Application of blackberry RuCHS-1 gene
By overexpressing the blackberry RuCHS-1 gene in plants, the problem of low extraction efficiency of blackberry flavonoids in existing technologies was solved, and the flavonoid content in Arabidopsis thaliana plants was increased and the leaves turned yellow, thus enhancing the plant's stress resistance.
Patent Information
- Application Number
- CN202511132156.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-13
- Publication Date
- 2025-11-07
AI Technical Summary
Existing technologies are insufficient to effectively improve the synthesis of plant flavonoids and/or induce leaf transformation. Consequently, existing technologies cannot effectively address the application of plant flavonoids, resulting in low extraction efficiency, easy degradation of components, and insufficient bioavailability of blackberry flavonoids.
By overexpressing the blackberry RuCHS-1 gene in plants, which encodes chalcone synthase with the amino acid sequence shown in SEQ ID NO:2, a plant expression vector of the RuCHS-1 gene was constructed. This vector was then transformed into Arabidopsis thaliana using Agrobacterium-mediated transformation technology. Transgenic plants with increased flavonoid content or yellowing leaves were obtained through cultivation and screening.
It increased the flavonoid content in Arabidopsis thaliana plants, achieved the yellowing effect of leaves, enhanced the plant's stress resistance, and has broad application prospects.
Smart Images

Figure CN120905282A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of plant genetic engineering, and more particularly relates to the application of a blackberry RuCHS-1 gene. BACKGROUND
[0002] Blackberry (Rubus spp.) is an important economic crop of the Rosaceae genus Rubus, and its fruits are widely planted in the global temperate regions due to their unique flavor and rich nutrients, and a mature industrial chain of fresh consumption and deep processing (such as juice, jam, wine and functional food ingredients) has been formed. In addition to economic value, blackberry is considered as a "super fruit" and is rich in vitamins, minerals and polyphenolic active substances, among which flavonoids and flavonoids such as anthocyanins, flavonols and proanthocyanidins have been proven to have significant antioxidant, anti-inflammatory, cardiovascular protection and anticancer biological activities, and are the core components supporting their medicinal and health functions. With the upgrading of health consumption, the market demand for high-value blackberry products and their active ingredients continues to grow.
[0003] Current development of blackberry flavonoids mainly relies on physical and chemical extraction techniques (such as solvent extraction, chromatographic separation) and dosage form stabilization processes (such as microencapsulation), but there are limitations such as low extraction efficiency, degradation of components and insufficient bioavailability. In-depth research has found that the biosynthesis of flavonoids and flavonoids depends on the phenylpropanoid metabolic pathway, involving key structural genes such as PAL (Phenylalanine Ammonia-Lyase), CHS (Chalcone Synthase), ANS (Anthocyanidin Synthase) and the MYB-bHLH-WD40 regulatory complex. Although some studies have preliminarily analyzed the functions of some genes, the systematic understanding of the regulation network of flavonoids and flavonoids is still not perfect, making it difficult to precisely improve the content of target components through directed breeding.
[0004] In view of the deficiencies of the prior art, deep mining of blackberry flavonoid and flavonoid regulatory genes has become a key to breaking through the technical barriers of the industry. Its significance not only lies in revealing the molecular regulation basis of secondary metabolism, but also in enabling precise breeding: through molecular marker-assisted selection or gene editing technology to modify target genes, it is expected to create new germplasm with ultra-high flavonoid content, enrichment of specific active ingredients (such as anthocyanins) and strong stress resistance, greatly shortening the breeding cycle. SUMMARY
[0005] In view of the above problems existing in the prior art, the technical problem to be solved by the present application is to provide the application of blackberry RuCHS gene, specifically for improving plant flavonoid synthesis and / or inducing leaf yellowing.
[0006] In order to solve the above technical problems, the technical scheme adopted by the present application is as follows:
[0007] The application of blackberry RuCHS gene in improving plant flavonoid synthesis and / or inducing leaf yellowing, comprising: overexpressing blackberry RuCHS-1 gene in a plant, wherein the blackberry RuCHS-1 gene encodes a chalcone synthase with an amino acid sequence as shown in SEQ ID NO: 2.
