganism. MsLEA3 The present application also provides the gene, the MsLEA3 protein, the polynucleotide mutant or the biological material.
[0036] The present application also provides the gene, the MsLEA3 protein, the polynucleotide mutant or the biological material. MsLEA3 The present application also provides the gene, the MsLEA3 protein, the polynucleotide mutant or the biological material.
[0037] In the present application, the way to improve the salt tolerance of the plant is to improve the expression amount and / or activity of the gene as shown in SEQ ID NO. 3, or to introduce the gene editing binary vector into Medicago sativa to edit the gene. MsLEA3 In the present application, the way to improve the expression amount and / or activity of the gene is preferably overexpression. MsLEA3 When the gene is overexpressed, the vector used is preferably pCAM1307; the restriction enzymes used are preferably Not I and Xba I. MsLEA3 When the gene is overexpressed, the vector used is preferably pCAM1307; the restriction enzymes used are preferably Not I and Xba I. MsLEA3 BamH When the gene is overexpressed, the vector used is preferably pCAM1307; the restriction enzymes used are preferably Not I and Xba I. Xba When the gene is overexpressed, the vector used is preferably pCAM1307; the restriction enzymes used are preferably Not I and Xba I.
[0038] The present application also provides the gene, the MsLEA3 protein, the polynucleotide mutant or the biological material. MsLEA3 The present application also provides the gene, the MsLEA3 protein, the polynucleotide mutant or the biological material.
[0039] In the present application, the plant is preferably a dicotyledonous plant, and the dicotyledonous plant is preferably Medicago sativa. As an optional embodiment, the variety of the Medicago sativa is 'Zhongmo No. 1'.
[0040] The application also provides a method for improving salt tolerance of alfalfa, which comprises introducing the gene editing binary vector into alfalfa, or overexpressing the gene in alfalfa. MsLEA3
[0041] The application constructs two different alfalfa transgenic lines based on the gene, including an alfalfa transgenic line overexpressing the gene and an alfalfa transgenic line edited by the gene. MsLea3 MsLea3 The application constructs two different alfalfa transgenic lines based on the gene, including an alfalfa transgenic line overexpressing the gene and an alfalfa transgenic line edited by the gene. MsLea3 MsLea3 The gene produces a frameshift mutation in the gene editing alfalfa transgenic line, and the gene does not function in the gene editing line. MsLea3 The application constructs two different alfalfa transgenic lines based on the gene, including an alfalfa transgenic line overexpressing the gene and an alfalfa transgenic line edited by the gene. MsLea3 The application constructs two different alfalfa transgenic lines based on the gene, including an alfalfa transgenic line overexpressing the gene and an alfalfa transgenic line edited by the gene. MsLea3 The application constructs two different alfalfa transgenic lines based on the gene, including an alfalfa transgenic line overexpressing the gene and an alfalfa transgenic line edited by the gene. MsLea3 The application constructs two different alfalfa transgenic lines based on the gene, including an alfalfa transgenic line overexpressing the gene and an alfalfa transgenic line edited by the gene. MsLea3 The application constructs two different alfalfa transgenic lines based on the gene, including an alfalfa transgenic line overexpressing the gene and an alfalfa transgenic line edited by the gene. MsLea3 The application constructs two different alfalfa transgenic lines based on the gene, including an alfalfa transgenic line overexpressing the gene and an alfalfa transgenic line edited by the gene. MsLea3 The application constructs two different alfalfa transgenic lines based on the gene, including an alfalfa transgenic line overexpressing the gene and an alfalfa transgenic line edited by the gene. MsLea3 The application constructs two different alfalfa transgenic lines based on the gene, including an alfalfa transgenic line overexpressing the gene and an alfalfa transgenic line edited by the gene. MsLea3 The application constructs two different alfalfa transgenic lines based on the gene, including an alfalfa transgenic line overexpressing the gene and an alfalfa transgenic line edited by the gene. MsLea3 The application constructs two different alfalfa transgenic lines based on the gene, including an alfalfa transgenic line overexpressing the gene and an alfalfa transgenic line edited by the gene. MsLea3 The application constructs two different alfalfa transgenic lines based on the gene, including an alfalfa transgenic line overexpressing the gene and an alfalfa transgenic line edited by the gene. MsLea3 The application constructs two different alfalfa transgenic lines based on the gene, including an alfalfa transgenic line overexpressing the gene and an alfalfa transgenic line edited by the gene.
