Aire yeast and construction method thereof
By knocking out the TUP1 gene in yeast using gene editing technology, the problem of glucose repression during brewer's yeast fermentation was solved, which improved the fermentation speed and degree while maintaining other yeast properties and flavor.
Patent Information
- Application Number
- CN202511084605.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-04
- Publication Date
- 2025-11-11
AI Technical Summary
During the fermentation of brewer's yeast in wort, glucose repression leads to lower fermentation degree and longer fermentation cycle. Existing technologies such as process optimization and mutation breeding methods are inefficient and non-directional, which may have a negative impact on yeast performance.
By knocking out the TUP1 transcription factor gene in yeast using gene editing technology, Ayers yeast was constructed using the CRISPR/Cas9 system to enhance its utilization of maltose and maltotriose and improve fermentation.
It significantly improves fermentation speed and degree while maintaining the stability of other yeast properties, and does not significantly affect the synthesis of organic acids and flavor compounds.
Smart Images

Figure HDA0005532012530000011 
Figure HDA0005532012530000012 
Figure HDA0005532012530000013
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to an aerobacterium and its construction method. Background Technology
[0002] In the long process of evolution and adaptation to nature, microorganisms mostly prioritize the carbon source with the best growth rate, thus developing different priorities for utilizing different carbon sources. Monosaccharides such as glucose and fructose can be directly utilized by microorganisms and converted into various substances and energy required for life, making them their preferred carbon source. When glucose is abundant in the environment, microorganisms only use glucose for growth and do not metabolize other carbon sources. However, when glucose is scarce, microorganisms will activate other carbon sources. This phenomenon of microorganisms preferentially utilizing glucose and inhibiting the metabolism of other carbon sources is called glucose repression, also known as the glucose effect.
[0003] Wort contains various sugars, such as the monosaccharide glucose, the disaccharide maltose, and the trisaccharide maltotriose, with maltose and maltotriose accounting for over 60%. Therefore, the fermentation process of brewer's yeast in wort is affected by glucose repression. Because yeast preferentially utilizes glucose, it limits the utilization rate of maltose and maltotriose, thus affecting overall fermentation performance (lower fermentation degree and longer fermentation cycle). A lower fermentation degree may affect the beer's taste, foam properties, and stability. Simultaneously, a longer fermentation cycle increases production costs, so brewing strains require strict control of the fermentation degree. The main strategy for improving the fermentation degree is to relieve or weaken the yeast's glucose repression. That is, in the presence of glucose, to enhance the yeast's ability to utilize maltose and maltotriose, thereby improving the yeast's fermentation degree and ultimately shortening the fermentation cycle.
[0004] Currently, improving the fermentation rate of brewer's yeast can be achieved through process optimization, such as adjusting the saccharification process to increase the proportion of glucose in the wort, thereby improving sugar utilization. However, excessively high glucose content leads to increased osmotic pressure in the wort, which in turn slows down the fermentation rate. Furthermore, it can also result in the formation of higher alcohols. Some studies have reported that exogenous addition of Mg... 2+It can partially alleviate the inhibitory effect of glucose on Saccharomyces cerevisiae in the environment. However, process optimization has limited effect on improving fermentation degree. Screening for strains that alleviate glucose repression using glucose structural analogs is another approach. Mutagenesis breeding (physical or chemical methods) can yield a large number of random mutants. Using the glucose analog D-2-deoxyglucose as a selection pressure, the mutagenic strains can be screened to obtain strains that overcome the glucose metabolite repression effect. However, the randomness and non-directedness of mutagenesis mean that the location and nature of the mutated genes are difficult to predict and control, which may lead to randomness in the acquisition of desired traits. Furthermore, the mutagenesis process is often accompanied by paramutations, meaning that the proportion of strains with undesirable traits in the mutant library is much higher than that of strains with the target trait, which may negatively impact other important characteristics such as growth rate and flavor compound synthesis. Therefore, iterative breeding is often necessary, resulting in long breeding cycles and low efficiency. Summary of the Invention
[0005] To address the aforementioned problems, this invention provides an ale yeast that significantly improves fermentation efficiency without significantly affecting the synthesis of organic acids, 4-VG, and flavor components, while maintaining other properties of the strain at normal levels. This ale yeast can better overcome the repression caused by glucose in the wort during the early stages of fermentation, significantly increasing the fermentation rate.