[0008] In some embodiments, the nucleotide sequence of the blackberry RuCHS-1 gene is as shown in SEQ ID NO: 1.
[0009] In some embodiments, the application comprises the following steps:
[0010] (1) constructing a plant expression vector of RuCHS-1 gene;
[0011] (2) transforming the plant expression vector of RuCHS-1 gene into plant tissues or cells;
[0012] (3) cultivating the transgenic plants with improved flavonoid content or leaf yellowing.
[0013] In some embodiments, the method for constructing the plant expression vector of RuCHS-1 gene is specifically as follows: inserting an expression cassette of the blackberry RuCHS-1 gene into a vector skeleton, wherein the vector skeleton comprises a plant selective marker gene and / or a terminator sequence.
[0014] In some embodiments, the method for constructing the expression cassette of the blackberry RuCHS-1 gene is as follows: connecting the blackberry RuCHS-1 gene with a plant functional promoter to form an expression cassette.
[0015] In some embodiments, the plant functional promoter is a cauliflower mosaic virus 35S promoter.
[0016] In some embodiments, the transformation is performed by Agrobacterium transformation.
[0017] In some embodiments, the plant is Arabidopsis thaliana.
[0018] The transgenic plant obtained by any of the above applications or a part thereof can be used in the preparation of a plant extract or product with high flavonoid content.
[0019] The transgenic plant obtained by any of the above applications or a part thereof can be used as a model for studying plant flavonoid metabolic pathways or leaf pigment regulation.
[0020] Compared with the prior art, the application has the following advantages:
[0021] The present application carries out bioinformatics and expression pattern analysis on CHS family related genes in blackberry which may be related to thorn development and flavonoid synthesis, clones the blackberry CHS-1 gene and carries out function verification. The results show that there are 11 CHS family members in blackberry, the relative molecular weight of the encoded protein is between 95.8-139.2kDa, and the theoretical isoelectric point is between 4.92-5.1. The RuCHS-1 gene of chalcone synthase with the nucleotide sequence shown as SEQ ID NO:1 and the encoded protein amino acid sequence shown as SEQ ID NO:2 is genetically transformed into Arabidopsis, and the transgenic Arabidopsis plants obtained are higher than the CK control plants in total phenol and flavonoid content compared with the wild type. These experimental results show that the blackberry RuCHS-1 gene provided in the present application is a key enzyme gene for regulating the synthesis of flavonoid substances in blackberry, and has an important role in the synthesis of flavonoid substances, and is expected to be applied to cultivate transgenic plants with high content of flavonoid compounds and phenolic compounds, and has a broad application prospect in the field of plant medicine preparation technology and the cultivation of ornamental plants. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 CHS gene motif analysis chart;
[0023] Figure 2 CHS conserved domain analysis chart;
[0024] Figure 3 CHS family phylogenetic tree chart;
[0025] Figure 4 Blackberry 'Early Red' and 'Boson' different parts CHS gene expression analysis chart; wherein, A is 'Early Red' variety, B 'Boson' variety;
[0026] Figure 5 Arabidopsis genetic transformation process and PCR amplification results; A: Arabidopsis genetic transformation process of RuCHS-1 gene; B: Positive seedling detection of RuCHS-1 transgenic Arabidopsis; a: Arabidopsis planting; b: Arabidopsis infection; c: Arabidopsis transformation; d: Arabidopsis screening; e: Arabidopsis seedling transplanting; f: Arabidopsis seed collection;
[0027] Figure 6-1 Arabidopsis CHS and related genes (CHS, CPC, EGL3, ETC1, ETC3, GL2) high expression strain chart;
[0028] Figure 6-2 Arabidopsis CHS and related genes (TCL1, TTG1, TRY) high expression strain chart;
[0029] Figure 7Figure 1 is a comparison of the phenotype of the T3 generation of the positive seedlings of the RuCHS transgenic Arabidopsis thaliana with the wild type; A is a comparison of the leaf color; B is a comparison of the growth state. DETAILED DESCRIPTION
[0030] In order to make the purpose, technical solutions and advantages of the present application clearer, the present application will be further described below in combination with specific examples. In the following examples, if not specifically described, the technical means used are all conventional means familiar to those skilled in the art. Or according to the instructions of the kit and product. In the following examples, the materials, reagents, etc. used, if not specifically described, can be obtained from commercial channels.
