Kluyveromyces marxianus with high yield of mellow substances and application of Kluyveromyces marxianus

Abstract

The invention relates to the field of microbial food fermentation, in particular to kluyveromyces marxianus capable of producing high-yield mellow substances and application of the kluyveromyces marxianus. The Kluyveromyces marxianus capable of producing the high-yield mellow substances is obtained through screening, the strain is named as Kluyveromyces marxianus Y4, the preservation number is CCTCC (China Center for Type Culture Collection) NO: M2025759, the preservation date is April 11, 2025, and the preservation address is China Center for Type Culture Collection. The Kluyveromyces marxianus obtained by the invention is applied to the preparation of the mellow flavored yoghourt, and has the advantages that the yield of the mellow substances is increased; the variety and the content of alcohol volatile flavor substances in the yoghourt can be remarkably improved, and richer taste levels and unique flavor are provided for the yoghourt.

Description

Technical Field

[0001] This invention relates to the field of microbial food fermentation, specifically to a Max Kluyveromyces strain that produces high levels of aromatic compounds and its applications. Background Technology

[0002] Yogurt, with its unique flavor and rich nutrition, is suitable for people with lactose intolerance, resulting in high market demand and research value, and attracting widespread attention. The flavor of yogurt largely determines its popularity among consumers. Currently, most yogurts on the market are lactic acid yogurts made with lactic acid bacteria as a starter culture, resulting in limited flavor and texture.

[0003] The types and amounts of alcohols in yogurt determine its flavor. The more types of alcohols there are, the more layered the taste of the yogurt will be. The higher the content of alcohols, the richer the aroma of the yogurt will be. For example, ethanol gives yogurt a refreshing and crisp taste, while phenylethanol has a rose aroma. Alcohols play an important role in forming the unique flavor of yogurt.

[0004] Therefore, how to improve the volatile flavor compounds of alcohols in yogurt is an urgent problem to be solved. Summary of the Invention

[0005] To overcome the above problems, the purpose of this invention is to provide a Kluyveromyces martensii strain that produces high levels of alcoholic flavor compounds and its application. When the screened Kluyveromyces martensii strain is used in the preparation of yogurt, it can significantly increase the types and contents of volatile alcoholic flavor compounds in yogurt, providing yogurt with a richer taste and a unique alcoholic flavor.

[0006] To achieve the above objectives, this invention screened and obtained a Kluyveromyces macrocephala strain that produces high levels of aromatic compounds. The Kluyveromyces macrocephala strain producing high levels of aromatic compounds is Kluyveromyces macrocephala Y4, and the strain is named Kluyveromyces macrocephala Y4. Kluyveromyces marxianus Y4), accession number: CCTCC NO: M2025759, accession date: April 11, 2025, accession address: China Center for Type Culture Collection.

[0007] The present invention relates to the application of the Kluyveromyces martensii strain, which produces high levels of aromatic compounds, in the preparation of aromatic yogurt.

[0008] As a preferred embodiment, the yogurt fermentation system comprises reconstituted milk, sucrose, yogurt starter, and Kluyveromyces mascarponeum Y4.

[0009] As a preferred embodiment, the reconstituted milk contains 12% milk powder by mass, the sucrose is added at 5-7% of the reconstituted milk's mass, the yogurt starter is a direct-inoculation yogurt starter added at 0.2% of the reconstituted milk's mass, and the Kluyveromyces macrocephala Y4 is a suspension of Kluyveromyces macrocephala Y4, with a viable count of 1.54 × 10⁻⁶ cells. 5 The amount of CFU / mL Kluyveromyces macrocephala Y4 suspension added was 3-4% of the reconstituted milk mass.

[0010] As a preferred embodiment, the reconstituted milk is obtained by mixing milk powder with water and then sterilizing it.

