Reagent composition for detecting different subtypes of monkey pox virus and application thereof

Abstract

The invention relates to the technical field of biological detection, and discloses a reagent composition for detecting different subtypes of monkey pox viruses and application of the reagent composition. The monkey pox virus typing detection can be realized by designing reagents aiming at specific gene segments (target sequences), and the reagents designed aiming at the gene segments are compatible with one another and do not interfere with one another even if the reagents are used in the same system, so that the detection sensitivity, specificity and accuracy can be ensured.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological detection, and in particular to a reagent composition for detecting different subtypes of monkeypox virus and application thereof. BACKGROUND

[0002] Monkeypox virus (MPXV) belongs to Orthopoxvirus genus of Poxviridae family, is an enveloped double-stranded DNA virus, with a genome length of about 197 kb, resistant to dryness and low temperature, and sensitive to organic solvents. Monkeypox virus invades the host through broken skin, mucous membranes or respiratory tract, mainly spreads through close contact (infected skin, body fluids, contaminants), with a latent period of 6-13 days. Its clinical manifestations include fever, lymphadenopathy and progressive rash (macule → pustule → scab), and the disease course is self-limiting, but the risk of severe illness is high in immunodeficient individuals.

[0003] Monkeypox virus shows a three-track evolutionary trend: Clade I (type I) continues to be highly virulent, Clade II (type II) spreads globally with mild virulence, and Clade Ib (type Ib) is a new threat with high virulence (mortality rate of 3-4%) and multiple transmission routes (droplet, contact, contamination). Its prevalence has triggered a global public health emergency response. Accurate identification of this strain is of great significance beyond individual diagnosis and treatment. Developing PCR-based accurate typing technology is not only a key support for clinical classification and treatment, but also a core tool for containing high virulent strains across borders and optimizing vaccine resource allocation. Timely and accurate laboratory confirmation of monkeypox virus is crucial to breaking the transmission chain and preventing outbreaks. Currently, the main detection method for monkeypox virus is real-time / traditional polymerase chain reaction (PCR) technology based on nucleic acid amplification technology (NAAT), which can also be detected by gene sequencing technology. Laboratory confirmation of samples is essential for skin rash exudates, blood and secretions. The current PCR technology for detecting monkeypox using loop-mediated isothermal amplification (LAMP) mainly uses single amplification technology with dye addition or visual colorimetric method for naked eye judgment. For example, a LAMP kit designed for OPG002 gene and ATI gene of monkeypox virus has a minimum reaction time of 40 minutes, and cannot stably detect 1 cp / μL of template, nor can it distinguish different subtypes of monkeypox virus.

[0004] Currently, there is no technology that can simultaneously detect monkeypox virus types I, II and Ib (multiplex typing in a single tube) using LAMP technology, and no commercial kit is available. Therefore, it is crucial to establish a one-step multiplex real-time LAMP technology to detect and identify monkeypox virus and its subtypes for the prevention and control of monkeypox outbreaks. SUMMARY

[0005] The present application aims to overcome the above-mentioned problems existing in the prior art, and provides a reagent composition for detecting different subtypes of monkeypox virus and use thereof.

[0006] To achieve the above-mentioned purpose, in one aspect, the present application provides a reagent composition for detecting different subtypes of monkeypox virus, which comprises a reagent for detecting the presence of a gene fragment as shown in at least one of SEQ ID NO: 46-48 by loop-mediated isothermal amplification technology.

[0007] In a second aspect, the present application provides a kit for detecting different subtypes of monkeypox virus, which comprises the reagent composition of the first aspect.

[0008] In a third aspect, the present application provides use of the reagent composition of the first aspect in the preparation of a kit for detecting different subtypes of monkeypox virus.

[0009] In a fourth aspect, the present application provides use of a reagent for detecting the presence of a gene fragment as shown in at least one of SEQ ID NO: 46-48 in the preparation of a kit for detecting different subtypes of monkeypox virus.

[0010] The present application can achieve the detection of different subtypes of monkeypox virus by designing reagents for specific gene fragments (target sequences), and the reagents designed for each gene fragment are compatible with each other, i.e. they do not interfere with each other even when used in the same system, which can ensure the sensitivity, specificity and accuracy of the detection.

[0011] In addition, the traditional LAMP technology generally detects by magnesium pyrophosphate precipitation (turbidity method) or fluorescent dye intercalation (such as SYBR Green), which does not have the ability to detect the subtypes of monkeypox virus. According to the preferred embodiment of the present application, the inventors introduce a strand displacement fluorescent probe based on the traditional LAMP technology, which can achieve one-step multiplex detection of monkeypox virus I / II / Ib subtypes. By using the reagent of the present application, the detection can be completed in only 20 minutes at the fastest, and the sensitivity can be as low as 1000 cp / mL, which is of great significance for rapid screening of imported diseases (monkeypox virus) at ports, and is conducive to providing technical support for the defense against the import of diseases and meeting the current needs of health quarantine. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1-3 is a result graph of detecting a positive sample by the reagent composition according to the preferred embodiment of the present application.

[0013] Figure 4-6 is a sensitivity detection result graph of the reagent composition according to the preferred embodiment of the present application.

[0014] Figure 7-9This is a graph showing the precision test results of the reagent composition according to a preferred embodiment of the present invention.