[0031] Example 1
[0032] I. Method
[0033] (1) Plant material
[0034] In this study, the stems, leaves and fruits of different developmental stages of the blackberry cultivars 'Early Red' and 'Bosman' from the experimental base of the Bai Ma Town of Lishui District in Nanjing City of Jiangsu Province were collected. After being picked, they were immediately frozen in liquid nitrogen and then stored in a -80℃ refrigerator for RNA extraction.
[0035] (2) RNA extraction, cDNA synthesis and gene cloning
[0036] The total RNA of blackberry was extracted using a plant total RNA extraction kit (BioTeke, Beiing, China), and the integrity of the RNA was detected by agarose gel electrophoresis. The concentration and purity of the RNA were detected using a Nanodrop 2000c spectrophotometer (Thermo Fisher, Waltham, MA, USA). The cDNA was reverse transcribed using a PrimeScript RT Master Mix kit (TaKaRa, Otsu, Japan). The cloning primers (Table 1) were designed using Oligo 7.0 software, and the open reading frame (ORF) sequence of the candidate gene was cloned using a high-speed high-fidelity PCR enzyme PrimeSTAR Max DNA Polymerase (TakaRa, Otsu, Japan). The 50 μL PCR reaction system: Primer Star Max 25 μL, 1 μL of forward and reverse primers, 1 μL of cDNA template, 22 μL of ddH2O. PCR reaction program: 98℃ for 3 min; 98℃ for 10 s, 55℃ for 5 s, 72℃ for 15 s, 45 cycles; 72℃ for 3 min, 4℃ permanent preservation. After the PCR reaction was completed, the PCR product was detected by 1% agarose gel electrophoresis, and the band with the predicted target gene amplification product length was cut off.
[0037] Table 1 PCR primer information
[0038] Gene name Forward primer Reverse primer RuCHS1 ATGGTGACCGTCGATGAAGTC GACCTGCTCAATTATACG AtEGL3 AGTGTTGGAGTGGGGAGATG CGACTGAACCGAGTGAGAAT AtTTG1 ATGGATAATTCAGCTCCAG TCAAACTCTAAGGAGCTGC AtTRY ATGGATAACACTGACCGTCG CTAGGAAGGATAGATAG AtTCL1 ATGGATAACACAAACCGTC TCATTTGTGGGAGAAATAGTC AtCPC ATGTTTCGTTCAGACAAGGC TCATTTCCTAAAAAAGTCTC AtETC1 ATGAATACGCAGCGTAAGTC TCAACGTAATTGAGATCTTCG AtETC3 ATGGATAACCATCGCAGGAC TCAATTTTTCATGACCCAAAAC AtUBC CTGCGACTCAGGGAATCTTCTAA TTGTGCCATTGAATTGAACCC RuCHS GGGCCTAGTGACACCCACCT GCCGCCGAGACCAACTCAAA RuLIM TGCCACCACTGCAAAGGAACC ACGCACTTGTCCTGAGTCCCA RuMYB GCTTGGATGGCAGCTGAAGACA AGCCTGCAGCTCTTCCCACA RubHLH2 CCGGTGGCAGATGTCGAAGC CGTCGGAGCGCAAACTCTGT RuNAC1 GCAGCTGCCAGAGAAGGCAA TCGTGCTCCGTTCGGGTACT RuNAC2 CCAAGGCAGGGCTCCCAAAG GCCGGTGTCGTCGTCATAGC RuWRKY GGGTCATGGGCATAGGGTTGC AGAGCTGCGCACAGTTGGG RuPOD TGGAGGCTTCATGCCCTGGT TGTGCCCTCCTGAAAGAGCCA 18S ACGTCATCCTCCGGCAAAGC ACGACGAAGCTCGCAAGTACAC
[0039] The cut electrophoresis gel was recovered and purified using a BioTeKe rapid agarose gel DNA recovery kit, and then the purified product was ligated with a vector according to the requirements of the pClone007Blunt Vector Kit kit (TSINGKE company), and then transformed into E. coli competent cells. After short recovery, it was coated on ampicillin-resistant LB medium. After overnight culture, single colonies were randomly selected and transferred into ampicillin-resistant LB culture solution, and then incubated in a constant temperature shaker for 8 h (the shaker was set at 37°C and 200 r / min). 2xT5 Super PCR Mix (Colony) kit (TSINGKE company) was used for bacterial liquid PCR verification, and positive bacterial liquid was sent to Nanjing Qikexin Biotechnology Co., Ltd. for first-generation sequencing. The bacterial liquid PCR system was 15 μL: 2xT5 Super PCR Mix 7.5 μL, forward primer 0.75 μL, reverse primer 0.75 μL, bacterial liquid 1.5 μL, ddH2O 4.5 μL. The bacterial liquid PCR reaction program was 98°C for 2 min; 98°C for 10 s, 55°C for 10 s, 72°C for 15 s, 35 cycles; 72°C for 2 min, 4°C for permanent incubation. After sequencing, the plasmid extraction kit (Baiteke company, Cat#DP1003) was used to extract the E. coli plasmid of the bacterial liquid with correct sequence alignment, and then stored in a -20°C refrigerator for subsequent experiments.
