Method for detecting human adenovirus nucleic acid by combining RPA and CRISPR-Cas12a one-step method

Abstract

The invention discloses a rapid adenovirus detection method based on a tube of RPA-CRISPR / Cas12a (recombinase polymerase amplification-CRISPR / associated protein 12a). The method for detecting the human adenovirus nucleic acid by using the crRNA provided by the invention for the CRISPR-Cas12a technology is simple, convenient, easy to implement and rapid, and detection can be carried out in a tube when the crRNA is combined with an RPA (recombinase polymerase amplification) isothermal amplification technology. The invention also discloses a related amplification primer, a composition, a kit and a detection method. The lowest detection limit of the method for detecting the adenovirus at least reaches 45 aM, and the method has the characteristics of accuracy, sensitivity, convenience and rapidness, can be used for rapidly detecting the adenovirus, and has a wide application prospect in the field of on-site instant detection.

Description

TECHNICAL FIELD

[0001] The application discloses a crRNA molecule and a method for detecting human adenovirus nucleic acid, and belongs to the technical field of nucleic acid detection. BACKGROUND

[0002] Adenovirus (ADV) is a double-stranded DNA virus without envelope, and human adenovirus (HADV) is a member of the genus Mastadenovirus, and seven subgroups (HADV-A to HADV-G) have been identified, containing 69 serotypes and more than 70 genotypes. It usually causes mild infection of upper respiratory tract, lower respiratory tract, gastrointestinal tract and conjunctiva, and when the symptoms are severe or in specific conditions (immunocompromised patients), it can cause bloody cystitis, hepatitis, hemorrhagic colitis, pancreatitis, nephritis or encephalitis, and the mortality rate can be more than 50%. Due to the lack of humoral immunity, young children are more susceptible to HADV infection, and in addition, healthy children or adults (especially recruits) are more likely to be infected in closed or crowded environments. Therefore, therefore, being able to diagnose adenovirus infection at an early stage is an important means to effectively treat patients and reduce mortality.

[0003] Nucleic acid detection technology is increasingly favored by major hospitals and diagnostic laboratories due to its good specificity, high sensitivity and other advantages. However, a series of nucleic acid detection technologies based on the principle of polymerase chain reaction are limited to variable temperature control modules, which usually make the instrument too large to be carried to the clinical side and epidemic areas, or difficult to popularize to remote areas due to the expensive equipment price. Recombinase polymerase amplification (RPA) technology is a technology that amplifies specific fragments of target DNA under constant temperature conditions of 37-42℃ through the catalysis of recombinase and polymerase. Due to its rapidity, simplicity and isothermal characteristics, it has become the preferred amplification technology for on-site diagnosis. In addition, in vitro diagnostic technologies (DETECTR and SHERLOCK) based on Cas12a and Cas13a in the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR associated) system have been proven to be able to effectively detect pathogenic microorganisms, with good specificity and reliability. Because Cas12a-crRNA can recognize single-stranded or double-stranded DNA, it is not necessary to convert the substrate DNA into RNA, thereby saving the transcription step. Therefore, the CRISPR / Cas12a technology based on RPA pre-amplification will be more convenient for nucleic acid detection of DNA viruses.

[0004] The traditional two-step method RPA-CRISPR / Cas12a detection technology involves the transfer of pre-amplification and various manual operations, which makes the test process complex, and there is a risk of aerosol pollution in the transfer process of the amplification product. The method of adding target DNA, RPA reagent and CRISPR reagent into a tube in advance can reduce the aerosol pollution caused by secondary opening, and does not affect the sensitivity of the detection, and the detection can be completed at a constant temperature for a period of time, which is more convenient and fast.

[0005] The purpose of the present application is to provide a high-sensitivity and high-specificity nucleic acid detection method for rapidly detecting human adenovirus based on the CRISPR-Cas system, combining RPA constant temperature amplification and CRISPR fluorescence detection method. SUMMARY

[0006] The purpose of the present application is to provide a RPA method for detecting general human adenovirus, and to solve the technical problems of providing a set of specific primers and crRNA for rapidly detecting general human adenovirus, and a rapid, simple and specific general human adenovirus detection method.

[0007] To solve the above technical problems, the present application first provides a primer pair for detecting adenovirus, which can be a pair of primers for specifically amplifying an adenovirus detection target gene, and the nucleotide sequence of the adenovirus detection target gene can be SEQ ID No. 1.

[0008] Further, the primer pair can consist of primer ADV-RPA-F and primer ADV-RPA-R, the primer ADV-RPA-F can be a single-stranded DNA molecule shown in SEQ ID No. 3, and the primer ADV-RPA-R can be a single-stranded DNA molecule shown in SEQ ID No. 4. The present application also provides a composition for detecting adenovirus, which can include the primer pair and crRNA, and the sequence of the crRNA can consist of an anchor sequence and a guide sequence, and the guide sequence can be 1-21 of SEQ ID No. 2.