[0011] This invention also provides a method for preparing a rich and flavorful yogurt, characterized by comprising the following steps: By weight, 100 parts reconstituted milk, 5-7 parts sucrose, 0.2 parts yogurt starter, and 3-4 parts Max Kluyveromyces Y4 suspension; The Kluyveromyces martensii Y4 suspension was composed of sterile water and Kluyveromyces martensii Y4, wherein the viable count of the Kluyveromyces martensii Y4 suspension was 1.54 × 10⁻⁶. 5 CFU / mL; Max Kluyveromycin Y4 ( Kluyveromyces marxianus Y4), accession number: CCTCC NO: M2025759, accession date: April 11, 2025, accession address: China Center for Type Culture Collection; (2) Fermentation Mix the ingredients evenly and ferment at 37-38℃ until curd forms, thus obtaining a rich and flavorful yogurt.

[0012] As a preferred embodiment, the volatile flavor compounds of alcohols produced during the fermentation process of the mellow-flavored yogurt include: ethanol, cyclobutanol, isobutanol, isoamyl alcohol, n-octanol, phenylethanol, and tetrahydrolinalool.

[0013] As a preferred embodiment, the reconstituted milk is obtained by mixing milk powder with water and then sterilizing it.

[0014] As a preferred embodiment, the yogurt starter is a direct-inoculation yogurt starter, the components of which include maltodextrin, Streptococcus salivarius subsp. thermophilus, and Lactobacillus delbrueckii subsp. bulgaricus.

[0015] As a preferred option, by weight, there are 100 parts reconstituted milk, 7 parts sucrose, 0.2 parts yogurt starter, and 3 parts Max Kluyveromyces Y4 suspension, with a fermentation temperature of 38°C. The reconstituted milk contains 12% milk powder.

[0016] The design concept of this invention is as follows: In the nomadic regions of Xinjiang, there are many yogurts made using traditional hand-fermentation methods. Compared to commercially available yogurts, these yogurts have a more unique and richer flavor. These dairy products are rich in microbial resources, containing not only lactic acid bacteria but also abundant yeast. These yeasts can degrade proteins and fats in the raw milk, producing a large amount of nutrients such as amino acids and vitamins, as well as flavor metabolites such as alcohols and esters. Alcohols, in particular, contribute to the unique aroma and flavor of yogurt. For example, ethanol gives yogurt a refreshing and crisp texture, while phenylethanol has a rose-like aroma. These factors play a crucial role in forming the unique flavor of yogurt and improve its quality. Therefore, selecting high-alcohol-producing yeasts from yogurts made in Xinjiang's nomadic regions and adding these yeasts to the production process of commercially available yogurts helps to improve their flavor. Attached Figure Description

[0017] Figure 1 This is a diagram showing the colony morphology of strain Y4. Figure 2 Microscopic image of strain Y4; Figure 3 Figure showing the tolerance of Kluyveromyces martensii Y4 to ethanol; Figure 4 Figure showing the temperature tolerance of Kluyveromyces martensii Y4; Figure 5 This is the standard curve for ethanol; Figure 6 A bar chart showing the ethanol content in yogurt; Figure 7 A bar chart showing the content of volatile flavor compounds in yogurt; Figure 8 A bar chart showing the number and types of volatile flavor compounds in yogurt; Figure 9 This is a stacked bar chart showing the content of volatile flavor compounds in yogurt.

[0018] Example 1: Screening of strains (1) Isolation and purification of bacterial strains One mL of the yogurt sample (from Kashgar, Xinjiang Uygur Autonomous Region, made using traditional hand-fermentation methods) was transferred to a 15 mL centrifuge tube containing 9 mL of sterile 0.85% saline. After vortexing, 100 μL was transferred to a 1.5 EP tube containing 900 μL of 0.85% saline, vortexed, and diluted using a tenfold gradient method, with each 100 μL drop representing a 10x dilution. -1 10 -2 10 -3The diluted solutions were spread onto YPD solid medium (YPD medium formula: 10 g yeast extract, 20 g glucose, 20 g peptone, 1000 mL deionized water, and 20 g agar for solid medium) and incubated upside down in a 28℃ constant temperature incubator for 36-48 h until a large number of colonies appeared on the surface of the medium.

