Kit for detecting new coronavirus and identifying single base mutation based on hyper-branched rolling circle amplification and detection method thereof
A kit for detecting the novel coronavirus was constructed by combining superbranched rolling circle amplification technology with molecular beacon probes. This solves the problems of complex and costly detection methods in existing technologies, and achieves rapid, simple, and highly sensitive identification of single-base mutations, showing good application prospects.
Patent Information
- Application Number
- CN202510647794.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-08
- Publication Date
- 2025-11-07
AI Technical Summary
Existing methods for detecting COVID-19 variants are cumbersome, time-consuming, costly, and require professional personnel, making it difficult to achieve rapid and accurate identification of variants.
By employing superbranched rolling circle amplification technology combined with molecular beacon probes, and designing specific recognition probes to achieve superbranched amplification of signals, a kit was constructed for detecting SARS-CoV-2 and identifying single-base mutations.
It achieves rapid, simple, highly sensitive and specific detection of the novel coronavirus, can identify single-base mutations, and has a detection limit of up to 16.6 fM, showing good application prospects.
Smart Images
Figure CN120905442A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of detection, and particularly relates to a kit for detecting new coronavirus and recognizing single base mutation based on hyperbranched rolling circle amplification and a detection method thereof. BACKGROUND
[0002] Up to now, the new coronavirus is still evolving and mutating, including Alpha, Beta, Delta and Omicron and other variants. Therefore, accurate detection of new coronavirus variants is very important for clinical diagnosis.
[0003] At present, new coronavirus mutation can be detected at the protein and gene levels. At the protein level, ACE2 protein can be used to detect SARS-CoV-2 mutant proteins, and biosensors based on aptamers and antibodies can also be designed to distinguish mutant S proteins. At the gene level, qRT-PCR and gene sequencing are the main detection methods, which can identify SARS-CoV-2 mutations by base complementary pairing principle. In combination with gene sequencing and techniques based on different types of PCR, capillary electrophoresis, surface enhanced Raman spectroscopy (SERS), denaturing high performance liquid chromatography (dHPLC), etc. can also be used for routine screening of new coronavirus mutations. The above methods have accurate and reliable detection results, but have certain limitations, such as complicated operation process, long detection time, high cost, and the need for professional personnel. Rapid detection and identification of new coronavirus variants are important prerequisites for timely taking effective epidemic prevention measures and curbing the spread of the virus, so the development of rapid detection methods for new coronavirus variants is particularly important.
[0004] Rolling circle amplification (RCA) is a highly efficient isothermal amplification reaction that can rapidly amplify target nucleic acid fragments by adding different active enzymes and specific primers at a constant temperature. Compared with other nucleic acid amplification methods, rolling circle amplification avoids the repeated heating and cooling process in traditional PCR technology, making the nucleic acid amplification process more efficient and simple. By introducing multifunctional specific primers, exponential amplification can be easily achieved with good sensitivity and specificity. In addition, the ligation of the padlock probe has strict complementarity, which gives the rolling circle amplification reaction high specificity, and even can be used to distinguish single base mismatch. Hyperbranched rolling circle amplification (HRCA) is based on rolling circle amplification (RCA) and realizes the hyperbranched amplification of the signal by designing specific recognition probes. SUMMARY
[0005] The purpose of the present application is to provide a kit for detecting new coronavirus and recognizing single base mutation based on hyperbranched rolling circle amplification and a detection method thereof.
[0006] In order to achieve the above object and other related objects, the technical scheme provided by the present application is: a kit for detecting new coronavirus and recognizing single base mutation based on hyper-branching rolling circle amplification, comprising a target gene, a padlock probe PP and a molecular beacon PMB;
[0007] The nucleotide sequence of the target gene is:
[0008] GGAACCTCATCAGGAGA invert dT;
[0009] The nucleotide sequence of the padlock probe PP is:
[0010] P-TGAGGTTCCAAAAAAAAAAACCTCGCTACGTGTATCATCTCCTG A;
[0011] The nucleotide sequence of the molecular beacon PMB is:
[0012] / BHQ1 / atcgatagctgCCTCGCTACGTGTATCcagctatcgat / FAM / ttttttttttt.