[0009] In the above composition, the nucleotide sequence of the crRNA can be SEQ ID No. 2.

[0010] In the above composition, the composition can further include ssDNA and / or Cas12a protein, and the ssDNA can be a reporter molecule modified with a fluorescent group and a quencher group at both ends.

[0011] Further, the nucleotide sequence of the ssDNA can be SEQ ID No. 5.

[0012] Further, the 5' end of the ssDNA can be labeled with a fluorescent group, and the 3' end can be labeled with a quencher group.

[0013] Further, the fluorescent group can be selected from at least one of FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LC RED640, LC RED705, Quasar705, or Texas Red.

[0014] Further, the quencher group can be selected from at least one of TAMRA, BHQ1, BHQ2, BHQ3, MGB, Dabcy1.

[0015] Further, the 5' end of the ssDNA can be labeled with FAM, and the 3' end can be labeled with BHQ1.

[0016] The present application also provides a kit for detecting adenovirus, which can comprise the primer pair, or a composition as described herein.

[0017] Further, the kit can be a kit for detecting adenovirus based on One-Tube RPA-CRISPR / Cas12a technology: the kit can comprise RPA amplification reagents and CRISPR / Cas12a detection reagents, wherein the RPA amplification reagents can comprise the primer pair as described in the present application (e.g., primer ADV-RPA-F and primer ADV-RPA-R); the CRISPR / Cas12a detection reagents can comprise the ssDNA, Cas12a protein, and crRNA as shown in SEQ ID No. 2.

[0018] The adenovirus comprises 7 subgroups of human adenovirus (HAdV-A to HAdV-G).

[0019] The present application also provides a method for detecting adenovirus, which can comprise detecting a sample to be tested using the primer pair, a composition as described herein, or a kit, and determining whether the sample to be tested contains adenovirus or whether the sample to be tested is adenovirus according to the detection result, and the purpose of the method is non-disease diagnosis.

[0020] Further, the method can comprise the following steps: (1) extracting DNA of a sample to be tested; (2) using the DNA of the sample to be tested as a template, performing RPA amplification using the primer pair, and simultaneously performing detection using a CRISPR / Cas12a detection system; The CRISPR / Cas12a detection system comprises the crRNA as described in claim 3.

[0021] Further, the primer pair consists of primer ADV-RPA-F (SEQ ID No. 3) and primer ADV-RPA-R (SEQ ID No. 4).

[0022] Further, the RPA-Cas12a one-step reaction system can include: freeze-dried reaction microspheres, RPA upstream primer ADV-RPA-F, RPA downstream primer ADV-RPA-R, RPA A Buffer, MgOAc, template DNA, Cas12a protein, NEBuffer2.1, ssDNA (SEQ ID No. 7) and crRNA (SEQ ID No. 2).

[0023] Further, the RPA-Cas12a one-step reaction system (30 μL) can be: 18 μL of RPA mixed solution, which contains 1 freeze-dried reaction microsphere, 2 μL of RPA upstream primer ADV-RPA-F (10 μM), 2 μL of RPA downstream primer ADV-RPA-R (10 μM), 29.4 μL of RPA A Buffer; 2 μL of template DNA, 3 μL of Cas12a protein (1 μM), 2 μL of NEBuffer2.1, 1.2 μL of ssDNA (SEQ ID No. 7) (500 nM), 3 μL of crRNA (SEQ ID No. 2) (1 μM), 2 μL of MgOAc (280 mM).

[0024] Further, the reaction conditions of the RPA-Cas12a one-step method can be: 37℃, 50 min, and the qPCR instrument records the fluorescence value in real time.

[0025] The present application first uses screening to obtain an adenovirus conserved specific target sequence (SEQ ID No. 2), and designs corresponding primers and crRNA based on this, screens ideal RPA amplification primers, and establishes an adenovirus detection method based on Cas12a. The detection method of the present application has a minimum detection limit of 45aM, has the characteristics of precision, sensitivity, convenience and speed, can quickly detect adenovirus, does not need to rely on expensive and large instruments and long reaction time, greatly saves the cost, provides reliable and effective technical support for the prevention and control of diseases caused by adenovirus infection, and has wide application prospect in the field of on-site instant detection (POCT). BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 The crRNA one-step detection effect based on different PAM sequences is designed for adenovirus ADV-RPA.

[0027] Figure 2 The fluorescence intensity analysis histogram for the sensitivity of the adenovirus RPA-CRISPR / Cas12a one-step detection method.