[0006] To achieve the above objectives, the present invention provides an alfalfa, the preservation number of which is CGMCCNO.35020, and the preservation institution is the China General Microbiological Culture Collection Center.
[0007] In one embodiment, the Aer yeast knocked out the transcription factor TUP1 gene.
[0008] With the rapid development of biotechnology, the development of various gene editing methods has provided more precise and efficient tools for targeted breeding. Gene editing is one of the most efficient methods to directly alter the traits of microorganisms. By knocking out key genes in the glucose repression mechanism pathway, it alleviates or eliminates the glucose effect at the molecular level, modifying the fermentation characteristics of yeast, and usually without affecting other yeast properties. Therefore, developing efficient gene editing tools and deeply exploring key genes related to improved fermentation degree are crucial for breeding strains with high fermentation degree. In addition, combining gene editing technology with in-depth research on yeast metabolic pathways and their regulatory mechanisms can achieve more targeted and efficient breeding strategies. However, the genetic backgrounds of different industrial strains vary greatly, and even if the same functional genes are knocked out, whether the phenotype of the strain can achieve the original research and development goals remains highly uncertain. Meanwhile, the inventors discovered during their research that glucose mainly regulates the glucose repression effect in yeast through the Snfl / Mig1 signaling pathway. In the presence of glucose, Snf1 is dephosphorylated and inactivated, allowing Mig1 to enter the nucleus. This Mig1 then recruits the repression complex Cyc8 / SSN6-TUP1 to bind to the promoter region of the repressed target gene, ultimately inhibiting the expression of the relevant gene at the transcriptional level. Therefore, the inventors attempted to knock out the key repression factors SSN6 and TUP1 to block or weaken their transcriptional repression regulation of genes related to maltose and maltotriose utilization. This resulted in improved utilization of maltose and maltotriose in the presence of glucose, thereby improving yeast fermentation. Furthermore, after successful gene knockout, the inventors conducted performance tests on the recombinant engineered strain after knockout. They found that the fermentation rate of *Saccharomyces cerevisiae* with the TUP1 gene knocked out was significantly improved, without significant impact on the synthesis of organic acids, 4-VG, and flavor components. Other performance characteristics of the strain remained at normal levels. This *Saccharomyces cerevisiae* can better overcome the repression caused by glucose in the wort during the early fermentation stage, significantly improving the fermentation rate.
[0009] The present invention also provides an expression system for *Saccharomyces cerevisiae*, the expression system comprising a dual expression cassette and a donor fragment; the dual expression cassette comprising an sgRNA expression cassette and a Cas protein; the dual expression cassette and the donor fragment are introduced into competent cells for gene knockout to obtain *Saccharomyces cerevisiae*.
[0010] In one embodiment, the sgRNA expression cassette includes a first sequence and a second sequence, the first sequence being shown in SEQ ID NO.1 and the second sequence being shown in SEQ ID NO.2.
[0011] In one embodiment, the Cas protein includes Cas9.
[0012] In one embodiment, the donor fragment includes an upper homologous arm and a lower homologous arm, the sequence of the upper homologous arm being shown in SEQ ID NO.3 and the sequence of the lower homologous arm being shown in SEQ ID NO.4.
[0013] The present invention also provides a method for constructing the *Aureobasidium*, comprising the following steps: introducing the expression system into competent cells for gene knockout to obtain the *Aureobasidium*.
[0014] The present invention also provides the application of the expression system or the construction method in strain selection.
[0015] The present invention also provides a method for strain selection, comprising the following steps: obtaining *Ayers yeast* using the aforementioned construction method.
[0016] Compared with the prior art, the present invention has the following beneficial effects:
[0017] This invention discloses an ale yeast and its construction method. The fermentation degree of this ale yeast is significantly improved, and it does not significantly affect the synthesis of organic acids, 4-VG, and flavor components, while maintaining other properties of the strain at normal levels. This ale yeast can better overcome the repression caused by glucose in the wort during the early stage of fermentation, significantly increasing the fermentation rate. Attached Figure Description
[0018] Figure 1 Agarose gel electrophoresis images of recombinant engineered strains (△TUP1 strain and △SSN6 strain);
[0019] Figure 2 The fermentation performance results of the starting strain (ZPJ303-1) and the recombinant engineered strains (△TUP1 strain and △SSN6 strain) are shown in the figure.