[0013] The preferred technical scheme is: further comprising Klenow polymerase and its buffer, T4 DNA ligase.
[0014] In order to achieve the above object and other related objects, the technical scheme provided by the present application is: a detection method for detecting new coronavirus and recognizing single base mutation based on hyper-branching rolling circle amplification, mixing different concentrations of target and 2 μL of 2.5 μM padlock probe PP, 0.25 U of T4 DNA ligase and 1 μL of 10×T4 DNA ligase buffer in an EP tube; the total volume of the reaction solution is 10 μL, and the ligation reaction is carried out at 25℃ for 0.5-1.5 h; then, 2 μL of 5 μM molecular beacon PMB, 2 μL of 10×NEB2 buffer, 2 μL of 25 mM dNTPs, 2.5 U of Klenow polymerase are added, and ddH2O is supplemented to a total system of 20 μL; incubating at 37℃ for 0.5-1.5, completing the hyper-branching rolling circle amplification reaction, and finally 78-82℃ for 5-15 min to terminate the whole reaction; finally, all samples are respectively added with 80 μL of ddH2O, and then the fluorescence intensity is directly measured by using a fluorescence spectrophotometer; the excitation wavelength of the fluorescence spectrophotometer is set to 490 nm, and the fluorescence emission wavelength scanning range is 500-650 nm;
[0015] The nucleotide sequence of the target gene is:
[0016] GGAACCTCATCAGGAGA invert dT;
[0017] The nucleotide sequence of the padlock probe PP is:
[0018] P-TGAGGTTCCAAAAAAAAAAACCTCGCTACGTGTATCATCTCCTG A;
[0019] The nucleotide sequence of the molecular beacon PMB is:
[0020] / BHQ1 / atcgatagctgCCTCGCTACGTGTATCcagctatcgat / FAM / ttttttttttt.
[0021] By using the above technical solutions, the present application has the following advantages compared with the prior art:
[0022] The present application successfully constructs a kit for detecting new coronavirus targets by combining HRCA and molecular beacon probes. The developed kit is a simple, high selectivity and sensitivity new coronavirus fluorescence detection method, which can identify single base mutations and screen new coronavirus variants. The cascade amplification reaction of HRCA successfully solves the problem of low abundance detection, realizes high sensitivity detection of the target, and the detection limit can reach 16.6fM; the padlock probe connection in HRCA has strict complementarity, which gives it high specificity and can be used to distinguish single base mismatches. The kit developed based on this can be used to detect new coronavirus targets, indicating that the kit has good application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0023] Figure 1 The present application is a schematic diagram.
[0024] Figure 2 The fluorescence spectrum verifies the feasibility.
[0025] Figure 3 The super-branch RCA effect is verified.
[0026] Figure 4 The T4 DNA ligase usage dose is optimized.
[0027] Figure 5 The Klenow polymerase usage dose is optimized.
[0028] Figure 6 The polymerase reaction time is optimized.
[0029] Figure 7 The sensitivity analysis I is performed.
[0030] Figure 8 The sensitivity analysis II is performed.
[0031] Figure 9 The specificity analysis is performed. DETAILED DESCRIPTION
[0032] The present application is explained by the following specific embodiments, and other advantages and effects of the present application can be easily understood by those skilled in the art from the content disclosed in the embodiments.
[0033] Reference is made to Figures 1-9 It should be understood that the structures, proportions, sizes, etc. shown in the drawings attached to the present specification are only used to illustrate the content disclosed in the present specification for understanding and reading by those skilled in the art, and are not used to limit the defined conditions under which the present application can be implemented, and therefore do not have technical significance. Any modification of the structure, change of the proportional relationship, or adjustment of the size. The following examples are provided to better understand the present application, not to limit the present application. The experimental materials used in the following examples are commercially available from regular consumables and biochemical reagent stores unless otherwise specified.