[0019] Single colonies were picked using an inoculation loop and streaked onto YPD solid medium to obtain strains with different colony morphologies. The medium was then incubated upside down at 37°C for 48 h. This process was repeated three times. Single colonies were then picked and placed into YPD liquid medium and incubated upside down at 37°C for 24 h. The culture was examined under a microscope. Pure bacteria were inoculated at a 2% inoculum and then stored. Impure bacteria were streaked again until they were pure and then stored.

[0020] (2) Initial screening of alcohol-producing strains Forty isolated bacterial strains were streaked onto YPD medium and cultured for 48 h. Single colonies were picked and activated for three generations in YPD liquid medium. The bacterial suspension was centrifuged at 8000 rpm for 10 min, and the cells were washed 2-3 times with sterile water. An equal volume of sterile water was added to mix the cells thoroughly. Under aseptic conditions, the bacterial suspension was inoculated at a ratio of 3% (v / v) into 100 mL of aseptic reconstituted milk with a milk powder content of 12% (m / m) (sterilized at 95℃ for 10 min, cooled to fermentation temperature before inoculation). The mixture was incubated at 37℃ until curdled and stored at 4℃ for later testing. The aroma intensity was assessed by olfactory evaluation, and the results are shown in Table 1. Nine strains with a strong aroma were selected for subsequent experiments.

[0021] Table 1. Aroma intensity of different Max Kluyveromycetes. In Table 1, +++ indicates a rich and mellow flavor, while ++ indicates a weaker and more mellow flavor. (3) Chromatographic screening of high alcohol-producing strains 3.1 Preparation of Fermentation Raw Materials Aseptic reconstituted milk (made from milk powder and water to a mass percentage of 12%, sterilized at 95°C for 10 min and then cooled for later use).

[0022] Commercial yogurt starter (commercial yogurt starter is purchased from the market, a 2-strain yogurt starter, including maltodextrin, Streptococcus salivarius thermophilus subsp., and Lactobacillus delbrueckii subsp. bulgaricus).

[0023] Alcohol-producing bacterial suspension: The 9 strains obtained from the initial screening were removed from the frozen environment and inoculated into YPD liquid medium for three generations of activation. The bacterial suspension was centrifuged at 8000 rpm for 10 min, and the bacterial cells were washed 2-3 times with sterile water. An equal volume of sterile water was added to mix the bacterial cells, resulting in 9 tubes of alcohol-producing bacterial suspension for later use. The CFU of the alcohol-producing bacterial suspension was 1.0 × 10⁻⁶. 5 Approximately CFU / mL; all procedures were performed under aseptic conditions.

[0024] 3.2 Fermentation The fermentation system included: 100 mL of aseptic reconstituted milk, 0.2 g of commercial yogurt starter, and 3 ml of alcohol-producing bacteria suspension. The fermentation system was mixed evenly and fermented at a constant temperature of 37℃ until curd was formed. After fermentation, the yogurt was in a curd-like state. Nine yogurt samples were obtained.

[0025] Blank control fermentation system: 100 mL of aseptic reconstituted milk and 0.2 g of commercial yogurt starter; mix the fermentation system evenly and ferment at a constant temperature of 37℃ until curd forms. After fermentation, the yogurt in the blank control group LS is obtained.

[0026] 3.3 Gas chromatography-mass spectrometry was used to detect volatile flavor compounds of alcohols in nine yogurt samples and one blank control yogurt sample.

[0027] Sample pretreatment: 5 mL of yogurt sample was placed into a 20 mL chromatographic sample vial and equilibrated at 55℃ for 20 min. The aged (250℃, 5 min) extraction head was inserted into the chromatographic sample vial and extracted at 50℃ for 30 min. Then it was inserted into the gas chromatograph injection port and desorbed at 240℃ for 5 min.