[0015] Figure 10-11 This is a graph showing the results of testing a positive sample using the reagent composition from Example 2.

[0016] Figure 12 This is a graph showing the results of testing a positive sample using a reagent composition according to a preferred embodiment of the present invention. Detailed Implementation

[0017] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0018] In this invention, the term "different subtypes of monkeypox virus" mainly includes: type I, type II and type Ib.

[0019] There are many conserved genes (marker genes / target sequences) among different subtypes of monkeypox virus. Preliminary screening protocols targeting these genes for different subtypes of monkeypox virus are constantly being updated. However, current gene detection methods based on LAMP technology still have unsatisfactory screening effects for different subtypes of monkeypox virus, with frequent instances of missed screening and false positives. In particular, it is difficult to achieve single-tube multiplexing, resulting in low detection efficiency and wasted resources. Through long-term research, the inventors of this invention have ingeniously discovered that the detection method targeting conserved genes of different subtypes of monkeypox virus has excellent sensitivity and specificity, thereby effectively improving screening accuracy, increasing the effective utilization of medical resources, and reducing the burden on patients. Therefore, this invention provides a method for in vitro detection of different subtypes of monkeypox virus by detecting the presence of the OPG002 gene, D14L gene, or dD14-16 fragment in a sample. The method provided by this invention can detect different subtypes of monkeypox virus non-invasively and rapidly.

[0020] Based on this, a first aspect of the present invention provides a reagent composition for detecting different subtypes of monkeypox virus, the reagent composition comprising a reagent having a marker gene or fragment thereof for detecting different subtypes of monkeypox virus, wherein the marker gene includes the OPG002 gene, the D14L gene, or the dD14-16 sequence. The presence of the marker gene or fragment thereof is characterized by the presence of the target sequence of the marker gene.

[0021] The gene names involved in the present application have the general meaning in the art, and the complete sequences thereof can be obtained by conventional means in the art, for example, can be obtained by querying public biological information databases such as NCBI. For example, the OPG002 gene encodes a secreted TNF-alpha-receptor-like protein, and the sequence thereof can be seen in NCBI GenBank: OQ054224.1 (1,699..2,748). The D14L gene encodes a Bcl-2-like protein interferon-beta inhibitor protein, and the sequence thereof can be seen in NCBI GenBank: AF380138.1 (19,060..19,710). The D15L gene sequence can be seen in NCBI GenBank: AF380138.1 (19,834..20,151). The D16L gene sequence can be seen in NCBI GenBank: AF380138.1 (20,205..20,438). The dD14-16 sequence relates to the deletion of D14L-D15L-D16L, and the deletion length is 1142 bp, which is a specific feature of monkeypox Clade Ib, and the present application uses "dD14-16 sequence" to represent the sequence (D14L-D15L-D16L deletion fusion region) directly connected between the gene upstream of D14L and the gene downstream of D16L after the deletion of D14L-D15L-D16L. The complete sequence of the internal standard IC gene can be referred to NCBI GenBank: NC_000007.14, and the protein encoded by the gene belongs to beta-actin, which is a protein involved in the construction of cytoskeletal structure and cell movement.

[0022] The reagent composition provided by the present application can be used to detect the presence of the complete OPG002 gene, D14L gene or dD14-16 sequence, or can be used to detect the presence of a partial fragment (for example, a single fragment or multiple fragments) in the above-mentioned genes. The inventors have found in research that the detection and analysis of the presence of a specific region in the OPG002 gene, D14L gene or dD14-16 sequence can achieve the purpose of screening different subtypes of monkeypox virus at a higher sensitivity and specificity level. Compared with the detection of complete genes, the detection of specific regions is simpler and easier to implement, and therefore the present application preferably uses reagents for detecting the presence of specific regions in the OPG002 gene, D14L gene or dD14-16 sequence in the reagent composition.

[0023] According to some particularly preferred embodiments of the present application, the reagent for detecting the presence of the marker gene or fragment thereof of different subtypes of monkeypox virus is a reagent for detecting the presence of a gene fragment with a nucleotide sequence as shown in at least one of SEQ ID NOs: 46-48 (a reagent capable of detecting the presence of a gene fragment with a nucleotide sequence as shown in one, two or three of SEQ ID NOs: 46-48). It will be understood that a combination of reagents capable of detecting the presence of a nucleotide sequence as shown in one or two of SEQ ID NOs: 46-48 is also within the scope of the present application, but in order to achieve the typing detection of monkeypox virus in one step, it is preferred that the reagent for detecting the presence of the marker gene or fragment thereof of different subtypes of monkeypox virus is a reagent for simultaneously detecting the presence of a nucleotide sequence as shown in all of SEQ ID NOs: 46-48 (a reagent containing detection of a nucleotide sequence as shown in all of SEQ ID NOs: 46-48). After a large number of attempts in research, the inventors of the present application finally obtained a reagent suitable for the detection of one, two or three gene fragments, i.e., when a reagent for detecting two or three gene fragments is simultaneously contained in the detection system, specific detection can still be achieved, and the presence of a reagent for detecting another or two gene fragments will not cause non-specific amplification. It is well known to those skilled in the art that LAMP technology is a highly efficient and rapid nucleic acid amplification method, and the design of primers faces multiple challenges in ensuring amplification efficiency and specificity, mainly including: (1) Design of multiple pairs of primers: LAMP usually requires the design of multiple pairs of primers, and each pair of primers needs to be accurately designed to ensure that they can work together to form a circular amplification structure. (2) Specificity of primers: Since LAMP requires amplification of multiple regions, the design of primers must be highly specific to avoid binding to non-target sequences and prevent non-specific amplification and false positive results. (3) Length and structure of primers: LAMP primers are usually longer to ensure stable binding under isothermal conditions, however, excessively long primers can cause annealing difficulties, affecting amplification efficiency, therefore, a balance needs to be found between primer length and amplification efficiency. (4) Interaction between primers: LAMP primers need to work together during amplification to form a circular structure, if there is incompatibility between primers, it can cause amplification failure or low efficiency, therefore, when designing primers, their interaction needs to be considered to ensure effective binding and amplification of target sequences. (5) Selection of amplification regions: LAMP usually requires amplification of multiple regions, which need to have sufficient conservation and specificity, and improper selection of amplification regions can cause amplification failure or decreased detection sensitivity. (6) Optimization of temperature and reaction conditions: LAMP reactions are usually carried out at a constant temperature, therefore, primers capable of efficient amplification at this temperature need to be designed, and excessively high or low temperatures can affect amplification efficiency. In summary, it is extremely difficult to obtain primers suitable for LAMP detection of two or even three target sequences simultaneously.