[0034] Example 1: A kit for detecting SARS-CoV-2 and identifying single base mutations based on hyperbranched rolling circle amplification and a detection method thereof
[0035] (1) Reagents and equipment
[0036] All oligonucleotides (as shown in the following table) were synthesized by General Biotech Co., Ltd. (Anhui) and purified by high-performance liquid chromatography (HPLC). T4 DNA ligase and its 10×T4 buffer (400mM Tris-HCl, 100mM MgCl2, 100mM DTT, 5mM ATP) were purchased from Thermo Fisher Scientific (Shanghai, China). Klenow polymerase and 10×NEB2 buffer (50mM NaCl, 10mM Tris-HCl, 10mM MgCl2, 1mM DTT, pH=7.9) were from New England Biolabs (Beijing, China). 25mM dNTPs, ammonium persulfate (AP), N,N,N',N'-tetramethyl ethylenediamine (TEMED), 1×TE buffer (10mM Tris-HCl, 1mM EDTA), 5×TBE buffer (445mM Tris, 445mM boric acid, 10mM EDTA, pH=8.0), SYBR Green I, 6×DNA loading buffer and DNA Marker (25-500bp) were purchased from Sangon Biotech (Shanghai) Co., Ltd.
[0037] The nucleotide sequences of the target, padlock probe PP and molecular beacon PMB described in the present application are shown in the following table:
[0038] Sequence Name Sequence (5'-3') Target GGAACCTCATCAGGAGA invert dT PP P-TGAGGTTCCAAA AAAAAAAACCTCGCTACGTGTATCATCTCCTG A PMB / BHQ1 / atcgatagctgCCTCGCTACGTGTATCcagctatcgat / FAM / ttttttttttt
[0039] Fluorescence spectra were measured using a F97 Pro Fluorescence Spectrophotometer (Shanghai Linhong Technology Co., Ltd.). Polyacrylamide gel electrophoresis (PAGE) was run on an electrophoresis system (Bio-Rad). The electrophoresis results were visualized using a gel imaging system (Hangzhou Langji Science and Technology Co., Ltd.).
[0040] (2) Fluorescence spectrum determination and gel electrophoresis analysis
[0041] Fluorescence spectrophotometer parameter settings: the fluorescence detection excitation wavelength was set to 490 nm, and the fluorescence emission wavelength scanning range was 500-650 nm. The excitation slit and emission slit width were both set to 10 nm, and the PMT detector operating voltage was set to 650 V.
[0042] Polyacrylamide gel electrophoresis (PAGE): 8 μL of the sample to be tested was mixed with 2 μL of 6x loading buffer, 2 μL of nucleic acid dye (100x SYBR Green I) and then spotted on a freshly prepared 12% non-denaturing polyacrylamide gel. Electrophoresis was performed in a 1x TBE buffer system, with a constant voltage of 80 V, and the electrophoresis time was 90 minutes.
[0043] (3) Target detection based on HRCA
[0044] Different concentrations of target and 2 μL of 2.5 μM lock probe (PP), 0.25 U T4 DNA ligase and 1 μL of 10x T4 DNA ligase buffer were mixed in an EP tube. The total volume of the reaction solution was 10 μL, and the ligation reaction was carried out at 25°C for 1 h. Subsequently, 2 μL of 5 μM molecular beacon (PMB), 2 μL of 10x NEB2 buffer, 2 μL of 25 mM dNTPs, 2.5 U of Klenow polymerase were added, and ddH2O was added to make the total system 20 μL. Incubate at 37°C for 1 h to complete the hyperbranched rolling circle amplification reaction, and finally terminate the entire reaction at 80°C for 10 min. Finally, all samples were added with 80 μL of ddH2O and then directly measured for fluorescence intensity using a F97 Pro fluorescence spectrophotometer. The excitation wavelength of the fluorescence spectrophotometer was set to 490 nm, and the fluorescence emission wavelength scanning range was 500-650 nm.