[0042] In the following examples of the application, the experimental material alfalfa 'Zhongmo No. 1' is a known alfalfa variety from the present art, which is donated by Professor Lin Qing, College of Life Sciences, Inner Mongolia University.
[0043] In the following examples, the p6401 vector and p5CBC were kindly provided by Professor Dong Jiangli of the School of Life Sciences, China Agricultural University, as described in the article “ZHU, F., YE, Q., CHEN, H., DONG, J. & WANG, T. 2021. Multigene editing reveals that MtCEP1 / 2 / 12 redundantly regulate lateral root and nodule number in Medicago truncatula. J. Exp. Bot.”
[0044] In the following examples, the plasmid pCAM1307 was disclosed in the Chinese patent CN 116640201 A: Application of MfERF026 gene in regulating growth and development and stress tolerance of alfalfa. 2023.08.25, and was preserved in our laboratory.
[0045] In the following examples, the formulations of each medium are as follows:
[0046] The MSBK medium formulation is: MS basal medium 4.43 g / L, sucrose 30 g / L, kinetin 1 mg / L, 6-BA 0.5 mg / L, Timetin 150 mg / L, hygromycin B 5 mg / L and plant gel 3 g / L, pH 5.8-6.0.
[0047] The SH9 medium formulation is: In addition to the basic medium: MgSO4·7H2O 185 mg / L, KNO3 2830 mg / L, (NH4)2SO4 463 mg / L, CaCl2·2H2O 166 mg / L, KH2PO4 400 mg / L, MnSO4·H2O 10 mg / L, H3BO3 5.0 mg / L, ZnSO4·7H2O 1.0 mg / L, KI 1.0 mg / L, Na2MoO4·2H2O 0.1 mg / L, CuSO4·5H2O 0.2 mg / L, CoCl2·6H2O 0.1 mg / L, EDTA-FeNa 140 mg / L, thiamine hydrochloride 5.0 mg / L, pyridoxine hydrochloride 5.0 mg / L, nicotinic acid 5.0 mg / L and myo-inositol 100 mg / L, it also contains: sucrose 20 g / L, Timetin 150 mg / L, hygromycin B 5 mg / L and plant gel 3 g / L, pH 5.8-6.0.
[0048] The MSO medium formulation is: MS basal medium 2.22 g / L, sucrose 5 g / L and plant gel 3 g / L.
[0049] In the following examples, the formula of the 1 / 2 Hoagland solution is as follows: Ca(NO3)2·4H2O 4 mmol / L, KNO3 5 mmol / L, NH4NO3 1 mmol / L, KH2PO4 1 mmol / L, MgSO4·7H2O 2 mmol / L, KI 5 µmol / L, H3BO3 100 µmol / L, MnSO4·H2O 100 µmol / L, ZnSO4·7H2O 30 µmol / L, Na2MoO4·2H2O 1 µmol / L, CuSO4·5H2O 0.1 µmol / L, CoCl2·6H2O 0.1 µmol / L, FeSO4·7H2O 50 µmol / L, and Na2EDTA 50 µmol / L, pH 5.8-6.0.
[0050] In the following examples, the test methods used are conventional test methods unless otherwise specified; the materials, reagents, etc. used are reagents and materials available through commercial channels unless otherwise specified.
[0051] The technical solutions in the present application will be described clearly and completely below in combination with the examples in the present application.
[0052] Example 1
[0053] Medicago sativa MsLea3 Obtaining of the gene
[0054] Extraction of total RNA of Medicago sativa ‘Zhongmo 1’: The total RNA of Medicago sativa ‘Zhongmo 1’ was extracted by using the liquid nitrogen grinding method and the Trizol RNA extraction reagent of Takara Bio Company.
[0055] Reverse transcription to synthesize cDNA was performed according to the instructions of the reverse transcription kit (product number: RR047A) of Takara Bio Company.
[0056] PCR was performed with MsLea3 -F (SEQ ID NO. 1) and MsLea3 -R (SEQ ID NO. 2) as primers and the cDNA synthesized by reverse transcription as a template.
[0057] The sequence of the MsLea3 -F is: ATGGCAGCAACAATGTTGAC (SEQ ID NO. 1).
[0058] The sequence of the MsLea3 -R is: TTACTCCTTCCCAGCCACG (SEQ ID NO. 2).
[0059] PCR conditions: pre-denaturation 95℃ 5min; denaturation 98℃ 10sec; annealing 58℃ 30sec; extension 68℃ 1min, denaturation to extension 30 cycles; post-extension 68℃ 10min; 4℃ preservation.