[0020] Figure 3 The results show the peak areas of sugar components for the starting strain (ZPJ303-1) and the recombinant engineered strains (△TUP1 strain and △SSN6 strain);
[0021] Figure 4 The graph shows the organic acid synthesis results of the starting strain (ZPJ303-1) and the recombinant engineered strains (△TUP1 strain and △SSN6 strain);
[0022] Figure 5 The graph shows the 4-VG synthesis results of the starting strain (ZPJ303-1) and the recombinant engineered strains (△TUP1 strain and △SSN6 strain);
[0023] Figure 6The results of flavor compound synthesis for the starting strain (ZPJ303-1) and the recombinant engineered strains (△TUP1 strain and △SSN6 strain) are shown in the figure. Detailed Implementation
[0024] To facilitate understanding of the present invention, a more complete description will be given below with reference to the accompanying drawings. Preferred embodiments of the invention are shown in the drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention.
[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the specification of this invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.
[0026] Unless otherwise specified, all reagents, materials, and equipment used in this embodiment are commercially available; unless otherwise specified, all experimental methods are conventional experimental methods in this field.
[0027] Biological Preservation Instructions:
[0028] Biomaterial name: ZPJ303-1(△TUP1)
[0029] Preservation Institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee
[0030] Collection institution abbreviation: CGMCC
[0031] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing
[0032] Deposit date: June 26, 2025
[0033] Collection Center Registration Number: CGMCC NO.35020 Classification and naming: Saccharomyces cerevisiae.
[0034] Example 1
[0035] This invention develops a CRISPR / Cas9-based gene editing tool for *Saccharomyces cerevisiae* ZPJ303-1 preserved at the R&D center of Guangzhou Nansha Zhujiang Beer Co., Ltd. The specific steps are as follows:
[0036] I. Construction of △TUP1 and △SSN6 strains.
[0037] 1. Preparation method of Ale yeast ZPJ303-1 competent cells.
[0038] (1) Pick a fresh, activated yeast single colony from YPD and inoculate it into a 50mL Erlenmeyer flask containing 10mL YPD liquid medium. Incubate at 30℃ and 250rpm for 20-24h.
[0039] (2) Control the initial OD 600 =0.6, the yeast seed culture was transferred to a 250mL Erlenmeyer flask containing 50mL YPD liquid medium, and incubated at 30℃ and 250rpm for about 3 hours before measuring OD. 600 When OD 600 When the bacterial culture reaches 1.2, the bacterial culture is aliquoted into two 50mL sterile centrifuge tubes, centrifuged at room temperature, 4,000rpm for 5min, and the supernatant is discarded.
[0040] (3) Add 40 mL of freshly prepared and filtered sterilized LDST solution to each of the two 50 mL sterile centrifuge tubes to resuspend the bacterial cells. Incubate at 30 °C for 25 min, centrifuge at 4 °C and 4,000 rpm for 5 min, and discard the supernatant.
[0041] (4) Add 10 mL of pre-chilled 1M sorbitol to each of the two 50 mL sterile centrifuge tubes to resuspend the bacterial cells. Centrifuge at 4°C, 4,000 rpm for 5 min, and discard the supernatant. Repeat this step 3 times;
[0042] (5) Finally, add 400 μL of pre-cooled 1M sorbitol to resuspend the bacterial cells, and take 100 μL of competent cells into a 1.5 mL sterile centrifuge tube and store at -80℃ for later use.
[0043] 2. Construction of a gene editing tool to knock out TUP1 and SSN6.
[0044] (1) Gene editing tools that knock out TUP1.