[0045] (4) The schematic diagram is shown in Figure 1
[0046] The present application is based on the hyperbranched rolling circle amplification (HRCA) technology to construct a high sensitivity and specificity target detection system. The principle is as follows: after the target gene is modified by 3' end inverted dT sealing, it can specifically bind to the two ends of the padlock probe (PP), and is connected by T4 DNA ligase to form a circular template; then, the molecular beacon (PMB) is complementary combined with the poly-A region of the circular PP through the tail poly-T, and the rolling circle amplification (RCA) is started under the action of Klenow polymerase, to generate a long-chain repeated DNA product, which is complementary paired with the stem loop region of PMB and opens its hairpin structure, and the fluorescence signal is preliminarily restored; in this process, the opened PMB tail poly-T can bind to the free circular PP in the system again, start more polymerization reaction, form a hyperbranched DNA network structure, further exponentially amplify the target sequence and continuously open more PMB, realize the cascade amplification of fluorescence signal. When the target gene does not exist, the PP cannot be connected into a ring, and the subsequent HRCA cannot be carried out, resulting in that the PMB cannot be opened, and a very low fluorescence background signal appears.
[0047] (5) The feasibility is verified by fluorescence spectrum, as shown in Figure 2 .
[0048] (6) The effect of hyperbranched RCA is verified, as shown in Figure 3 .
[0049] The hyperbranched rolling circle amplification (HRCA) has better signal amplification effect than the rolling circle amplification (RCA).
[0050] (7) Condition optimization:
[0051] ①The T4 DNA ligase usage dose is optimized as shown in Figure 4 , and the best dose is 0.25 U T4 DNA ligase.
[0052] ②The Klenow polymerase usage dose is optimized as shown in Figure 5 , and the best dose is 2.5 U Klenow polymerase.
[0053] ③The polymerase reaction time is optimized as shown in Figure 6 , and the best reaction time is 60 minutes.
[0054] (8) Sensitivity analysis, as shown in Figure 7 and Figure 8 .
[0055] The sensitivity of this method was determined based on optimal reaction conditions. The target was diluted to different concentrations: 500 nM, 200 nM, 100 nM, 50 nM, 20 nM, 10 nM, 5 nM, 2 nM, 500 pM, 200 pM, 50 pM, 20 pM, 5 pM, 2 pM, and 500 fM, and added to the system. The fluorescence intensity gradually increased with increasing target concentration. When the target concentration was between 200 pM and 2 pM, the fluorescence intensity (F...)... 520 ) and target concentration (C target There is a good linear relationship between them, and the linear equation is F. 520 =22.44lg C target +118.65, linear correlation coefficient R 2 =0.996, the calculated detection limit (LOD) is 16.6 fM.
[0056] (9) Specificity analysis such as Figure 9 As shown,
[0057] Using H1N1, IBV, and H7N9 as interfering agents, the test results under the same experimental conditions are shown in the figure above. Only when the target is SARS-CoV-2 does the fluorescence intensity increase significantly. Furthermore, when the target is mismatched by one base, almost no fluorescence enhancement is observed, and the signal is close to that of the blank sample. These results indicate that the sensor has good selectivity for the detection of SARS-CoV-2.