[0060] The PCR reaction system is shown in Table 1 as follows:
[0061] Table 1 PCR reaction system
[0062]
[0063] After the PCR reaction, the SanPrep column DNA gel recovery kit from Shenguo Bioengineering Co., Ltd. was used to recover the target fragment, and the operation was performed according to the method of the kit instruction.
[0064] The Medicago sativa obtained by the above method MsLea3 The recovered fragment was connected to the T vector pMD19T (TAKARA, item number 6013), and a single clone was picked for sequencing. MsLea3 The nucleotide sequence of the gene is shown in SEQ ID NO. 3, and the amino acid sequence encoded thereby is shown in SEQ ID NO. 4.
[0065] MsLea3The nucleotide sequence of the gene (579 bp) is ATGGCAGCAACAATGTTGACAAGTAACACACTCTTCCAAACCTCAAACTCATTCCCTAATGTCCCTTCACTCACCCTTCCTAAACCCTCCAGGGTCTTCTTAGCTTCCAACTGGAGAAATGCATCGGAAGGAACAAAAAACACTTCACTCAGTTGGGCTTACACTTCTTCTACAAAGACAAGAAGATACGCAGATGGAACAGCCGGCAAAGCCGGAGAAACGGTGAACGCAGGCATAGATGACATCAAACAATTCGGACAAGATGCAGATGAAAAGACAAAGGACGCTGCGAGTTCAATTGCGGATAAAGCAAAAGAAAACACAGACAAGACTGTAGAGGCAGTAGGAAGTGCTGGAGACAAGGCAAAAGATTATGCTTTTGATGCAAATGACAAAACCAAGGAAGCAATAGGTTCTGCTACTGATAAGGCAAAAGAAGGATTTGAGGCAGCAACGAAGAACACACAGGAGGCTGCTGGGTCAGCGACAGAGGCTCTGAAGAATGCAGGAGATCAGGCAAAGGAGGCGGTGGAAGGAGCGTTGGACGCGGCCAAGGATGCCGTGGCTGGGAAGGAGTAA (SEQ ID NO. 3).
[0066] MsLea3 The amino acid sequence encoded by the gene (192 AA) is MAATMLTSNTLFQTSNSFPNVPSLTLPKPSRVFLASNWRNASEGTKNTSLSWAYTSSTKTRRYADGTAGKAGETVNAGIDDIKQFGQDADEKTKDAASSIADKAKENTDKTVEAVGSAGDKAKDYAFDANDKTKEAIGSATDKAKEGFEAATKNTQEAAGSATEALKNAGDQAKEAVEGALDAAKDAVAGKE (SEQ ID NO. 4).
[0067] The sequencing results were analyzed by constructing a phylogenetic tree using the maximum likelihood method by MEGA software, as shown in Figure 1 MsLea3 The highest similarity with MsLEA3-1 (EU665182.1), and thus namedMsLea3 .
[0068] Example 2
[0069] Medicago sativa MsLea Expression pattern analysis of genes
[0070] (1) Wild type Medicago sativa 'Zhongmo No.1' normally grown to flowering was selected, and roots, stems, leaves and flowers were collected, wrapped with tin foil paper, labeled, quickly frozen in liquid nitrogen, and stored at -80°C.
[0071] The RNA of the above treated Medicago sativa samples was extracted, and cDNA was obtained by reverse transcription. The cDNA was used as a template, qRT-F (the sequence is shown as SEQ ID NO. 5) and qRT-R (the sequence is shown as SEQ ID NO. 6) were used as primers, and the operation was performed according to the instruction manual of the fluorescent quantitative kit (product number: RR047Q) of TAKARA Bio Company. MsLea3 MsLea3
[0072] MsLea3 The sequence of qRT-F is: CTCAGTTGGGCTTACACTTCTTCTAC (SEQ ID NO. 5).
[0073] MsLea3 The sequence of qRT-R is: TATGCCTGCGTTCACCGTTT (SEQ ID NO. 6).
[0074] (2) Wild type Medicago sativa 'Zhongmo No. 1' normally grown for four weeks was selected, and the treatment methods of salt, low temperature, drought, SA (salicylic acid) and ABA (abscisic acid) were used for grouping. Medicago sativa 'Zhongmo No. 1' was treated with 250 mM NaCl, 300 mM mannitol, 1 mM SA and 100 μM ABA for 0 h, 2 h, 4 h, 8 h, 12 h, 24 h and 48 h. The low temperature stress treatment method was to place Medicago sativa in a 0°C plant low temperature incubator for stress treatment for 0 h, 2 h, 4 h, 8 h, 12 h, 24 h and 48 h. The whole plant (roots, stems and leaves) of the treated Medicago sativa was wrapped with tin foil paper, labeled with stress conditions and stress time, quickly frozen in liquid nitrogen, and stored at -80°C.