[0028] Gas chromatography conditions: initial temperature 35℃, hold for 3 min; increase temperature to 210℃ at 6℃ / min, hold for 10 min. Injector temperature 240℃; carrier gas: He, flow rate 1.5 mL / min; split ratio 10:1.

[0029] Mass spectrometry conditions: ionization method: EI source; electron energy: 70 eV; ion source temperature: 230℃; mass scan range: m / z 35-500; emission current: 100 μA.

[0030] The results are shown in Table 2. As can be seen from Table 2, the yogurt with added strain Y4 had the highest total concentration of alcohols and produced a rich variety of alcohols, including six types: isobutanol, isoamyl alcohol, n-heptanol, and phenylethanol. Isobutanol (0.3778 mg / mL) and isoamyl alcohol (1.743 mg / mL) were present in the highest concentrations among all samples. Therefore, strain Y4 was selected as the target strain for this screening.

[0031] Table 2. Volatile flavor compounds and their content in yogurt. (4) Identification of strains 4.1 Colony morphology identification: The Y4 strain was spread on YPD plates, and the results are as follows. Figure 1 As shown, the colony morphology is characterized by raised, round colonies that are milky white, opaque, moist, smooth, and have a yeast aroma, and is preliminarily identified as yeast.

[0032] 4.2 Microscopic morphological identification: The Y4 strain was observed under a microscope, and the results are as follows. Figure 2 As shown. From Figure 2 It can be seen that the microscopic morphology is elliptical, and it reproduces by budding.

[0033] 4.3, 5.8S rDNA identification: The 5.8S rDNA of strain Y4 was amplified using PCR technology, and the genus of the strain was further identified based on the 5.8S rDNA sequence.

[0034] Forward primer ITS1: 5'-TCCGTAGGTGAACCTGCGG-3'; Reverse primer ITS4: 5'-TCCTCCGCTTATTGATATGC-3'; After DNA amplification, the DNA was sent to a gene company for sequencing, and the sequenced bases are shown in SEQ ID NO:1.

[0035] The sequenced 5.8S rDNA base sequence was compared with NCBI's BLAST algorithm. Kluyveromyces marxianus The strain similarity was 99.72%, and the Y4 strain was ultimately identified as *Kluyveromyces martensii*. Kluyveromyces marxianus It was sent to the China Center for Type Culture Collection for preservation, and the strain was named: Kluyveromyces martensii Y4 ( Kluyveromyces marxianus Y4), with accession number: CCTCC NO: M2025759, accession date: April 11, 2025, accession address: Wuhan, China.

[0036] (5) Ethanol tolerance and temperature tolerance of the obtained Kluyveromyces martensii Y4. 5.1. Ethanol tolerance of Kluyveromyces martensii Y4 Kluyveromyces martensii Y4 seed culture was inoculated at a rate of 2% (v / v) into YPD medium containing different ethanol volumes of 0%, 2%, 4%, 6%, 8%, and 10%. The culture was incubated at 37°C for 24 h. After incubation, the absorbance of the fermentation broth was measured at 600 nm. The results are as follows: Figure 3As shown, Y4 can tolerate a maximum of 6% ethanol, and basically does not grow at 8% and 10% ethanol concentrations.

[0037] 5.2. Temperature tolerance of Kluyveromyces martensii Y4 Kluyveromyces martensii Y4 seed culture was inoculated into YPD medium at a 2% (v / v) inoculum and cultured for 24 h in incubators at five temperature gradients: 27℃, 32℃, 37℃, 42℃, 47℃, and 52℃. After culture, the absorbance of the fermentation broth was measured at 600 nm to investigate the growth ability of Kluyveromyces martensii Y4 at different temperatures. The results are as follows: Figure 4 As shown, both high and low temperatures inhibit the growth of Kluyveromyces martensii Y4, which can still maintain its activity at 42℃. Kluyveromyces martensii Y4 grows better at 37℃.