[0058] 5. Conclusion
[0059] This invention successfully constructed a sensitive fluorescent sensor for detecting SARS-CoV-2 targets by combining HRCA (High-density Alternating Current Detection) and molecular beacon probes. The developed sensor is a simple, highly selective, and sensitive fluorescent detection method for SARS-CoV-2, capable of identifying single-base mutations and screening for SARS-CoV-2 variants. The cascade amplification reaction of HRCA successfully solved the problem of low-abundance detection, achieving highly sensitive target detection with a detection limit of 16.6 fM. The padlock probes in the HRCA exhibit strict complementarity, endowing it with high specificity and enabling the differentiation of single-base mismatches. The fluorescent biosensor developed based on this method can be used to detect SARS-CoV-2 targets, demonstrating its promising application prospects.
[0060] Example 2: A kit and detection method for detecting SARS-CoV-2 and identifying single-base mutations based on superbranched rolling circle amplification.
[0061] A fluorescent biosensor for detecting SARS-CoV-2 and recognizing single-base mutations based on superbranched rolling circle amplification. This invention provides the following technical solution:
[0062] A fluorescent biosensor for detecting SARS-CoV-2 and recognizing single-base mutations based on superbranched rolling circle amplification includes a linkage reaction system and an amplification reaction system.
[0063] The connection reaction system comprises a target gene, a padlock probe PP, T4 DNA ligase and a buffer thereof; the target gene is blocked at the 3' end by an inverted dT; the padlock probe is composed of a substrate chain and a molecular beacon PMB combined chain and a target combined chain, and the 5' end of the padlock probe PP is modified by a phosphate group to facilitate the catalysis of T4 DNA ligase on the 5'-P and 3'-OH of the padlock probe PP to form a phosphodiester bond and complete the connection reaction.
[0064] The amplification reaction system comprises a molecular beacon PMB, Klenow polymerase and a buffer thereof; the molecular beacon PMB is composed of a stem loop region comprising a poly-T structure and a product combined chain and a double-stranded stem portion, and the 3' end is modified by a fluorescent group, and the 5' end which is complementary to the fluorescent quenching group is modified by a fluorescent group. The poly-T structure at the tail is hybridized with the poly-A of the padlock probe PP to promote the rolling circle amplification reaction; after the product combined chain CCTCGCTACGTGTATC is hybridized and combined with the complementary strand of the substrate chain, the molecular beacon PMB is opened, and the fluorescence is recovered.
[0065] When the target exists, the target is specifically combined with the combined chains at both ends of the padlock probe PP, a circular template is formed through T4 DNA ligase, then the molecular beacon (PMB) is complementarily combined with the poly-A region of the circular PP through the tail poly-T, and under the action of Klenow polymerase, the circular PP is used as a template to replicate and extend forward to form rolling circle amplification, thereby generating a unit length chain repeated DNA product; the product is complementarily paired with the stem loop region of the PMB and opens the hairpin structure thereof, the groups modified at both ends of the PMB are away from each other, and the fluorescence signal is preliminarily recovered; at the same time, the tail poly-T of the opened PMB can be combined with the free circular PP in the system again to start more polymerization reactions, form a super-branch DNA network structure, further exponentially amplify and continuously open more PMBs, and realize cascade amplification of the fluorescence signal.
[0066] The nucleotide sequences of the target, the padlock probe PP and the molecular beacon PMB in the application are shown in the following table:
[0067] Sequence Name Sequence (5'-3') Target GGAACCTCATCAGGAGA invert dT PP P-TGAGGTTCCAAA AAAAAAAACCTCGCTACGTGTATCATCTCCTG A PMB / BHQ1 / atcgatagctgCCTCGCTACGTGTATCcagctatcgat / FAM / ttttttttttt
[0068] In some embodiments of the application, the detection method comprises the following steps: first, the target to be detected is mixed with the connection reaction system for the first time, then is added to the amplification reaction system for the second time after the reaction is completed, the polymerase activity is inactivated after the reaction is completed, and finally the fluorescence value is detected.