[0024] The reagent composition of the present application can detect the presence of the sequence of the target detection region (marker gene) described above, or the presence of a segment having at least 80% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 100%, or a range between any two of the above values, or any intermediate value in the range) homology to the target sequence shown in SEQ ID NO: 46-48 in the marker gene. For example, the presence of a gene fragment containing additional nucleotides based on the above sequence can be detected.

[0025] According to a preferred embodiment of the present application, the reagent composition further comprises a reagent for detecting an internal standard. The "internal standard" refers to a non-target detection gene (or a fragment thereof) that is detected together with the target detection gene (or a fragment thereof). The addition of the internal standard detection reagent can further improve the accuracy of the detection. Generally, a conservative gene known in the target detection object (e.g., the sample used for detection) can be selected as the internal standard.

[0026] Preferably, the internal standard is at least one of the conservative genes of the monkeypox virus, which is a type of gene that is stably expressed in all types of monkeypox genes.

[0027] According to a particularly preferred embodiment of the present application, the internal standard is the IC gene or a fragment thereof.

[0028] Preferably, the nucleotide sequence (target sequence) of the internal standard is shown in SEQ ID NO: 49.

[0029] In the present application, the reagents for detecting the presence of the marker gene and (optionally) the internal standard can be conventional reagents used in methods capable of performing corresponding detection in the art. For example, amplification-sequencing, biochip, fluorescence quantitative PCR, etc. (particularly LAMP technology) can be used for detection, and correspondingly, the reagent composition of the present application can use reagents commonly used in the above methods.

[0030] For example, when LAMP technology is used for detection, according to a preferred embodiment of the present application, the reagent composition comprises external primers (forward external primer F3 and reverse external primer B3), internal primers (forward internal primer FIP and reverse internal primer BIP), and optional loop primers (LB and / or LF).

[0031] Any external primer, internal primer, and loop primer capable of detecting the aforementioned marker gene and (optionally) the internal standard can be suitable for the present application. The "primer" refers to an oligonucleotide that can serve as a starting point for synthesis when placed under isothermal nucleic acid amplification conditions. The primer generally contains at least about 9, 10, or 15, or 20, or 25 or more nucleotides.

[0032] Further, the forward inner primer FIP is composed of the F2 region at the 3' end and the Flc region at the 5' end; the forward outer primer F3 is composed of the F3 region, which is complementary to the F3c region of the target sequence; the backward inner primer BIP is composed of the B2 region at the 3' end and the Blc region at the 5' end. The backward outer primer B3 is composed of the B3 region, which is complementary to the B3c region of the target sequence. When the F2 region of the forward inner primer FIP hybridizes with the F2c region of the target sequence and initiates the synthesis of the complementary strand, the amplification begins, and then the forward outer primer F3 hybridizes with the F3c region of the target sequence and extends, replacing the complementary strand connected by the forward inner primer FIP. The replacement strand forms a loop LOOP at the 5' end, and this single-stranded DNA with a loop at the 5' end is used as a template for the backward inner primer BIP, which hybridizes with the B2c region of the target sequence and initiates the DNA synthesis, forming a complementary strand and opening the 5' end loop. Subsequently, the backward outer primer B3 hybridizes with the B3c region of the target sequence and extends, replacing the complementary strand connected by the backward inner primer BIP, thereby forming a dumbbell-shaped DNA. The nucleotides are added to the 3' end of Fl by Bst DNA polymerase, which extends at the 5' end and opens the loop, and the dumbbell-shaped DNA is converted into a stem-loop structure. This structure is used as an initiator for the LAMP cycle. The circular primer is used for the exponential amplification of LAMP, and the final product obtained is a mixture of stem-loop DNAs with different stem lengths and various cauliflower-like structures with multiple loops.