[0040] (3) Expression analysis
[0041] Based on the FPKM and log2Fold Change values in the transcriptome data of the CHS gene family, TB tools software was used for calculation and drawing of the expression trend and pattern heat map.
[0042] (4) Protein physicochemical property analysis
[0043] The physicochemical properties of the proteins were analyzed using the ProtParam online tool (https: / / web.expasy.org / protparam / ); the subcellular localization of the proteins was analyzed using the online tool wolf psort (https: / / wolfpsort.hgc.jp); the secondary structure of the proteins was analyzed using the SOPMA online tool (https: / / npsa-prabi.ibcp.fr / cgi-bin / npsa_automat.pl?page=npsa_sopma.htmL); the three-dimensional model of the proteins was constructed and verified using SWISS-MODEL (https: / / swissmodel.expasy.org / ); the conserved motifs of the proteins were predicted using the online tool MEME (http: / / meme-suite.org / ); the conserved domains of the proteins were analyzed using NCBI (https: / / www.ncbi.nlm.nih.gov / Structure / bwrpsb / bwrpsb.cgi); the phosphorylation sites of the proteins were predicted using the online tool NetPhos (https: / / services.healthtech.dtu.dk / service.php?NetPhos-3.1); and the glycosylation sites of the proteins were predicted using the online tool NetNGlyc-1.0 (http: / / www.cbs.dtu.dk / services / NetNGlyc / ).
[0044] (5) Sequence alignment and phylogenetic tree analysis
[0045] The CHS gene family in the blackberry transcriptome data was analyzed by alignment using DNAMAN 6.0 software. The 20 protein sequences with the highest similarity to the target gene (CHS) were found through the NCBI database, the parts with low alignment quality were removed through the Clustal W function in MEGA 11 software, and then the phylogenetic tree was constructed by the neighbour-joining (NJ) method with 1000 bootstrap tests in MEGA 11 software.
[0046] (6) Fluorescent quantitative expression analysis
[0047] To verify the accuracy of differentially expressed genes in the CHS gene sequencing data, 10 differentially expressed genes were selected for quantitative PCR verification and analysis. Primers were designed using Primer Premier 5.0 software (Table 1), and total RNA from different parts of 'Zaohong' and 'Baosen' 'various' cultivars, including stem segments, prickles, leaves, and fruits, was reverse transcribed into cDNA using the TaKaRa PrimeScript RT Master Mix (Perfect Real Time) kit (Baori Biotechnology Co., Ltd.). Blackberry 18S was used as an internal control, and 2... -ΔΔCt Methods for calculating gene expression levels. RT-qPCR reactions were performed using TB Green Premix Taq II (Tli RNASEH Plus) (TaKaRa, Dalian, China), and quantitative analysis was performed on a Quant Studio 3 (ABI, ThermoFisher Scientific, USA) instrument. The 15 μL reaction mixture contained 7.5 μL TB Green Premix Taq II fluorescent dye, 1 μL cDNA template, 0.6 μL each of upstream and downstream primers, and 5.3 μL ddH2O. Graphs were created using Origin 2021 and Adobe Photoshop 2020.