[0069] The reaction system of the fluorescent biosensor includes 500 nM padlock probe, 0.25 U / 10 microliters T4 DNA ligase, 500 nM molecular beacon PMB, 2.5 mM dNTP, and 2.5 U / 20 microliters Klenow polymerase. The first given reaction condition is incubation at 25°C for 1 h, the second incubation reaction condition is incubation at 37°C for 1 h, and the enzyme inactivation reaction condition is inactivation at 80°C for 10 min. When detecting the fluorescence value, the parameter setting is as follows: the excitation wavelength is set to 490 nm, the fluorescence emission wavelength scanning range is 500-650 nm, the excitation slit and the emission slit width are both set to 10 nm, and the PMT detector working voltage is set to 650 V.
[0070] Different from the conventional rolling circle amplification technology which uses a target as a primer, the method innovatively uses a target gene only as a loop recognition element, introduces a hairpin structure probe containing 10 T bases in the tail as an amplification primer, and successfully realizes efficient cascade amplification of super-branch signals. In addition, the method uses Klenow polymerase instead of the conventional Phi29 polymerase, avoids non-specific amplification, effectively shortens the reaction time, and improves the amplification efficiency. The entire detection process can be completed within 2 h only by relying on the padlock probe and the padlock probe with a tail, and the operation is simple and the reaction is rapid. The experimental results show that the method has high detection sensitivity, the detection limit can reach the pM level, and has excellent single-base mutation recognition ability, and can accurately distinguish the variant strains of the new coronavirus.
[0071] The above description is only to explain the preferred embodiments of the present application, and is not intended to limit the present application in any form. Any modification or change related to the present application made under the same inventive spirit should still be included in the scope intended to be protected by the present application.
Claims
1. A kit for detecting SARS-CoV-2 and identifying single base mutations based on hyperbranched rolling circle amplification, characterized in that: The target gene, a padlock probe PP and a molecular beacon PMB are included. The nucleotide sequence of the target gene is: GGAACCTCATCAGGAGA invert dT; The nucleotide sequence of the padlock probe PP is: P-TGAGGTTCCAAA AAAAAAAACCTCGCTACGTGTATCATCTCCTG A; The nucleotide sequence of the molecular beacon PMB is: / BHQ1 / atcgatagctgCCTCGCTACGTGTATCcagctatcgat / FAM / ttttttttttt.
2. The kit for detecting SARS-CoV-2 and identifying single base mutation based on hyperbranched rolling circle amplification according to claim 1, characterized in that: Klenow polymerase and its buffer, T4 DNA ligase are also included.
3. A detection method for detecting SARS-CoV-2 and identifying single base mutation based on hyperbranched rolling circle amplification, characterized in that: Mix the target and 2 μL of 2.5 μM padlock probe PP, 0.25 U of T4 DNA ligase and 1 μL of 10×T4 DNA ligase buffer in an EP tube; the total volume of the reaction solution is 10 μL, and the ligation reaction is carried out at 25℃ for 0.5-1.5 h; then, 2 μL of 5 μM molecular beacon PMB, 2 μL of 10×NEB2 buffer, 2 μL of 25 mM dNTPs, 2.5 U of Klenow polymerase are added, and ddH2O is added to make the total system 20 μL; incubate at 37℃ for 0.5-1.5 to complete the hyperbranched rolling circle amplification reaction, and finally terminate the whole reaction at 78-82℃ for 5-15 min; finally, add 80 μL of ddH2O to each of all samples, and then directly determine the fluorescence intensity using a fluorescence spectrophotometer; the excitation wavelength of the fluorescence spectrophotometer is set to 490 nm, and the fluorescence emission wavelength scanning range is 500-650 nm; The nucleotide sequence of the target gene is: GGAACCTCATCAGGAGA invert dT; The nucleotide sequence of the padlock probe PP is: P-TGAGGTTCCAAAAAAAAAAACCTCGCTACGTGTATCATCTCCTG A; The nucleotide sequence of the molecular beacon PMB is: / BHQ1 / atcgatagctgCCTCGCTACGTGTATCcagctatcgat / FAM / ttttttttttt.