[0033] In order to obtain a better detection effect, preferably, the reagent composition comprises a combination of external primers, internal primers and circular primers shown in at least one of the following (1)-(3):

[0034] (1) External primers, internal primers and circular primers for detecting the presence of the OPG002 gene: external primers with nucleotide sequences as shown in SEQ ID NO: 1-2, internal primers with nucleotide sequences as shown in SEQ ID NO: 3-4, and, optionally, circular primers with nucleotide sequences as shown in SEQ ID NO: 5-7;

[0035] (2) External primers, internal primers and circular primers for detecting the presence of the D14L gene: external primers with nucleotide sequences as shown in SEQ ID NO: 8-9, internal primers with nucleotide sequences as shown in SEQ ID NO: 10-11, and, optionally, circular primers with nucleotide sequences as shown in SEQ ID NO: 12-14;

[0036] (3) External primers, internal primers and loop primers for detecting the presence of dD14-16 sequence: external primers with nucleotide sequences as shown in SEQ ID NO: 15-16, internal primers with nucleotide sequences as shown in SEQ ID NO: 17-18, and, optionally, loop primers with nucleotide sequences as shown in SEQ ID NO: 19-21.

[0037] More preferably, the reagent composition further comprises:

[0038] (4) External primers, internal primers and loop primers for detecting IC gene (internal standard): external primers with nucleotide sequences as shown in SEQ ID NO: 22-23, internal primers with nucleotide sequences as shown in SEQ ID NO: 24-25, and, optionally, loop primers with nucleotide sequences as shown in SEQ ID NO: 26-28.

[0039] According to the present application, the loop primers can be strand displacement fluorescent probes commonly used in the art for LAMP fluorescent amplification, which can be used or not used, but in order to further shorten the detection time and achieve one-step (single tube) detection of two or three gene fragments (monkeypox virus I / II / Ib subtypes), the loop primers are used. The loop primers are modified with reporter groups and / or quenching groups to facilitate the visualization of the detection results. More preferably, the loop primers comprise unmodified loop primers (LB and / or LF) and two modified loop primers (first modified loop primer (fluorescent quenched primer, 5' quenching group + Tail + Loop) and second modified loop primer (fluorescent reporter primer, Loop + Tail + 3' fluorescent reporter group)). Among them, the unmodified loop primers bind to the loop structure region of the amplification product (stem-loop structure) to help identify the presence of the amplification product, and the two modified loop primers do not emit fluorescence in the unbound state due to the inhibition of the fluorescent reporter group by the quenching group. When the two modified loop primers bind to the target region, the fluorescent groups release a fluorescent signal, so that by detecting the change in the fluorescent signal, the presence or absence of the target sequence can be determined.

[0040] According to the present application, any fluorescent reporter group commonly used in the art can be suitable for the present application, for example, ATTO 425, HEX, FAM, ROX, CY5, Quasar705, Alexa Fluor 405, etc. Preferably, the (fluorescent) reporter groups modified on different loop primers are (fluorescent) reporter groups detected by different fluorescent detection channels (i.e., the reporter groups on different loop primers are different).

[0041] According to the preferred embodiments of the present application, the quencher group is further modified on the circular primer, preferably at the 3' end. Any quencher group commonly used in the art in combination with a reporter group can be suitable for the present application. For example, it can be BHQ-0, BHQ-1, BHQ-2, SQ1, SQ2, etc. The combinations between the reporter groups and the corresponding quencher groups are well known to those skilled in the art, and the quencher groups on different circular primers can be the same or different, which will not be described here.

[0042] Further, the nucleotide sequence of the quencher primer (5' quencher group + Tail + Loop) in the circular primer of the aforementioned (1) is shown in SEQ ID NO: 6, and the nucleotide sequence of the reporter primer (Loop + Tail + 3' fluorescent reporter group) is shown in SEQ ID NO: 7.

[0043] Further, the nucleotide sequence of the quencher primer (5' quencher group + Tail + Loop) in the circular primer of the aforementioned (2) is shown in SEQ ID NO: 13, and the nucleotide sequence of the reporter primer (Loop + Tail + 3' fluorescent reporter group) is shown in SEQ ID NO: 14.

[0044] Further, the nucleotide sequence of the quencher primer (5' quencher group + Tail + Loop) in the circular primer of the aforementioned (3) is shown in SEQ ID NO: 20, and the nucleotide sequence of the reporter primer (Loop + Tail + 3' fluorescent reporter group) is shown in SEQ ID NO: 21.

[0045] The second aspect of the present application provides a kit for detecting different subtypes of monkeypox virus, which comprises the reagent composition of the first aspect.

[0046] The kit provided by the present application can only contain core reagents for detecting different subtypes of monkeypox virus (such as external primers, internal primers, and optional circular primers used in the detection of the aforementioned marker genes), or can further contain other conventional reagents required for the detection process (such as buffer systems, enzymes, dNTPs, and other reagents required for LAMP detection. Any reagent commonly used in the art for marker gene detection can be suitable for the present application, and those skilled in the art can select and adjust according to the actual detection technology selected.

[0047] According to some preferred embodiments of the present application, the kit further comprises at least one of an enzyme, a buffer, a magnesium source, and dNTPs.

[0048] The enzyme can be a DNA polymerase that catalyzes the synthesis of complementary strands with strand displacement, and preferably the enzyme comprises a Bst DNA polymerase with strand displacement properties.

[0049] Preferably, the magnesium source comprises a water-soluble inorganic Mg salt. Typically, the magnesium source can be provided in the form of an aqueous solution, for example Mg 2+ concentrations of 1-6 mM of magnesium chloride, magnesium sulfate, magnesium nitrate, etc.