[0075] The RNA of the above treated Medicago sativa samples was extracted, and cDNA was obtained by reverse transcription. The cDNA was used as a template, qRT-F (the sequence is shown as SEQ ID NO. 5) and qRT-R (the sequence is shown as SEQ ID NO. 6) were used as primers, and the operation was performed according to the instruction manual of the fluorescent quantitative kit (product number: RR047Q) of TAKARA Bio Company. MsLea3 MsLea3 qRT-R (sequence as shown in SEQ ID NO. 6) is a primer, and the operation is according to the instruction of the fluorescence quantitative kit (product number: RR047Q) of TAKARA Bio Company.
[0076] The results are shown as A in Figure 2 , MsMYBS3 The relative expression amount of the gene in the leaf of wild-type alfalfa 'Zhongmu No. 1' is the highest; Figure 2 B~F in MsMYBS3 respectively represent the relative expression amount of the alfalfa Figure 2 gene under different stress treatments of NaCl stress, 0℃ low temperature stress, mannitol stress, SA treatment and ABA treatment, according to B~F in MsMYBS3 , the alfalfa gene can respond to NaCl, 0℃ low temperature and drought (mannitol) stress and respond to SA and ABA treatment induced expression.
[0077] Example 3
[0078] MsLea3 Alfalfa MsLea3 Gene editing strain and alfalfa Gene overexpression strain
[0079] 3.1 Construction of gene editing vector p5CBC-6401- MsLea3
[0080] The gene editing method in Chinese patent 202110884895.X: alfalfa CRISPR / Cas9 genome editing system and its application is used to construct the alfalfa MsLea3 gene editing vector.
[0081] Specifically includes:
[0082] Gene editing target point design
[0083] According to the alfalfa MsLea3 gene sequence (SEQ ID NO. 3), the target point list is generated through the online target point prediction website (http: / / crispor.tefor.net / ), and the target point 1 is 5'-CCGGAGAAACGGTGAACGC-3'(SEQ ID NO. 7), and the target point 2 is 5'-GACGCTGCGAGTTCAATTG-3'(SEQ ID NO. 8).
[0084] Construction of sgRNA module
[0085] According to the target point 1 (SEQ ID NO. 7), the MsLea3 -DT1-BsF (SEQ ID NO. 9) primer andMsLea3 -DT1-F0 (SEQ ID NO. 10) primer; synthesized according to the target 2 (SEQ ID NO. 8) MsLea3 -DT2-BsR (SEQ ID NO. 11) primer and MsLea3 -DT2-R0 (SEQ ID NO. 12) primer.
[0086] MsLea3 The sequence of -DT1-BsF is ATATATGGTCTCGCTTGCCGGAGAAACGGTGAACGCGTT (SEQ ID NO. 9), wherein the 18th to 36th nucleotides are designed Mslea3 the sequence of the target 1;
[0087] MsLea3 The sequence of -DT1-F0 is GCCGGAGAAACGGTGAACGCGTTTTAGAGCTAGAAATAGC (SEQ ID NO. 10), wherein the 2nd to 20th nucleotides are designed Mslea3 the sequence of the target 1;
[0088] MsLea3 The sequence of -DT2-BsR is ATTATTGGTCTCGAAACCAATTGAACTCGCAGCGTCC (SEQ ID NO. 11), wherein the 18th to 36th nucleotides are designed Mslea3 the reverse complement sequence of the target 2;
[0089] MsLea3 The sequence of -DT2-R0 is AACCAATTGAACTCGCAGCGTCCAATTTAATGGTTCGCTTGTA (SEQ ID NO. 12), wherein the 4th to 22nd nucleotides are designed Mslea3 the reverse complement sequence of the target 2.
[0090] The primers used for constructing the p5CBC empty plasmid and the editing vector MsLea3 -DT1-BsF (SEQ ID NO. 9), MsLea3 -DT1-F0 (SEQ ID NO. 10), MsLea3 -DT2-R0 (SEQ ID NO. 12) and MsLea3 -DT2-BsR (SEQ ID NO. 11) were obtained by bridge PCR amplification with the target MsLea3 -p5CBC-DT1T2 fragment (i.e. sgRNA module).