[0048] (7) Vector construction and Arabidopsis genetic transformation
[0049] A positive vector homologous recombination primer, RuCHS, containing restriction enzyme sites, was designed for the ORF region of the RuCHS-1 gene. An overexpression homologous recombination primer, RuCHS, containing restriction enzyme sites, was also designed for the RuCHS gene. The vector primers consisted of upstream and downstream primers designed at both ends of the ORF, with a 21 bp sequence identical to the end of the linearized vector added to the 5' end of each primer. The blackberry RuCHS gene ORF region was amplified by PCR and then forward-directed into the p35SGK binary expression vector via double enzyme digestion and ligation. After vector construction, double enzyme digestion identification and target gene PCR detection were performed, and positive clones were selected for sequencing. Primer synthesis and recombinant sequencing were performed by Nanjing Qingke Biotechnology Co., Ltd. Agrobacterium was picked and resuspended to prepare OD... 600Agrobacterium resuspension liquid = 0.8-1.2, silwet-77 is added to a concentration of 0.02%, all inflorescences of Arabidopsis thaliana material are dipped in the bacterial liquid for 2-3 s, the film is sealed to maintain humidity > 90%, and the culture is carried out in the dark at 25°C for 24 h. The period of immersion is 7 days, and the immersion is carried out 3 times. The immersed Arabidopsis thaliana seedlings are placed in 23°C 16h / 8h light / dark culture, and seeds are allowed to be formed; the mature fruit pods are gently rubbed onto clean white paper, wrapped and dried at 37°C for 24 h. After drying is completed, the seeds are sieved with a 60-mesh sieve, and the clean seeds are stored at 4°C. The seeds are sterilized with 95% ethanol for 10 min, 75% ethanol for 10 min, and sterile water for 2-3 times, 1 min each time, and are uniformly spread on the corresponding resistant screening medium, and are placed at 4°C for 2-3 days; the plate is taken out and placed at 23-25°C, 16h / 8h light / dark culture for 10-14 days. The screening concentration is hygromycin 35 mg / L, kan 60 mg / L, and Basta 20 mg / L. The surviving seedlings are transplanted into nutrient soil and cultured at 23°C, 16h / 8h light / dark.
[0050] (8) Detection and analysis of positive plants
[0051] When the seedlings grow for about 20 days, the Arabidopsis thaliana genomic DNA is extracted by the CTAB method, and PCR detection is carried out, and the detection method is the same as that of Agrobacterium bacteria. Before infection, select healthy Arabidopsis thaliana plants in the flowering stage, pour water, and cut off the fruit pods. The inflorescences are immersed in the resuspension liquid and shaken gently, and are removed after 1 min of infection; the excess resuspension liquid on the Arabidopsis thaliana plant is shaken off, the plant is wrapped with plastic wrap, and is placed on a tray in the dark for 24 h, and then the plastic wrap is removed and the plant is placed upright for culture; after 7 days, the second transformation is carried out again; after the Arabidopsis thaliana is cultured to maturity, all mature seeds are collected, and are recorded as T0 generation; a small amount of T0 generation transgenic Arabidopsis thaliana seeds are sterilized and sterilized, and are sown on MS solid medium containing 35 mg / L Kan. Select healthy seedlings and transplant them into the culture medium. After the Arabidopsis thaliana is cultured to maturity, all seeds are collected and recorded as T1 generation; the same method is used for resistance screening of Arabidopsis thaliana, and the Arabidopsis thaliana seeds are collected and recorded as T2 generation; the same method is used for resistance screening of Arabidopsis thaliana, and T3 generation seeds are obtained. The T3 generation seeds are sown, and the growth conditions are observed and recorded. The T3 generation of each strain of the target gene and the related gene of the thorn formation (Table 1) is verified by fluorescent quantitative PCR, and the Arabidopsis thaliana reference gene AtUBC (GenBank accession number AT5g25760) is from the reported sequence.