[0050] More preferably, the kit further comprises reagents and vessels for sample collection, such as a flocked swab. The sample to be detected according to the present application can be a detection sample collected from a subject in need, for example, can be a skin lesion swab sample (blister fluid or pus fluid). According to the preferred embodiments of the present application, the present application uses LAMP technology for detection, without the need for nucleic acid extraction or purification operation, and is more simple and convenient.

[0051] In the present application, the concentrations of various reagents contained in the kit are not particularly limited and can be adjusted according to actual detection needs.

[0052] In order to obtain better detection effect (such as to improve sensitivity, specificity and accuracy, etc.), according to some preferred embodiments of the present application, the final concentrations of the reagents contained in the kit are as follows: the final concentration of Mg 2+ may be 1-6 mM; the final concentration of dNTPs can be 1-80 mM; the final concentration of enzyme can be 0.01-30 U / μL; the final concentration of external primer or internal primer can be 0.1-40 μM; and the final concentration of circular primer can be 0.1-20 μM. Among them, the final concentration of external primer, internal primer and circular primer refers to the final concentration of one primer / circular primer.

[0053] The present application further provides a method for detecting different subtypes of monkeypox virus, which comprises detecting a sample using the reagent composition of the first aspect or the kit of the second aspect.

[0054] The method provided by the present application can be a diagnostic method or a non-diagnostic method. For example, the diagnostic method can comprise detecting a sample from a subject in need using the reagent composition or kit provided by the present application, and determining whether the subject is infected with monkeypox virus and typing the same, so as to determine the subsequent diagnosis and treatment scheme (such as whether to transfer, whether to further treat, etc.). For another example, the non-diagnostic method can comprise detecting a sample using the reagent composition or kit provided by the present application in research work or non-diagnostic detection work, for example, detecting a sample using the reagent composition or kit provided by the present application in the mechanism research of different subtypes of monkeypox virus, drug research and development, etc.

[0055] The third aspect of the present application provides use of the reagent composition in the preparation of a kit for screening / detecting different subtypes of monkeypox virus.

[0056] Similarly, the present application also provides the use of the reagent composition of the first aspect, or the kit of the second aspect in screening / detecting different subtypes of monkeypox virus.

[0057] The fourth aspect of the present application provides the use of a reagent for detecting the presence of a gene fragment as shown in at least one of SEQ ID NO: 46-48 in the preparation of a kit for detecting different subtypes of monkeypox virus.

[0058] Similarly, the present application further provides the use of the detection of the presence of OPG002 gene, D14L gene or dD14-16 sequence in the detection of different subtypes of monkeypox virus (typing of monkeypox virus).

[0059] The use of the above-mentioned third and fourth aspects provided by the present application can be diagnostic (for example, for medical detection, to further determine and determine subsequent detection / treatment plan) or non-diagnostic (for example, can be used for research work, for drug screening, disease mechanism research and verification, etc.).

[0060] The present application will be described in detail below by way of examples. It should be understood that the following examples are only used to exemplarily further explain and illustrate the content of the present application, and are not used to limit the present application.

[0061] In the following examples, unless otherwise specified, the reagents and materials used are commercially available products purchased from regular chemical or biological reagent / material suppliers, and the reagents are all analytical pure.

[0062] Example 1

[0063] 1. Primer

[0064] A detection system (reagent composition) for monkeypox virus was developed using the conserved region gene of monkeypox virus type I / II / Ib as the detection target and IC gene as the internal standard. The primers used are shown in Table 1, which were synthesized by Hunan Kangde Biological Technology Co., Ltd. In Table 1, the one marked as "F3" in the name is the forward outer primer, the one marked as "B3" is the reverse outer primer, the one marked as "FIP" is the forward inner primer, the one marked as "BIP" is the reverse inner primer, and the one marked as "LB" is the loop primer.

[0065] Table 1

[0066]

[0067]

[0068] 2. Monkeypox virus different subtype conserved region gene sequence (target sequence)

[0069] The conserved region gene (D14L) sequence of the monkeypox-Congo strain (type I) is as follows:

[0070]

[0071] The conserved region gene (OPG002) of monkeypox-West African pearl (type II) is as follows:

[0072]

[0073] The sequence of the conserved region (dD14-16) of monkeypox-West African strain Ib is as follows:

[0074]

[0075] The sequence of the IC internal standard gene is as follows:

[0076]

[0077] In the target sequence above, the thin underline "_" indicates the F3 region, and the thick line... The area marked is F2, indicated by a dotted underline. The label indicates the F1 zone (F1c reverse complementary), indicated by a dashed underline. The area marked is B1c, indicated by a wavy line. The identifier is the sequence corresponding to the circular primer LB, indicated by dotted lines and underlines. The label indicates the B2c region (B2 reverse complementary), indicated by double underscores. The label indicates the B3c region (B3 reverse complementary).

[0078] 3. Detection Method

[0079] This invention is based on loop-mediated isothermal amplification (LAMP) technology. The reaction system contains the following components: 10X buffer, Bst enzyme, dNTPs, 10X primer mix, 25X strand displacement fluorescent circular primers (DP-Probe Pair), and the metal cations (magnesium ions) required for catalyzing DNA polymerase, as detailed in Table 2. Bst 4.2 DNA polymerase was purchased from Harbin Xinhai Gene Testing Co., Ltd.; buffer was also purchased from Harbin Xinhai Gene Testing Co., Ltd.