[0045] Gene editing plasmids pCfB3052 and pCfB2312 were purchased from Addgene. Homologous recombination cloning kit (Hieff) The Universal II One Step Cloning Kit was purchased from Yisheng Company, and the operation method was performed according to the kit instructions. Obtain the CRISPR / Cas9-Cas-sgRNA (TUP1) plasmid: The sgRNA sequence was designed, and the sgRNA (TUP1) expression cassette was constructed. This sgRNA (TUP1) expression cassette includes the first sequence:
[0046] GAAGGCTTTAATTTGCGGCCGGTACCGAGCTCTCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACTTGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTACAACTCTAGATTTTGTAGTGCCCTCT TGGGCTAGCGGTAAAGGTGCGCATTTTTTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAGTGAAAGTTGGTGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATCGCTTCTCGATGCCATCAGAC(SEQ ID NO.1);
[0047] Second sequence:
[0048] GCTTCTCGATGCCATCAGACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGGTGCTTTTTTTGTTTTTTATGTCTGCGGCCGCCAATTCGCCCTATAGTGAGT (SEQ ID NO. 2).
[0049] The first and second sequences of the sgRNA (TUP1) expression cassette fragment were amplified using two pairs of primers, PSNR52-S and TUP1-PA, and TUP1-TS and sgRNA-A, respectively. These sequences were then fused using fusion PCR to form the complete sgRNA (TUP1) expression cassette, named Cas-sgRNA (TUP1). Cas-sgRNA (TUP1) was inserted into the vector pCfB2312 using restriction enzyme sites to obtain the dual-expression cassette plasmid CRISPR / Cas9-Cas-sgRNA (TUP1), carrying both Cas9 and the TUP1-targeting sgRNA expression cassette (i.e., the dual expression cassette).
[0050] Construct a donor fragment for knocking out the TUP1 gene, which includes the upper homologous arm:
[0051] GAAGGCTTTAATTTGCGGCCGGTACCGAGCTCTCTTTGAAAAGATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACTTGATGTTTTCTTTCGAGTATATACAAGGTGATTACATGTACGTTTGAAGTACAACTCTAGATTTTGTAGTGCCCTCT TGGGCTAGCGGTAAAGGTGCGCATTTTTTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAGTGAAAGTTGGTGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATCGGGCGGTGAACAAACAATAA(SEQ ID NO.3);
[0052] Lower homologous arm:
[0053] GGGCGGTGAACAAACAATAAGTTTTAGCTAGAAATAGCAAGTTAAAATAAGGCT AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGGTGCTTTTTTTGTTTTTTATGTCTGCGGCCGCCAATTCGCCCTATAGTGAGT (SEQ ID NO. 4).
[0054] The upper and lower homologous arms of the donor fragment were amplified using two pairs of primers, U-TUP1-DS, U-TUP1-A and D-TUP1-S, D-TUP1-A. The upper and lower homologous arms were then fused using fusion PCR to obtain a complete donor fragment.
[0055] The primer sequences used in the above-mentioned methods for preparing sgRNA expression cassettes carrying Cas9 and targeting TUP1, and donor fragments are shown below:
[0056] PSNR52-S:5'-GAAGGCTTTAATTTGCGGCCGGTACCGAGCTCTCTTTGAAAAGATAAT GTATG-3' (SEQ ID NO.5);
[0057] TUP1-PA:5'-GTCTGATGGCATCGAGAAGCGATCATTTATCTTTCACTGCGGAGAAG-3' (SEQ IDNO.6);
[0058] TUP1-TS:5'-GCTTCTCGATGCCATCAGACGTTTTAGAGCTAGAAATAGCAAGTTAAA ATAAGGC-3' (SEQ ID NO.7);
[0059] sgRNA-A:5'-ACTCACTATAGGGCGAATTGGCGGCCGCAGACATAAAAAACAAAAAA AGCACC-3'(SEQ ID NO.8);
[0060] U-TUP1-DS:5'-GTAAAGTGTTCCTTTTGTGTTCTGTTCGCTGATTTCTTTCTTCCCCTG C-3' (SEQ ID NO.9);
[0061] U-TUP1-A:5'-GCCACTAGTAAGTCTGCGGAATCGATC-3' (SEQ ID NO. 10);
[0062] D-TUP1-S:5'-GAACAACGCCCTAGATATAGTGACCC-3' (SEQ ID NO. 11);
[0063] D-TUP1-A: 5'-GAACAGAACACAAAAGGAACACTTTAC-3' (SEQ ID NO. 12).