[0052] II. Results
[0053] (1) Bioinformatics analysis
[0054] The physical and chemical properties of the proteins encoded by the genes were analyzed using ProtParam software (Table 2). The results showed that the molecular weights of the proteins encoded by the 11 CHS genes were 96.5, 95.8, 96.6, 171.1, 95.4, 101.2, 139.2, 111.3, 1023, 86.3, and 103.2 kDa, respectively, the theoretical isoelectric points were between 4.92 (CHS-4) and 5.1 (CHS-10), the instability coefficients were between 37.21 (CHS-8) and 51.13 (CHS-2), and the subcellular localization showed that the CHS genes were mainly located in chloroplasts, cytoplasm, and plasma membranes, and most of them were located in cytoplasm and chloroplasts.
[0055] Table 2 Physical and chemical properties of the proteins encoded by the genes and their family members
[0056]
[0057]
[0058] The structural motifs of the CHS gene family members were analyzed using the online analysis website MEME (Fig. 2). Figure 1 It was found that CHS-1 (i.e., RuCHS-1), CHS-2, and CHS-3 had high similarity and contained six common motifs; CHS-9 and CHS-11 had high similarity and contained seven common motifs; CHS-5 and CHS-6 had high similarity and contained five common motifs; CHS-7 and CHS-8 had high similarity and contained seven common motifs; CHS-4 contained ten motifs, and all CHSs had motif 2.
[0059] The conserved domains of the CHS gene family-related genes were analyzed using the CD search online tool of NCBI (Fig. 3). Figure 2 The results showed that the CHS-1, CHS-2, and CHS-3 genes in the CHS family contained the PLN03173 superfamily domain, the CHS-5 and CHS-6 genes contained the PLN03169 superfamily domain, the CHS-7, CHS-8, CHS-9, CHS-10, and CHS-11 genes contained the PLN02377 superfamily domain, and the PLN03170 superfamily and PLN03172 superfamily domains were unique to the CHS-4 gene.
[0060] The secondary structure of the translated proteins of each gene was analyzed using the SOPMA online tool (Table 3). The results showed that the a-helix accounted for 39.17% (CHS-6) to 50.22% (CHS-8) in the translated proteins of the CHS gene family, the β-sheet accounted for 4.36% (CHS-8) to 6.20% (CHS-2), the random coil accounted for 32.74% (CHS-8) to 39.86% (CHS-4), and the extended strand accounted for 11.79% (CHS-7) to 15.09% (CHS-6).
[0061] Table 3 Secondary structure of proteins
[0062]
[0063]
[0064] The blackberry CHS gene sequences were compared and analyzed with other species gene sequences included in GeneBank by the BLAST tool in NCBI, and the top 20 genes with the highest similarity were selected (if the total number of gene sequences was not 20, all were selected). Multiple alignment of gene sequences was performed using DNAMAN 6 software, and it was found that PLN03173 superfamily and PLN02377 superfamily were the main domains in the CHS gene family. Figure 3 ), CHS-1 and CHS-2 had the closest genetic relationship with raspberry (Rubus idaeus) CHS-1 and raspberry CHS-2, and had a relatively distant genetic relationship with Pyrus communis CHS-1 and Pyrus communis CHS-2; CHS-3 had the closest genetic relationship with raspberry CHS-3, and had a relatively distant genetic relationship with Pyrus communis CHS-1 and Pyrus communis CHS-2; CHS-4, CHS-5, CHS-6, CHS-7, CHS-8, CHS-9, CHS-10 and CHS-11 had the farthest genetic relationship with raspberry CHS-1 and raspberry CHS-2.