[0038] Example 2: The selected Kluyveromyces macrocephala Y4 was applied to the preparation of rich and flavorful yogurt. In this embodiment, the Kluyveromyces martensii Y4 obtained in Example 1 was applied to the preparation of rich and flavorful yogurt. To compare the effects, two comparative examples are listed in this embodiment: blank control group yogurt LS and control yogurt A3.

[0039] (1) Preparation of yogurt raw materials Aseptic reconstituted milk (made from milk powder and water to a mass percentage of 12%, sterilized at 95°C for 10 min and then cooled for later use).

[0040] The commercial yogurt starter was purchased from the market. The yogurt starter in this embodiment is a (2-strain) yogurt starter, product code: 89001865, and its ingredients include maltodextrin, Streptococcus salivarius subsp. thermophilus, and Lactobacillus delbrueckii subsp. bulgaricus.

[0041] Y4 bacterial suspension: This involves preserving Kluyveromyces martensii Y4 (… Kluyveromyces marxianus Y4 was removed from the frozen environment and inoculated into YPD liquid medium for three generations of activation. The bacterial suspension was centrifuged at 8000 rpm for 10 min, and the cells were washed 2-3 times with sterile water. An equal volume of sterile water was then added to mix the cells thoroughly, yielding the Y4 bacterial suspension. The CFU of the Y4 bacterial suspension was 1.54 × 10⁻⁶. 5 CFU / mL; all of the above were performed under aseptic conditions.

[0042] A3 bacterial suspension: The purchased Kluyveromyces martensii yeast... Kluyveromyces marxianus (ECHansen) van der Walt prepared the A3 bacterial suspension according to the method described above. The CFU of the A3 bacterial suspension was 1.62 × 10⁻⁶. 5CFU / mL, Kluyveromyces martensii was purchased commercially and its name is: Kluyveromyces marxianus The colony morphology of the *Kluyveromyces martensii* obtained from (EC Hansen) van der Walt, with the serial number BNCC372528, is similar to that of *Kluyveromyces martensii* Y4 of this invention, and both were isolated from yogurt, making them highly comparable.

[0043] (2) Prepare the fermentation system and ferment. The Y4 fermentation system includes: 100 ml of aseptic reconstituted milk, 7 g of sucrose, 0.2 g of commercial yogurt starter, and 3 ml of Y4 bacterial suspension. Mix the fermentation system evenly and ferment at a constant temperature of 38°C until curd forms. After fermentation, the mixture will be curd-like, thus obtaining yogurt Y4.

[0044] The Y4-1 fermentation system includes: 100 ml of aseptic reconstituted milk, 6 g of sucrose, 0.2 g of commercial yogurt starter, and 4 ml of Y4 bacterial suspension. Mix the fermentation system evenly and ferment at a constant temperature of 37°C until curd forms. After fermentation, the mixture will be curd-like, thus obtaining yogurt Y4-1.

[0045] The Y4-2 fermentation system includes: 100 ml of aseptic reconstituted milk, 5 g of sucrose, 0.2 g of commercial yogurt starter, and 4 ml of Y4 bacteria suspension. Mix the fermentation system evenly and ferment at a constant temperature of 38℃ until curd forms. After fermentation, the mixture will be curd-like, thus obtaining yogurt Y4-2.

[0046] Blank control fermentation system: 100 ml of aseptic reconstituted milk, 7 g of sucrose, and 0.2 g of commercial yogurt starter; mix the fermentation system evenly and ferment at a constant temperature of 37℃ until curd forms. After fermentation, the yogurt in the control group (LS) is obtained.