[0080] Table 2

[0081] Component Amount used in each reaction 10X Buffer 5 μL dNTPs (10 mM) 6 μL 100 mmol / L MgCl2 3 μL 10X Primer Mix 5 μL 25x strand displacement fluorescent circular primer 2 μL Bst4.2 DNAase (16 U / μl) 3 μL Template 10 μL purified water q.s. 50 μL

[0082] The 10X primer mixture used was prepared according to Table 3 below:

[0083] Table 3

[0084]

[0085]

[0086] The 25x strand displacement fluorescent looped primer used was mixed and prepared according to the following Table 4, wherein the 10X primer annealing solution includes 200 mM Tris-HCl, 500 mM KCl, 20% (v / v) glycerol, 0.1% (v / v) Tween-20:

[0087] Table 4

[0088] Name Amount used 10X Primer Annealing Solution 2.5 μL MPV-WA-LB-tail-5BHQl (200 μM) 3 μL MPV-WA-LB-tail-3FAM (200 μM) 2 μL MPV-Congo-LB-tail-5BHQl (200 μM) 3 μL MPV-Congo-LB-tail-3HEX (200 μM) 2 μL MPV-Ib-LB-tail-5BHQ2 (200 μM) 3 μL MPV-Ib-LB-tail-3Cy5 (200 μM) 2 μL IC-2-LB-tail-3ROX (200 μM) 3 μL IC-2-LB-tail-5BHQ2 (200 μM) 2 μL purified water 2.5 μL

[0089] The above reaction system is heated at 95°C for 3 minutes on a PCR instrument and left at room temperature for 10 minutes.

[0090] Sample processing and loading:

[0091] Real sample types include human samples containing skin lesion samples (blister fluid or pus fluid), throat swabs.

[0092] Use a flocked swab to dip the non-monkeypox patient blister fluid or pus fluid into 1 mL of sample preservation solution containing monkeypox pseudovirus (Shangxiang Biotechnology Co., Ltd., product number X1011), stir the flocked swab, and mix thoroughly. Prepare the blister fluid or pus fluid simulation sample, collect the sample into the preservation solution, and immediately detect it. It can be stored at 2-8°C for no more than 48 hours.

[0093] For human blister fluid or pus fluid simulation samples, add 10 μL of sample release reagent (Shangxiang Biotechnology Co., Ltd., product number S1011) to each of the eight tubes. Add 10 μL of the sample to be tested to each tube (Note: If the sample is turbid or has obvious precipitate, centrifuge at 2000 rpm for 30 seconds, then aspirate 10 μL of the sample), mix the liquid thoroughly by blowing up and down 3-5 times, and then stand for 10 minutes for standby.

[0094] Use a swab to wipe the tonsils of the collector on both sides with a little force back and forth at least 3 times, and then wipe the posterior wall of the throat up and down at least 3 times. Dip the swab head into 1 mL of sample preservation solution containing monkeypox pseudovirus (Shangxiang Biotechnology Co., Ltd., product number X1011) to prepare a throat swab simulation sample. Collect the sample into the preservation solution and immediately detect it. It can be stored at 2-8°C for no more than 48 hours.

[0095] Remove the throat swab simulation sample, mix thoroughly, and aspirate 100-200 μL of the sample to be tested into a 1.5 mL centrifuge tube. Centrifuge at 12000 rpm for 10 minutes, and discard the supernatant. Add 50 μL of sample release reagent to the tube, and shake to mix the sample release reagent and the precipitate thoroughly. Stand for 10 minutes for standby.

[0096] The pseudovirus samples of various viruses in the experiment were obtained by recombination of plasmids containing the target sequences of OPG002 gene (length of 324 bp) of monkeypox West African type (Clade II), D14L gene (length of 330 bp) of monkeypox Congo type (Clade I), and dD14-16 region (length of 350 bp) of monkeypox Clade Ib type with an adenovirus vector (ampicillin resistance) in HEK293 cells using Cre / loxP (or FLP / frt, etc.) recombinase. The pseudovirus was obtained by lysing the cells to harvest the monkeypox virus pseudovirus particles. The pseudovirus was synthesized by Shengong Bioengineering (Shanghai) Co., Ltd.

[0097] The plasmid samples of various viruses in the experiment were obtained by introducing the fragments containing the target genes into plasmids, which were synthesized by Shengong Bioengineering (Shanghai) Co., Ltd.: the target OPG002 (342 bp) or D14L gene (330 bp) or dD14-16 sequence (350 bp) was synthesized on a full-automatic DNA synthesizer, and then linked with pGSI vector (2857 bp) to be transformed and cloned, and the plasmid was extracted to obtain the monkeypox West African type (Clade II) plasmid with a length of 3199 bp, the monkeypox Congo type (Clade I) plasmid with a length of 3187 bp, and the monkeypox Clade Ib type plasmid with a length of 3207 bp.

[0098] PCR amplification

[0099] The Shanghai Hongshi full-automatic fluorescent quantitative PCR instrument SLAN-96P was used for fluorescence collection at 70°C for 30 s, 40 cycles, reaction for 20 min, and the final fluorescence detection results were used for reference.