[0065] Figure 3each branch is specifically CHS family CHS-1 (Raspberry Rubus idaeus: AF400565.1: 51-1223); CHS-2 (Raspberry Rubus idaeus: AF400566.1: 76-1248); CHS-3 (Raspberry Rubus idaeus: AF400567.1: 71-1232); CHS (Rose R. hybrid: AB038246.1: 13-1174); CHS (Rose R. rugosa: KT809351.1: 1-1162); CHS-1 (Strawberry Fragaria x ananassa: AY997297.1: 27-1186); CHS-2 (Strawberry Fragaria x ananassa: AB201757.1: 1-1160); CHS (Cherry Plum Prunus cerasifera: KP772275.1: 1-1163); CHS (Malus toringoides: HQ853494.1: 110-1271); CHS (Peach Prunus persica: HM543568.1: 80-1242); CHS-1 (Apple Malus x domestica: EU872156.1: 1-1162); CHS (European Mountain Ash Malus sylvestris: XM 050264325.1: 127-1288); CHS (Plum Prunus salicina: OP131915.1: 1-1163); CHS-1 (European Pear Pyrus communis: XM068476082.1: 94-1255); CHS (Wild Cherry Prunus avium: GU990524.1: 80-1242); CHS (Almond Prunus dulcis: XM 034344458.1: 77-1239); CHS (European Whitebeam Sorbus aucuparia: DQ286037.1: 1-1164); CHS-2 (European Pear Pyrus communis: DQ901397.2: 78-1239); CHS-2 (Apple Malus x domestica: AY786996.1: 1-1164); CHS (Sand Pear Pyrus pyrifolia: JN870843.1: 1-1164).
[0066] (2) Gene expression pattern analysis
[0067] Expression analysis of the RuCHS-1 gene in different parts of 'Zaohong' and 'Baosen' showed that the highest expression level of the RuCHS-1 gene was observed in the shoot tip of 'Zaohong', with significant differences compared to other parts of 'Zaohong'. The RuCHS-1 gene was also highly expressed in the shoot tip, green-red fruit, and purple-red fruit of 'Baosen', with significant differences compared to the xylem, petiole, and young leaves of 'Baosen'. The expression level in the shoot tip of 'Baosen' was 3.33 times that in the xylem, 100.12 times that in the petiole, young leaves, old leaves, and green fruit, and 1.43 times that in the purple-red fruit of 'Baosen'. Figure 4 ).
[0068] (3) Genetic transformation and expression analysis of Arabidopsis thaliana
[0069] A plant overexpression vector pCAMBIA1303 was constructed to genetically transform Arabidopsis thaliana, and the plant conditions at each stage of the RuCHS-1 gene transformation process were recorded, including planting, infection, screening, transplanting, and seed harvesting. Figure 5 A), and PCR amplification and detection were performed on potential positive lines. Figure 5 B) Individual plants of Arabidopsis thaliana that tested positive were harvested and sown, which were designated as the T2 generation. The T2 generation seeds were repeatedly screened, transplanted, RNA extracted, PCR tested, and individual positive seedlings were harvested and sown to successfully obtain T3 generation transgenic Arabidopsis thaliana seeds.
[0070] Expression levels were calculated to reveal that eight RuCHS-1-related genes were highly expressed in Arabidopsis CHS-3, CHS-4, and CHS-5 lines. The figure shows that most genes, including CPC, EGL3, and TRY, were expressed at higher levels in the CHS-5 line than in the other two lines, with EGL3 showing the highest expression in the CHS-3 line. Figure 6-1 , Figure 6-2 Eight CHS-related genes are important genes in the synthesis of flavonoids. Their expression levels are high in transgenic Arabidopsis, indicating that the RuCHS-1 gene effectively regulates the synthesis of flavonoids in Arabidopsis.
[0071] (4) Phenotypic observation of transgenic plants
[0072] Screening of positive Arabidopsis thaliana T3 generation plants ( Figure 7 Three lines (CHS-3, CHS-4, and CHS-5) with relatively high RuCHS-1 expression levels were selected for phenotypic and scanning electron microscopy observation. The results showed that the leaves of RuCHS transgenic Arabidopsis plants were yellowish compared to wild-type plants. Figure 7 A, B).
[0073] (5) Physiological indicators related to flavonoids in transgenic plants
[0074] The results of determination of 7 physiological indexes of transgenic Arabidopsis plants showed that the SOD activity of CHS-5 strain was the highest, 370.53 U / g, which was significantly different from CHS-3 and CK; the POD activity of CHS-5 was the highest, 433.6 U / g, which was significantly different from other 3 strains; the MDA and H2O2 contents of CHS-5 were the highest, 91.59 nmol / g and 0.4 mmol / g, respectively, which were significantly different from other strains; the CAT activity of CHS-5 was the highest, 1.4 U / g, and the lowest was CK (0.27 mmol / g); the total phenol and flavonoid contents of CHS-5 were the highest, 13.27 μmol / g and 0.20 mg / g, respectively (Table 4). Overall, the activities of POD, SOD and CAT and the contents of MDA, H2O2, total phenol and flavonoid in transgenic plants were higher than those in CK, and the arrangement from high to low was CHS-5>CHS-4>CHS-3>CK.