[0047] A3 strain control fermentation system: 100 ml aseptic reconstituted milk, 7 g sucrose, 0.2 g commercial yogurt starter, 3 ml A3 strain suspension; mix the fermentation system evenly, ferment at 37℃ until curdled, and after fermentation, it is curdled; yogurt A3 is obtained.

[0048] The sample data of yogurt Y4, yogurt Y4-1, and yogurt Y4-2 showed little difference, with the difference within ±4%. To avoid excessive data description, the data of yogurt Y4 will be presented as a representative below.

[0049] (3) Determine the ethanol content of yogurt Y4, control group yogurt LS and yogurt A3. Principle: Potassium dichromate is reduced by ethanol to produce Cr. 3+ Colorimetric analysis was performed at the maximum absorption wavelength of 610 nm, and the absorbance was directly proportional to the ethanol content.

[0050] 3C2H5OH + 2Cr2O7 2-+16H + =4Cr 3+ +3CH3COOH+11H2O Measurement steps: 3.1 Preparation of Standard Curve Take 2.5 mL of anhydrous ethanol and add it to a 50 mL volumetric flask, then dilute to volume to prepare a 5% ethanol standard solution. Take 0, 1, 2, 3, 4, 5, 6, and 7 mL of the above ethanol standard solution and dilute to volume in 50 mL volumetric flasks respectively. Add 5 mL of each of the above standard solutions to an Erlenmeyer flask as the reaction solution.

[0051] Add 10 mL of 2.0% potassium dichromate solution and 5 mL of 98% concentrated sulfuric acid sequentially to an Erlenmeyer flask and mix well. React for 10 min, shake well, and cool to room temperature. Using a blank standard solution as a reference, plot the absorbance against alcohol concentration at 610 nm. Calculations show that the alcohol concentrations corresponding to 0, 1, 2, 3, 4, 5, 6, and 7 mL are 0%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, and 0.7%, respectively. Figure 5 As shown, the standard curve for ethanol was obtained.

[0052] 3.2 Sample Determination Sample preparation: Centrifuge the yogurt sample at 9000 rpm for 15 min and collect the supernatant for later use. Add 1 mL of the supernatant to a 50 mL volumetric flask and make up to volume. Add 5 mL of the supernatant to an Erlenmeyer flask and wait for the reaction to proceed. Sample reaction: Add 10 mL of 2.0% potassium dichromate solution and 5 mL of 98% concentrated sulfuric acid to an Erlenmeyer flask, mix well, seal the flask, react for 10 min, shake well, and cool to room temperature. Use a blank standard solution as a reference and measure the absorbance at a wavelength of 610 nm.

[0053] Determination of sample alcohol content: Calculate the corresponding alcohol content based on the standard curve. Results are as follows... Figure 6 As shown. From Figure 6 It can be seen that the ethanol content of yogurt Y4 (2.9061 g / L) is significantly higher than that of the control group yogurt LS and yogurt A3. Yeast produces ethanol during the fermentation process of yogurt, and ethanol can bring unique quality and taste to yogurt.

[0054] (4) Determination of volatile flavor compounds in yogurt Y4, control group yogurt LS and yogurt A3 Besides alcohols, which enhance the rich and creamy flavor of yogurt, esters, acids, ketones, and aldehydes further enhance its aroma. Therefore, this embodiment measures not only alcohols but also esters, acids, ketones, and aldehydes in yogurt.

[0055] Sample pretreatment: 5 mL of yogurt Y4, control group yogurt LS and yogurt A3 were loaded into 20 mL chromatographic sample vials and equilibrated at 55℃ for 20 min. The aged (250℃, 5 min) extraction head was inserted into the chromatographic sample vial and extracted at 50℃ for 30 min. Then it was inserted into the gas chromatograph injection port and desorbed at 240℃ for 5 min.

[0056] Gas chromatography conditions: initial temperature 35℃, hold for 3 min; increase temperature to 210℃ at 6℃ / min, hold for 10 min. Injector temperature 240℃; carrier gas: He, flow rate 1.5 mL / min; split ratio 10:1.