[0091] PCR conditions: pre-denaturation 94°C 3 min; denaturation 94°C 15 sec; annealing 60°C 30 sec; extension 68°C 1 min, denaturation to extension 30 cycles; post-extension 68°C 5 min; recovery MsLea3 - p5CBC-DT1T2 fragment.
[0092] The amplification system is shown in Table 2 below;
[0093] Table 2 MsLea3- p5CBC-DT1T2 reaction system
[0094]
[0095] After the bridge PCR reaction, the product was detected by 1% agarose gel electrophoresis, the gel block containing the target fragment was cut and the fragment was recovered by a gel recovery kit.
[0096] The gel recovery fragment was sent for sequencing, and the obtained MsLea3The sequence of the p5 CBC-DT1T2 fragment is as follows: ATATATGGTCTCGCTTGCCGGAGAAACGGTGAACGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTGCAAAATTTTCCAGATCGATTTCTTCTTCCTCTGTTCTTCGGCGTTCAATTTCTGGGGTTTTCTCTTCGTTTTCTGTAACTGAAACCTAAAATTTGACCTAAAAAAAATCTCAAATAATATGATTCAGTGGTTTTGTACTTTTCAGTTAGTTGAGTTTTGCAGTTCCGATGAGATAAACCAATAGAGTGTCGTTTTAGTAAAAAAAATTATTTTAAAATGAATATCATCACTTTTCAATATAGAATTATTATTTTACTTCCAATTATACCCTCTAATTAATTTCCAAAGCATTATACCAATAGTAAATAAAGTTAGTTTAGTAAAATTGTCATATCTTTTAACATTATTATTAGATTTCTTAATTTGTGTTTAAAAGCTTTAAACGATGATCATTTTTAAACAGAGAGTATAAAGTAGTAAAATAGTACTATTAGAAATGAATTGACGTGACATGCTATGAAAAGTCTGGAAGAGTATCGATAAAAGGCTACACTAGAGGTAGCTACTTATATGCGCAGGAACTGAAATCAAAAATGAAATAAAGGAGAAGGAAGATGCATGTTGTGTTATATAAGTGAAGGAGAAGGACTTGCATGTTGTGTTATATTTGCTTGTTTTAGTCCCACATCGACTGAAACAGAAAGTATCTCGGCGTTTATATACTACAAGCGAACCATTAAATTGGACGCTGCGAGTTCAATTGGTTTCGAGACCAATAAT (SEQ ID NO. 13).
[0097] MsLea3 The 18th-36th positions of the sequence of the p5 CBC-DT1T2 fragment are MsLea3 The 806th-824th positions of the sequence of the gene editing target 1 MsLea3 The sequence of the gene editing target 2.
[0098] Construction of gene editing binary vector
[0099] Golden Gate reaction with target sequence MsLea3- p5CBC-DT1T2 fragment and p6401 vector were digested by restriction enzyme I and ligated by T4 DNA ligase, forming p5CBC-p6401- Bsa . MsLea3
[0100] Golden Gate digestion and ligation were performed using p6401 empty plasmid and MsLea3- p5CBC-DT1T2 fragment, and the reaction system is shown in Table 3.
[0101] Table 3 Golden Gate digestion and ligation reaction
[0102]
[0103] After mixing according to the system in Table 3, the reaction procedure was as follows: first step: 37°C, 5h; second step: 50°C, 5min; third step: 80°C, 10min.
[0104] After the completion of the Golden Gate digestion and ligation reaction, the product was added to E. coli DH5α competent cells, which were then placed in an ice bath for 25min, heated at 42°C for 45s, and then added to LB liquid medium without antibiotics and incubated at 37°C with shaking at 150rpm for 45min. Subsequently, the bacterial solution was spread on LB solid medium containing Kanamycin (50mg / L) and incubated at 37°C in the dark under inverted screening for 12h. Single colonies were picked and inoculated into 400μL of LB liquid medium containing Kanamycin (50mg / L) and incubated at 37°C with shaking at 230rpm for 6~8h, followed by bacterial solution PCR identification.
[0105] Results verification: the above MsLea3 -DT1-F0 (SEQ ID NO. 10) and MsLea3 -DT2-R0 (SEQ ID NO. 12) were used as primers for amplification, and the positive clones had a specific band with a size of 811bp.