[0100] Interpretation of test results

[0101] FAM detection Ct value ≤40, and the internal standard channel detection is positive (Ct value ≤40), reported as monkeypox virus Ib type positive; ROX detection Ct value ≤40, and the internal standard channel detection is positive (Ct value ≤40), reported as monkeypox virus II type positive; HEX detection Ct value ≤40, and the internal standard channel detection is positive (Ct value ≤40), reported as monkeypox virus I type positive; for positive samples, the internal standard detection result is not required;

[0102] 2. FAM, ROX and HEX detection have no Ct value or Ct value >40, and the internal standard channel detection is positive (Ct value ≤40), reported as monkeypox virus negative;

[0103] 3. If FAM, ROX and HEX detection has no Ct value or Ct value > 40, and the internal standard channel detection has no Ct value or Ct value > 40, the detection result of the sample is invalid, the reason should be found and excluded, and the sample should be re-detected or re-sampled for experiment.

[0104] 4. Detection result of sample

[0105] Using the primers shown in Part 1, the real sample of monkeypox West African type (Clade II) (from Hunan Provincial Thoracic Hospital), one monkeypox Congo type (Clade I) pseudovirus sample and one monkeypox Clade Ib type pseudovirus sample were detected on a fluorescent quantitative PCR instrument according to the method of Part 3, and the results are shown in Table 2. Figure 1-3 As can be seen, the primers of the application can accurately diagnose the subtypes of the detected monkeypox.

[0106] Using the primers shown in Part 1, one mixed simulation sample containing monkeypox West African type (Clade II) pseudovirus sample, monkeypox Congo type (Clade I) pseudovirus sample and monkeypox Clade Ib type pseudovirus sample was detected on a fluorescent quantitative PCR instrument according to the method of Part 3, and the results are shown in Table 3. Figure 12 As can be seen, the primers of the application can detect all subtypes.

[0107] 5. Sensitivity detection result

[0108] Using the primers shown in Part 1, the primers were detected according to the method of Part 3. Pretreatment of the test sample: the positive test sample was an artificially synthesized monkeypox plasmid sample. The test sample was mixed with sample release agent according to the volume ratio of 1:1, and the final concentration was 10000 copies / mL, 2000 copies / mL, 1000 copies / mL and 500 copies / mL, respectively. Each template was repeated 20 times for detection, the number of detections was counted, and the detection rate was calculated. Multiple LAMP detection was performed on a full-automatic fluorescent quantitative PCR instrument, and the test results showed that the concentration as low as 1000 copies / mL could still detect 100% of the corresponding target, proving that the sensitivity of the composition of the application was 1000 copies / mL, and the detection results of each test sample at a concentration of 1000 copies / mL are shown in Table 4 and Table 5. Figure 4-6

[0109] Table 5

[0110]

[0111] 6. Specificity detection result

[0112] ​The pathogens, such as smallpox virus (pseudovirus), varicella vaccine, cowpox virus (pseudovirus), mousepox virus, measles virus, rubella virus, parvovirus B19, varicella-zoster virus, Treponema pallidum, herpes simplex virus type I, herpes simplex virus type 2, human herpes 6 virus, human herpes 7 virus, Staphylococcus aureus, Streptococcus pyogenes and Pseudomonas aeruginosa, which have homology with the nucleic acid sequence and can easily cause the same or similar clinical symptoms, are subjected to multiplex LAMP detection on the full-automatic fluorescent quantitative PCR instrument using the primers shown in Part 1 and according to the method in Part 3, and the detection results are shown in Table 6 below. The results show that the primers of the present application have no cross-reaction with the above pathogens. The viruses are derived from Hunan Shengwei Medical Inspection Co., Ltd.

[0113] Table 6

[0114]

[0115]

[0116] 7. Precision test results

[0117] The primers shown in Part 1 are used, and the method in Part 3 is used to select plasmids of strong positive and weak positive at two concentration levels (100,000 copies / ml and 5,000 copies / ml, respectively) to determine the intra-batch precision and inter-batch precision, and each sample is repeatedly measured 10 times. The results show that the detection rates of the strong positive and weak positive plasmids are both 100%, and the intra-batch and inter-batch detection Ct value coefficients of variation (CV) are less than 5%, as shown in Table 7 and Figure 7-9 , which shows that the primers of the present application have good detection precision in intra-batch and inter-batch.

[0118] Table 7

[0119]

[0120] 8. Clinical real sample detection results

[0121] The primers shown in Part 1 are used, and the method in Part 3 is used to detect clinical samples. The clinical samples are skin lesion swab samples derived from Hunan Provincial Center for Disease Control and Prevention from January 2024 to June 2024, and a total of 20 samples. A total of 4 monkeypox virus West African type (type II) positive samples are detected, and the detection results of the remaining samples are negative. The positive detection results of the present application are consistent with the positive detection results of the commercial kit (Shengxiang Biological, registration certificate number: Guojiazhunqu 20243402513) at 100% (see Table 8).