[0075] Table 4 Physiological indexes of transgenic Arabidopsis plants
[0076]
[0077] Note: In the table, capital letters represent extremely significant differences (p<0.01) between different strains, and lowercase letters represent significant differences (P<0.05) between different strains. The measured values of each physiological index are mean ± standard deviation.
[0078] In summary:
[0079] (1) There are 11 CHS family members in blackberry, and the relative molecular weights of the encoded proteins are 96.5, 95.8, 96.6, 171.1, 95.4, 101.2, 139.2, 111.3, 1023, 86.3, and 103.2 kDa, respectively. The theoretical isoelectric points are between 4.92 and 5.1. Subcellular localization shows that they are mainly located in chloroplast, cytoplasm and plasma membrane. Among the CHS gene family, 20 cis-acting elements are identified, among which the light response, hormone response, meristem expression, cell cycle regulation, defense and stress response, and flavonoid biosynthesis gene regulation elements may be related to the occurrence and development of blackberry thorns.
[0080] (2) The RuCHS-1 gene with the nucleotide sequence as shown in SEQ ID NO: 1 encodes a chalcone synthase with the amino acid sequence as shown in SEQ ID NO: 2, which contains 28 phosphorylation sites, 2 glycosylation modification sites, and 8 cis-acting elements, and is highly expressed in the stem tips of ‘Zaohong’ and ‘Baosen’, green-red fruits and purple-red fruits.
[0081] (3) The RuCHS-1 gene is genetically transformed into Arabidopsis, and the RuCHS transgenic Arabidopsis plant is yellow compared with the wild type, and the activities of POD, SOD and CAT and the contents of MDA, H2O2, total phenol and flavonoids in the transgenic plant are higher than those in the CK control plant.
[0082] The above description is only illustrative and is not restrictive, and those skilled in the art understand that many modifications, changes or equivalents can be made without departing from the spirit and scope defined by the appended claims, and all of them will fall within the protection scope of the present application.
Claims
1. Use of the blackberry RuCHS-1 gene for increasing the synthesis of plant flavonoids and / or for inducing leaf yellowing, characterized in that, Comprise: Overexpressing blackberry RuCHS-1 gene in plants, wherein the blackberry RuCHS-1 gene encodes a chalcone synthase with an amino acid sequence as shown in SEQ ID NO:
2.
2. Use according to claim 1, characterized in that, The nucleotide sequence of the blackberry RuCHS-1 gene is shown in SEQ ID NO:
1.
3. Use according to claim 1, characterized in that, The application comprises the following steps: (1) constructing a plant expression vector of the RuCHS-1 gene; (2) transforming the plant expression vector of the RuCHS-1 gene into plant tissues or cells; (3) cultivating and screening transgenic plants with increased flavonoid content or yellow leaves.
4. Use according to claim 3, characterized in that, The construction method of the plant expression vector of the RuCHS-1 gene is as follows: inserting an expression cassette of the blackberry RuCHS-1 gene into a vector backbone, wherein the vector backbone comprises a plant selective marker gene and / or a terminator sequence.
5. Use according to claim 4, characterized in that, The construction method of the expression cassette of the blackberry RuCHS-1 gene is as follows: connecting the blackberry RuCHS-1 gene with a plant functional promoter to form an expression cassette.
6. Use according to claim 5, characterized in that, The plant functional promoter is a cauliflower mosaic virus 35S promoter.
7. Use according to claim 2, characterized in that, The transformation is performed by Agrobacterium transformation.
8. The use according to claim 1, characterized in that, The plant is Arabidopsis thaliana.
9. Use of the transgenic plant obtained by the method of any one of claims 1-8 or a part thereof in preparing a plant extract or product with high flavonoid content.
10. Use of the transgenic plant obtained by the method of any one of claims 1-8 or a part thereof as a model for studying plant flavonoid metabolic pathways or leaf pigment regulation.