[0106] The positive clone plasmid was extracted, and the p5CBC-p6401- MsLea3 sequence in the constructed transformation vector was determined by sequencing, wherein the sequencing primers were the above primers MsLea3 -DT1-BsF (SEQ ID NO. 9) and MsLea3 -DT2-BsR (SEQ ID NO. 11).
[0107] Sequencing results showed that p5CBC-p6401- MsLea3 It is MsLea3 The base sequence shown at positions 14-824 of the p5CBC-DT1T2 fragment (SEQ ID NO. 13) replaces the fragment between the BsaI restriction endonuclease cleavage sites of vector p6401, while keeping the other sequences of vector p6401 unchanged, resulting in the recombinant expression vector p5CBC-p6401- MsLea3 p5CBC-p6401- MsLea3 Vector expression targeting MsLea3 The gene contains two sgRNAs: sgRNA1 (targeting target 1) and sgRNA2 (targeting target 2).
[0108] 3.2 Overexpression vector pCAM1307- MsLea Construction
[0109] use BamH I and Xba I. Double digestion of empty vector plasmid pCAM1307 (hereinafter referred to as p1307) with enzymes. The enzyme digestion system is shown in Table 4. After mixing the system, digest at 37℃ for 1 hour and recover the linearized plasmid vector (p1307 linearized vector).
[0110] Table 4. Enzyme digestion system of p1307 vector
[0111]
[0112] use MsLea3 OE-F and MsLea3 Using OE-R primers, the clone obtained in Example 1 was coupled with the correctly identified plasmid and subjected to PCR amplification to obtain plasmid containing the OE-R primers. Bam H Ⅰ and Xba I. OE- at the restriction enzyme site MsLea Full-length cDNA was used, and the PCR conditions were the same as in Example 1.
[0113] MsLea3 The sequence of OE-F is CGGGATCCATGGCAGCAACAATGTTGAC (SEQ ID NO.14);
[0114] MsLea3 The OE-R sequence is GCTCTAGACTCCTTCCCAGCCACG (SEQ ID NO.15).
[0115] The target fragment OE was recovered using a gel recovery kit. MsLea3.
[0116] According to the linearized p1307 plasmid vector: target fragment OE- MsLea3molar ratio = 3:1, the above OE- MsLea3 Full-length cDNA gene fragments were ligated to p1307 linearized vector using T4 DNA ligase, then transformed into E. coli competent cells DH5a, after plating, positive clones were picked for PCR detection. The positive clones verified by sequencing were expanded for culture, and the plasmid was extracted for future use.
[0117] 3.3 Editing vector p5CBC-6401- MsLea3 and overexpression vector pCAM1307- MsLea3 Transformation of Agrobacterium EHA105 .
[0118] Take the gene editing vector p5CBC-p6401- MsLea3 and overexpression vector pCAM1307- MsLea3 Each 500 ng was added to 50 μL EHA105 competent cells. Frozen in liquid nitrogen for 5 min, heat shock at 28°C for 5 min, ice bath for 5 min, add 600 μL YEB liquid medium, 28°C, 200 rpm for 4 h. Take 80 μL and spread on YEB solid medium containing kanamycin (50 mg / L) and rifampicin (75 mg / L), 28°C, inverted culture for 2 days, then screen positive colonies.
[0119] Select positive single colony and expand culture to OD600 0.6-0.8, centrifuge Agrobacterium broth at room temperature at 2400 r / min for 15 min, discard supernatant, suspend the bacterial body, make OD600 reach 0.2-0.3, prepare the infection liquid for future use.
[0120] 3.4 Agrobacterium EHA105 mediated leaf disc method to transform alfalfa
[0121] Plant material selection alfalfa No. 1, infection material selection three-leaf growth state of four to six weeks. Through EHA105The alfalfa is transformed by the mediation of leaf disc method. After the infection material is washed with ultrapure water, 30 mL of hypochlorous acid rinsing solution + 20 μL of Tween-20 is added, and sterilization is performed for 8 minutes. The prepared infection solution in 3.3 above is mixed with the alfalfa, vacuum infiltration is performed on the leaves at 0.08-0.09 MPa for 10 minutes, ultrasonic treatment (40 kHz) is performed at room temperature for 5 minutes, vacuum infiltration is performed on the leaves at 0.08-0.09 MPa for 10 minutes again. The agrobacterium suspension is discarded, the agrobacterium on the surface of the leaves is absorbed on a sterilized filter paper, and is placed on a co-culture medium and dark culture is performed for 24 hours. The explants are transferred to a selection medium, subcultured every 2 weeks, and the callus culture needs 5-6 weeks. The callus with a good growth state is transferred to a MSBK medium and is cultured for 14 days until green embryoid appears. The callus with green embryoid is transferred to a SH9 medium for bud differentiation. Subculture is performed every 4-6 weeks until the buds grow large, and the buds usually grow large on the medium for 6-8 weeks. When the buds grow 2-3 fully expanded trifoliate leaves, the roots are cultured in a MSO medium (if the growth of the seedlings is strong and it is difficult to root within one month, 1 mg / L of IAA is added). The rooted plants are transplanted to vermiculite and perlite (1:1) soil for acclimatization. The surviving plants are transferred to nutrient soil and vermiculite (2:3) for culture.