[0057] Mass spectrometry conditions: ionization method: EI source; electron energy: 70 eV; ion source temperature: 230℃; mass scan range: m / z 35-500; emission current: 100 μA.

[0058] The types and contents of volatile flavor compounds produced by yogurt Y4, control group yogurt LS, and yogurt A3 are shown in Tables 3, 4, and 5. To more intuitively compare the volatile flavor compounds produced by yogurt Y4, control group yogurt LS, and yogurt A3, the data in Tables 3, 4, and 5 are presented in bar charts.

[0059] Table 3. Types and contents of volatile flavor compounds in yogurt Y4 In Table 3, "-" indicates that it was not detected.

[0060] Table 4. Types and contents of volatile flavor compounds in the control group yogurt LS In Table 4, "-" indicates that it was not detected.

[0061] Table 5. Types and contents of volatile flavor compounds in Yogurt A3 In Table 5, "-" indicates that it was not detected.

[0062] comprehensive Figure 7 , Figure 8 and Figure 9It can be seen that yogurt Y4 with added Kluyveromyces martensii Y4 produced significantly higher levels of esters, alcohols, acids, and aldehydes than the control yogurts LS and A3. Furthermore, the variety and number of volatile flavor compounds produced were also higher in yogurt Y4 than in LS and A3. The increase in alcohol content was particularly significant, with isobutanol (0.3778 mg / mL) and isoamyl alcohol (1.743 mg / mL) levels in Y4 significantly higher than in LS and A3. These volatile alcohol flavor compounds provide the yogurt with a richer texture and unique flavor profile.

[0063] (5) Tasting of yogurt Y4, control group yogurt LS and yogurt A3 Sensory evaluation was conducted on the three groups of yogurts. The evaluation panel consisted of 10 judges, and the main evaluation criteria were based on four indicators: color, aroma, taste and texture of the yogurt. The specific evaluation criteria are shown in Table 6.

[0064] Table 6 Sensory Evaluation Form The specific sensory evaluation results are shown in Table 7. Compared with yogurt fermented with traditional lactic acid bacteria, yogurt with added yeast has a richer and more unique flavor. The alcohols produced by yeast (such as phenylethyl alcohol and isobutanol) add pleasant floral and fruity aromas to the yogurt, and also bring a certain degree of smoothness and effervescence, improving the taste of the yogurt. This embodiment also compared it with yogurt fermented with commercially available Kluyveromycin. The Kluyveromycin provided in this embodiment is slightly superior to commercially available Kluyveromycin in terms of flavor and taste, and has good application prospects.

[0065] Table 7 Sensory rating results sequence list <110> Shihezi University <120> A Max Kluyveromyces strain that produces high levels of aromatic compounds and its applications <160> 1 <210> 1 <211> 728 <212> DNA <213> Kluyveromyces marxianus <400> 1 CCTCTCCGTAGGGTGAACCTGCGGAAGGATCATTAAAGATTATGAATGAATAGATTACTG60 GGGGAATCGTCTGAACAAGGCCTGCGCTTAATTGCGCGGCCAGTTCTTGATTCTCTGCTA120 TCAGTTTTCTATTTCTCATCCTAAACACAATGGAGTTTTTTCTCTATGAACTACTTCCCT180 GGAGAGCTCGTCTCTCCAGTGGACATAAACACAAACAATATTTTGTATTATGAAAAACTA240 TTATACTATAAAATTTAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCG300 ATGAAGAACGCAGCGAATTGCGATATGTATTGTGAATTGCAGATTTTCGTGAATCATCAA360 ATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCAT420 TTCTCTCTCAAACCTTTGGGTTTGGTAGTGAGTGATACTCGTCTCGGGTTAACTTGAAAG480 TGGCTAGCCGTTGCCATCTGCGTGAGCAGGGCTGCGTGTCAAGTCTATGGACTCGACTCT540 TGCACATCTACGTCTTAGGTTTGCGCCAATTCGTGGTAAGCTTGGGTCATAGAGACTCAT600 AGGTGTTATAAAGACTCGCTGGTGTTTGTCTCCTTGAGGCATACGGCTTTAACCAAAACT660 CTCAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAAAAGCC720 GGAGGAAA728