[0028] Figure 3 The fluorescence intensity analysis histogram for the specificity of the adenovirus RPA-CRISPR / Cas12a one-step detection method. DETAILED DESCRIPTION

[0029] The advantages and features of the present application will become more apparent with the description of specific embodiments. However, these embodiments are only exemplary and do not limit the protection scope defined by the claims of the present application.

[0030] Experimental materials LbCas12a protein (NEB), human adenovirus DNA sample (extracted and preserved by Wuhan Institute of Virology, Chinese Academy of Sciences), crRNA sequence (synthesized by Guangzhou Tianyihuiyuan Company), DNA-based isothermal rapid amplification kit (Beijing Libote Technology Co., Ltd.), ssDNA fluorescent probe (synthesized by Guangzhou Tianyihuiyuan Company).

[0031] Example 1. Design and implementation of CRISPR-Cas12a detection system 1. Design of human adenovirus CRISPR-Cas12a system target ADV virus gene sequences in the past ten years were downloaded from the NCBI database, and gene sequence alignment and phylogenetic tree were drawn using mafft software to screen ADV specific and conserved nucleic acid sequences. First, find the PAM sequence marked by TTTN or TTN in the conserved region sequence as the commonly used target sequence recognized by Cas12a, and extend 20 bp downstream of the PAM sequence as the CRISPR-Cas12a system recognition target. For example, the sequence is: 5'-TTTA TGCCTTACCAGTGTAACATG-3', that is, the PAM sequence is TTTA, and the 20 bp target sequence is: TGCCTTACCAGTGTAACATG (SEQ ID No. 1). Secondly, find the suboptimal PAM sequence marked by VTTV or TCTV and TTVV in the conserved region sequence, and extend 20 bp downstream of the PAM sequence as the CRISPR-Cas12a system recognition target. For example, the sequence is: 5'-CTTACCAGTGTAACATGAATCATG-3', that is, the PAM sequence is CTTA, and the 20 bp target sequence is: CCAGTGTAACATGAATCATGT (SEQ ID No. 2).

[0032] The crRNA for each detection target was designed and synthesized. According to the gene sequence of each target and the CRISPR-Cas12a nucleic acid detection system, the corresponding crRNA was designed. The crRNA sequence consists of two parts: the 5' end of the conserved gene sequence (scaffold / repeat part), and the 3' end of the target gene sequence. The crRNA sequence was synthesized by a biological company, and the crRNA1 sequence was UAAUUUCUACUAAGUGUAGAUUGCCUUACCAGUGUAACAUGA (SEQ ID No. 3). The crRNA2 sequence was UAAUUUCUACUAAGUGUAGAUCCAGUGUAACAUGAAUCAUGU (SEQ ID No. 4).

[0033] 2. Design of isothermal amplification RPA primers based on target sequences The design requirements of RPA isothermal amplification primers are as follows: the length of the primer is 30-35 bp, avoid continuous G bases, avoid more than four single bases, do not consider the melting temperature Tm value of the primer itself, the length of amplification is not more than 500 bp, and 100-200 bp is appropriate. Due to the high sequence variation of HADV, introduce degenerate bases (underlined), preferably no more than five. According to the position of the target nucleic acid sequence in crRNA1 and crRNA2, the forward and reverse primer sequences for amplifying two targets simultaneously are as follows: ADV-RPA-F (SEQ ID No. 5): GTG W T K ACCAAGTG Y ACCATGCA YRY AGGTGG ADV-RPA-R (SEQ ID No. 6): CCTGTTA RR CTCA Y TCTGGAAAAGGCATCTGG 3. One-step nucleic acid detection based on RPA-Cas12a system Synthesis of ssDNA fluorescent reporter probe The ssDNA sequence is labeled with FAM fluorescent group and BHQ1 fluorescent quenching group at both ends, which can constitute the ssDNA fluorescent reporter probe. The sequence of the reporter probe is: 5'-FAM-TTATT-BHQ1-3' (SEQ ID No. 7), which was synthesized by Guangzhou Tianyihuiyuan Biotechnology Co., Ltd.

[0034] Integrated isothermal amplification and fluorescent detection of CRISPR-Cas12a system The RPA-Cas12a nucleic acid detection system established in the present research is used for isothermal amplification and fluorescence detection of the human adenovirus detection target.

[0035] Table 1 RPA-Cas12a fluorescence detection system Positive result determination The amplification detection results are shown in Figure 1 , and the ADV sample is used at a concentration of 541.2 aM (3x10 8 copies / μL). Compared with the negative control and the system using crRNA1, the fluorescence of the system using crRNA2 starts to rise at 15 minutes, and the fluorescence intensity is significantly increased at 60 minutes. Statistical analysis shows that the fluorescence intensity value of crRNA2 is statistically different from that of the negative control and crRNA1.