[0122] 3.5 MsLea3 Detection of genetically edited alfalfa strains
[0123] PCR and sequencing methods are used to verify the transgenic strains. The leaf DNA of the surviving transgenic plants is extracted for positive seedling verification, and the primers used are MsLea3 -DT1-BsF (SEQ ID NO. 9) and MsLea3 -DT2-BsR (SEQ ID NO. 11), and the PCR conditions are the same as in Example 1. The results are shown in A of Figure 3 , M is a marker; 19-26, 17, 13, and 1 are the PCR verification results of the plants obtained by genetic transformation, and except for 22, all are transgenic positive seedlings.
[0124] The leaf DNA of the 1st, 13th, and 17th strains preliminarily detected as positive strains is used for target detection, and the primers used are p6401- MsLEA3 -F: AATGGTGGTCAGTGAGAGTGTT (SEQ ID NO. 16) and p6401- MsLEA3 -R: GCAGCCTCCTGTGTGTTCTT (SEQ ID NO. 17), and the PCR conditions are the same as in Example 1. The target sequencing identification results of the genetically edited transgenic alfalfa strains are shown in MsLea3 Figure 3 As shown in B in the figure, C13, C1, and C17 represent the three edited lines 13, 1, and 17 used in the experiment. The results showed that each line produced two editing results. In line 13, one allele (C13-7) was deleted by 3 bp, and the other allele (C13-11) was inserted by one base. In line 1, one allele (C1-1) was inserted by one base, and the other allele (C1-10) was deleted by 70 bp. In line 17, one allele (C17-6) was deleted by 7 bp, and the other allele (C17-7) was deleted by 2 bp.
[0125] 3.6 MsLea3 Detection of gene overexpression lines in alfalfa
[0126] Using PCR and Q-PCR methods to MsLea3 The gene overexpression transgenic lines were validated. RNA was extracted from leaves of surviving transgenic plants and reverse transcribed into cDNA for PCR identification. Figure 4 As shown, primers are used MsLea3 OE-F (SEQ ID NO.14) and 3×Flag-R (SEQ ID NO.18), PCR conditions were the same as in Example 1.
[0127] The sequence of 3×Flag-R is: CTACTTATCGTCATCGTCCTTGTA (SEQ ID NO.18)
[0128] Leaf cDNA samples from lines that initially tested positive were selected, and quantitative real-time qRT-PCR was used to calculate the cDNA values for each line. MsLea3 The relative expression level.
[0129] by MsLea3 qRT-F (SEQ ID NO.5) and MsLea3 qRT-R (SEQ ID NO.6) was used as the primer, and the procedure was performed according to the instructions of the TAKARA Biotech Real-Time Fluorescence Kit (catalog number: RR047Q).
[0130] like Figure 5 As shown, compared with the control ck(WT), MsLea3 Gene overexpression levels were significantly increased in all strains. These results demonstrate that... MsLea3 The gene has been transferred into the alfalfa genome and overexpressed.
[0131] The expression levels were highest in strains 8, 13, and 20. Therefore, strains 8, 13, and 20, which had high expression levels, were selected for further research.
[0132] Example 4
[0133] MsLea3Salt tolerance experiment of gene edited and overexpression lines
[0134] 4.1 Cutting of transgenic alfalfa
[0135] Select well-grown MsLea3 gene edited and MsLea3 gene overexpression lines, cut the branches with one branch point and about 7 cm long with a slanting cut, immerse the bottom cut into rooting powder solution (Solarbio rooting powder, item number 401F031) (1 g / L) for 5 minutes, insert into vermiculite poured with water, and leave 6 cm above the ground. White roots will grow in about 2 weeks, change to pour 1 / 2 Hoagland solution, and cut the control alfalfa lines in the same batch.