[0122] Table 8

[0123]

[0124] Example 2

[0125] The monkeypox Clade II samples (same as in Example 1, Part 4) were tested with the Type II primers in Table 9 (targeting the sequence shown in SEQ ID NO: 29) in combination with the other target primers in Table 1 according to the method in Example 1, Part 3. The results are shown in Figure 10 Clade I and II targets showed non-specific amplification. The Clade Ib pseudovirus samples (same as in Example 1, Part 4) were tested with the Ib primers in Table 10 (targeting different segments of SEQ ID NO: 48) in combination with the other target primers in Table 1 according to the method in Example 1, Part 3. The results are shown in Figure 11 Clade I and II targets showed non-specific amplification. Some targets did not show amplification curves and the overall detection was not good.

[0126] SEQ ID NO: 29

[0127] GATAGTAATCAGGTAGAGACGCGATCGTGTAACACGACTCACAATAGAATCTGTGAATGCTCTCCAGGATATTATTGTCTTCTCAAAGGAGCATCAGGGTGTAGAACATGTATTTCTAAAACAAAGTGTGGAATAGGATACGGAGTATCCGGATACACGTCTACCGGAGACGTCATCTGTTCTCCGTGTGGTCCCGGAACATATTCTCACACCGTCTCTTCCACAGATAAATGCGAACCCGTCGTAACCAGCAATACATTTAACTATATCGATGTGGAAATTAACCTGTATCCAGTCAACGACACATCGTGTACTCGGACGACCACTACCGGTCTCAGCGAATCCATCTCAACGTCGGAACTAACTATTACCATGAATCATAAAGATTGTGATCCAGTCTTTCGTGCAGAATACTTCTCTGTCCTTAATAATGTAGCAACTTCAGGATTCTTTACAGGAGAAAATAGATATCAGAATACTTCAAAGATATGTA

[0128] Table 9

[0129]

[0130] Table 10

[0131]

[0132] Based on the principle of base complementary pairing, dimers can be formed between external primers, internal primers and / or loop primers, but the probability is very small, which can be excluded at the beginning of design. However, when multiple target points are detected, there are many external primers, internal primers and loop primers, and dimers are easily formed between internal and external primers, internal and external primers, loop primers and loop primers, or internal and external primers and loop primers. To ensure the conservation of the design (conservation is crucial for the accuracy of detection), and to consider the mutual interference between different external primers, internal primers and loop primers, careful design and verification of external primers, internal primers and loop primers are required. The inventors of the present application found that the external primers, internal primers and loop primers designed according to the target sequence as described above are particularly advantageous for avoiding such interference and achieving single-tube multiplex typing detection.

[0133] The above results show that the present application can realize rapid typing of monkeypox virus. In particular, as can be seen from the comparison of Comparative Example 1 and Example 2, even for the same target gene, a more optimal detection effect will be obtained for a specific target segment.

[0134] The above describes the preferred embodiments of the present application, but the present application is not limited thereto. Within the technical concept of the present application, various simple modifications can be made to the technical solutions of the present application, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be considered as disclosed by the present application and fall within the protection scope of the present application.

Claims

1. A reagent composition for detecting different subtypes of monkeypox virus, characterized in that, The reagent composition includes reagents for detecting the presence of a nucleotide sequence of a gene fragment shown in at least one of SEQ ID NOs: 46-48 by loop-mediated isothermal amplification.

2. The reagent composition according to claim 1, characterized by The reagent composition includes an outer primer, an inner primer, and an optional loop primer.

3. The reagent composition of claim 1, wherein The reagent composition includes a combination of an outer primer, an inner primer, and a loop primer shown in at least one of (1)-(3) below: (1) outer primer, inner primer, and loop primer for detecting the presence of an OPG002 gene: an outer primer of a nucleotide sequence shown in SEQ ID NOs: 1-2, an inner primer of a nucleotide sequence shown in SEQ ID NOs: 3-4, and a loop primer of a nucleotide sequence shown in SEQ ID NOs: 5-7; (2) outer primer, inner primer, and loop primer for detecting the presence of a D4L gene: an outer primer of a nucleotide sequence shown in SEQ ID NOs: 8-9, an inner primer of a nucleotide sequence shown in SEQ ID NOs: 10-11, and a loop primer of a nucleotide sequence shown in SEQ ID NOs: 12-14; (3) outer primer, inner primer, and loop primer for detecting the presence of a dD14-16 sequence: an outer primer of a nucleotide sequence shown in SEQ ID NOs: 15-16, an inner primer of a nucleotide sequence shown in SEQ ID NOs: 17-18, and a loop primer of a nucleotide sequence shown in SEQ ID NOs: 19-21.

4. The reagent composition according to claim 2 or 3, characterized in that, The loop primer is modified with a reporter group and / or a quencher group.

5. The reagent composition of claim 4, wherein, The loop primer includes an unmodified loop primer, a first modified loop primer modified with a fluorescent reporter group at the 5' end, and a second modified loop primer modified with a fluorescent quencher group at the 3' end.

6. The reagent composition of claim 1, wherein The reagent composition further includes reagents for detecting an internal standard.

7. A kit for detecting different subtypes of monkeypox virus, characterized in that, The kit includes the reagent composition of any one of claims 1-6.

8. The kit of claim 7, wherein The kit further includes at least one of an enzyme, a buffer, a magnesium source, and dNTPs.

9. Use of the reagent composition of any one of claims 1-6 in the manufacture of a kit for detecting different subtypes of monkeypox virus.

10. Use of a reagent for detecting the presence of a gene fragment shown in at least one of SEQ ID NOs: 46-48 in the manufacture of a kit for detecting different subtypes of monkeypox virus.

Images