Claims

1. A Kluyveromyces macrocephala strain that produces high levels of aromatic compounds, characterized in that, The Kluyveromyces macrocephala strain that produces high levels of aromatic compounds is Kluyveromyces macrocephala Y4, and the strain is named Kluyveromyces macrocephala Y4. Kluyveromyces marxianus Y4), deposited at the China Center for Type Culture Collection, accession number: CCTCC NO: M2025759, deposited on April 11, 2025.

2. The application of the Kluyveromyces martensii strain as described in claim 1, which produces high levels of aroma compounds, in the preparation of aroma-rich yogurt.

3. The application according to claim 2, characterized in that, The fermentation system of the yogurt consists of reconstituted milk, sucrose, yogurt starter, and Max Kluyveromyces Y4.

4. The application according to claim 3, characterized in that, The reconstituted milk contains 12% milk powder by weight, the added sucrose is 5-7% of the reconstituted milk by weight, the yogurt starter is a direct-inoculation yogurt starter, and the added amount of the direct-inoculation yogurt starter is 0.2% of the reconstituted milk by weight. The Kluyveromyces macrocephala Y4 is a suspension of Kluyveromyces macrocephala Y4, and the viable count of the Kluyveromyces macrocephala Y4 suspension is 1.54 × 10⁻⁶. 5 The amount of CFU / mL Kluyveromyces macrocephala Y4 suspension added was 3-4% of the reconstituted milk mass.

5. The application according to claim 3 or 4, characterized in that, The reconstituted milk is obtained by mixing milk powder with water and then sterilizing it.

6. A method for preparing a rich and flavorful yogurt, characterized in that, Including the following steps: (1) Preparation of raw materials By weight, 100 parts reconstituted milk, 5-7 parts sucrose, 0.2 parts yogurt starter, and 3-4 parts Max Kluyveromyces Y4 suspension; The Kluyveromyces martensii Y4 suspension was composed of sterile water and Kluyveromyces martensii Y4, wherein the viable count of the Kluyveromyces martensii Y4 suspension was 1.54 × 10⁻⁶. 5 CFU / mL; Max Kluyveromycin Y4 ( Kluyveromyces marxianus Y4), accession number: CCTCC NO: M2025759, accession date: April 11, 2025, accession address: China Center for Type Culture Collection; (2) Fermentation Mix the ingredients evenly and ferment at 37-38℃ until curd forms, thus obtaining a rich and flavorful yogurt.

7. The method for preparing rich and flavorful yogurt according to claim 6, characterized in that, The volatile flavor compounds produced during the fermentation of the mellow-flavored yogurt include: ethanol, cyclobutanol, isobutanol, isoamyl alcohol, n-octanol, phenylethanol, and tetrahydrolinalool.

8. The method according to claim 6, characterized in that, The reconstituted milk is obtained by mixing milk powder with water and then sterilizing it.

9. The method according to claim 6, characterized in that, The yogurt starter is a direct-inoculation yogurt starter, and its components include maltodextrin, Streptococcus salivarius subsp. thermophilus, and Lactobacillus delbrueckii subsp. bulgaricus.

10. The method according to claim 6, characterized in that, By weight, the ingredients are 100 parts reconstituted milk, 7 parts sucrose, 0.2 parts yogurt starter, and 3 parts Max Kluyveromyces Y4 suspension. The fermentation temperature is 38℃, and the reconstituted milk contains 12% milk powder.

Images