[0036] Example 2. Sensitivity analysis of RPA-Cas12a one-step detection The ADV DNA sample is diluted with nuclease-free ddH2O to concentrations of 270 aM, 180 aM, 90 aM, 45 aM, 9 aM, and 1 aM.

[0037] The diluted DNA is used as a template, and the CRISPR-Cas12a components, Cas12a protein, NEBuffer2.1, ssDNA (SEQ ID No. 7), and crRNA (SEQ ID No. 2), are first added to the reaction system. Then, the RPA mixed solution is configured, and the A Buffer is added to the freeze-dried powder. The primers (ADV-RPA-F and ADV-RPA-R) are mixed uniformly, and then 16.8 μL of the RPA mixed solution is taken. Finally, MgOAc is added, and the mixture is mixed uniformly and placed in a qPCR instrument for fluorescence detection at 37℃. The detection results are shown in Figure 2 . Figure 2 The fluorescence detection results show that when the plasmid concentration is 45 aM, the detection results are still orders of magnitude different from the negative control. The RPA-Cas12a one-step detection technology amplifies the RPA nucleic acid amplification signal, and has high sensitivity while reducing the time and opening pollution.

[0038] Example 3. Specificity analysis of PRA-Cas12a detection The HADV RPA-Cas12a detection system provided by the present application is used to analyze whether nucleic acid samples such as herpes simplex virus (HSV), influenza A HINI, echovirus 11 (ECHO 11), and respiratory syncytial virus (RSV) will have false positive detection results. The analysis results are shown in Figure 3As shown, there was no statistically significant difference between the detection results of each pathogenic nucleic acid sample and the negative control. The fluorescence signal intensity of human adenovirus nucleic acid sample was significantly higher than that of other groups, and the specificity of PRA-Cas12a one-step detection system was good.

Claims

1. A method for detecting human adenovirus nucleic acid by combining RPA isothermal amplification technology and CRISPR-Cas12a system one-step method, characterized in that, The target nucleic acid RPA isothermal amplification and CRISPR-Cas12a detection are carried out in one tube.

2. The one-step process of claim 1, wherein, The key of the method is to use suboptimal PAMs on the target nucleotide, such as suboptimal PAM sequences marked by VTTV or TCTV and TTVV, and extend 20bp downstream of the PAM sequence as the target point recognized by the CRISPR-Cas12a system.

3. The one-step method according to claim 1, wherein the primer pair is a pair of primers specific for amplifying a target gene for detection of adenovirus, characterized in that The nucleotide sequence of the adenovirus detection target gene is SEQ ID No.

2.

4. The target nucleotide screening requirement of claim 2, wherein, The nucleotide sequence of the crRNA is SEQ ID No. 4, and the PAM sequence is CTTA.

5. A composition for detecting adenovirus, characterized by, The composition comprises the primer pair of claim 3 or 4 and the crRNA, the sequence of the crRNA consists of an anchor sequence and a guide sequence, and the guide sequence is 22-42 of SEQ ID No.

4.

6. The primer pair according to claim 3, characterized in that, The primer pair consists of primer ADV-RPA-F and primer ADV-RPA-R, the primer ADV-RPA-F is a single-stranded DNA molecule shown in SEQ ID No. 5; the primer ADV-RPA-R is a single-stranded DNA molecule shown in SEQ ID No.

6.

7. A method for detecting human adenovirus nucleic acid based on the CRISPR-Cas12a technology of the crRNA molecule of claim 2 for non-diagnostic purposes, the method comprising the following steps: (1) preparing a sample nucleic acid template; (2) using the nucleic acid template obtained in step (1), RPA reaction mixture, magnesium acetate, Cas12a protein, single-stranded DNA probe labeled with fluorescent group and fluorescence quenching group, and the crRNA molecule in the CRISPR-Cas12a technology detection system for one tube reaction; (3) detecting the fluorescence intensity of the reaction system of step (2).

8. The method of claim 7, wherein, The RPA reaction mixture comprises RPA reaction freeze-dried powder, A Buffer, amplified upstream primer ADV-RPA-F and downstream primer ADV-RPA-R.

9. The method of claim 7, wherein, The sequence of the single-stranded DNA probe is shown in SEQ ID No.

7.

10. A method for detecting adenovirus, characterized in that, The method comprises using the primer pair of claim 6, the target nucleotide of claim 3 or the kit of claim 7 to detect the sample to be tested, and determining whether the sample to be tested contains adenovirus or the sample to be tested is adenovirus according to the detection result, and the purpose of the method is non-disease diagnosis.

Images