[0136] 4.2 Salt tolerance experiment of transgenic lines
[0137] Perform salt tolerance experiment on control lines, MsLea3 gene overexpression lines and MsLea3 gene edited lines grown in vermiculite for 4 weeks, pour 1 / 2 Hoagland solution containing 250 mM NaCl, take photos after 4 weeks to record the phenotype after salt stress Figure 7 , and then perform DAB and NBT staining, detect conductivity (EL), peroxidase (POD), catalase (CAT), superoxide dismutase (SOD) activity, and proline (Pro) content.
[0138] The DAB and NBT staining results of control lines (WT, wild-type alfalfa), MsLea3 gene overexpression lines and MsLea3 gene edited lines are shown in A of Figure 6 , the survival rate is shown in B of Figure 6 , the superoxide dismutase (SOD) activity is shown in C of Figure 6 , the catalase (CAT) activity is shown in D of Figure 6 , the peroxidase (POD) activity is shown in E of Figure 6 , the conductivity is shown in F of Figure 6 , and the proline (Pro) content is shown in G of MsLea3 . The results show that compared with WT, MsLea3 gene edited and overexpression lines have higher survival rate after stress, the survival rate of MsLea3 gene overexpression lines after salt stress is 83%, MsLea3 gene edited lines is 86%, and the survival rate of wild-type alfalfa in the control group after salt stress is 70%, MsLea3 gene overexpression lines and MsLea3The survival rate of the gene edited strain is higher than that of the wild type alfalfa in the control group. MsLea3 The SOD, POD and CAT enzyme activities of the gene edited strain are higher, indicating Figure 7 The gene edited strain has stronger salt tolerance, mainly by increasing the SOD, POD and CAT enzyme activities to enhance the salt tolerance.
[0139] Through MsLea3 It can be seen that the leaves of the control group (WT) appear yellowing or wilting, MsLea3 The leaf damage degree of the gene edited strain and the overexpression strain after four weeks of stress is obviously lower than that of the control group (WT), and basically no leaf yellowing or wilting occurs, further indicating MsLea3 The gene overexpression strain and The gene edited strain has stronger salt tolerance.
[0140] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which all belong to the protection scope of the present application.
Claims
1. The use of the MsLEA3 gene for regulating salt tolerance of alfalfa in improving salt tolerance of alfalfa or cultivating salt-tolerant alfalfa, characterized in that, The polynucleotide sequence of the MsLEA3 gene is shown as SEQ ID NO.
3.
2. The use of the MsLEA3 protein for regulating salt tolerance of alfalfa in improving salt tolerance of alfalfa or breeding salt-tolerant alfalfa, characterized in that, The amino acid sequence of the MsLEA3 protein is shown as SEQ ID NO.
4.
3. Use of a gene editing binary vector containing a CRISPR / Cas9 genome editing system in improving salt tolerance of alfalfa or breeding salt-tolerant alfalfa, characterized in that, The gene editing binary vector containing the CRISPR / Cas9 genome editing system expresses sgRNA, which targets target point 1 and target point 2 on the MsLEA3 gene, and performs gene editing on the MsLEA3 gene. The sequence of the target point 1 is shown as SEQ ID No.
7. The sequence of the target point 2 is shown as SEQ ID No.
8.
4. Use according to claim 3, characterized in that, The gene editing binary vector includes a p6401 vector and a p5CBC vector.
5. The use of a biological material containing the MsLEA3 gene of claim 1 in improving salt tolerance of alfalfa or breeding salt-tolerant alfalfa, characterized in that, The biological material includes one of an expression cassette, a recombinant vector, or a recombinant microorganism.
6. Use according to claim 1 or 3 or 4, characterized in that, The method for improving the salt tolerance of plants is to increase the expression amount and / or activity of the MsLEA3 gene shown as SEQ ID NO. 3, or to introduce the gene editing binary vector of claim 3 into Medicago sativa to perform gene editing on the MsLEA3 gene.
7. A method of increasing salt tolerance in alfalfa, comprising, The method includes introducing the gene editing binary vector of claim 3 into Medicago sativa, or overexpressing the MsLEA3 gene of claim 1 in Medicago sativa.
Citation Information
Patent Citations
alfalfa CRISPR / Cas9 genome editing system and its applications
CN113493803B
Application of regulating MfERF026 gene in growth and development and stress tolerance of medicago sativa
CN116640201A