[0064] (2) Gene editing tools that knock out SSN6.
[0065] Similarly, construct the gene-editing tool plasmid CRISPR / Cas9-Cas-sgRNA(SSN6) and donor fragment to knock out SSN6. Obtain the CRISPR / Cas9-Cas-sgRNA(SSN6) plasmid: design the sgRNA sequence and construct the sgRNA(SSN6) expression cassette.
[0066] The upper and lower portions of the sgRNA (SSN6) expression cassette fragment were amplified using two pairs of primers, PSNR52-S and SSN6-PA, and SSN6-TS and sgRNA-A, respectively. These portions were then fused using fusion PCR to form the complete sgRNA (SSN6) expression cassette, named Cas-sgRNA (SSN6). Cas-sgRNA (SSN6) was inserted into the vector pCfB2312 using restriction enzyme sites to obtain the dual-expression cassette plasmid CRISPR / Cas9-Cas-sgRNA (SSN6), carrying both Cas9 and an sgRNA expression cassette targeting SSN6.
[0067] Constructing a donor fragment for knocking out the SSN6 gene: The upper and lower homologous arms of the donor fragment were amplified using two pairs of primers, D-SSN6-S, D-SSN6-A and U-SSN6-DS, U-SSN6-A, and then fused by fusion PCR to obtain the complete donor fragment.
[0068] The primer sequences used in the above-mentioned methods for preparing sgRNA expression cassettes carrying Cas9 and targeting SSN6, as well as the donor fragment, are shown below:
[0069] PSNR52-S:5'-GAAGGCTTTAATTTGCGGCCGGTACCGAGCTCTCTTTGAAAAGATAAT GTATG-3' (SEQ ID NO.5);
[0070] SSN6-PA:5'-TTATTGTTTGTTCACCGCCCGATCATTTATCTTTCACTGCGGAGAAG-3'(SEQ IDNO.13)
[0071] SSN6-TS: 5'-GGGCGGTGAACAAACAATAAGTTTTAGAGCTAGAAATAGCAAGTTAA AATAAGGC-3' (SEQ ID NO. 14);
[0072] sgRNA-A:5'-ACTCACTATAGGGCGAATTGGCGGCCGCAGACATAAAAAACAAAAAA AGCACC-3'(SEQ ID NO.8);
[0073] D-SSN6-S:5'-GCATATATACGTGATTCATATGAAGG-3' (SEQ ID NO. 15);
[0074] D-SSN6-A:5'-GGAAGAAGATGAAAACTACGATGACT-3' (SEQ ID NO. 16);
[0075] U-SSN6-DS:5'-CATCGTAGTTTTCATCTTCTCCCCAGTCGTGTTTTGTTTGTTGTTG-3'(SEQID NO.17);
[0076] U-SSN6-A:5'-TCTAAGCGTCGGAACAACTGACGAA-3'(SEQ ID NO.18)
[0077] 3. Electroconversion method.
[0078] (1) Add 2 μg of CRISPR / Cas9-Cas-sgRNA (TUP1) and donor fragment to competent cells and mix gently with a pipette tip. Transfer to a pre-chilled electroporation cuvette and place on ice for 5 min;
[0079] (2) Set the voltage of the electric shock device to 1.5KV and the electric shock mode to Sc1 mode, and then perform an electric shock on the mixture once;
[0080] (3) Then transfer the mixture in the electroporation cup to 1 mL of 1 M sorbitol, incubate at 30°C for 1.5-2 h, centrifuge at 4,000 rpm for 2 min. Add 1 mL of LYPD medium, incubate at 30°C and 250 rpm for 2 h. Spread 100 μL of the bacterial culture onto a YPD+G418 (containing G418 antibiotic) plate. Incubate the plate at 30°C for approximately 3 days.
[0081] The same gene editing tool plasmid CRISPR / Cas9-Cas-sgRNA (SSN6) and donor fragment were electroporated into competent cells to construct the recombinant engineered strain △SSN6.
[0082] 4. Colony PCR identification of recombinant engineered strains.
[0083] (1) Randomly select several transformants, pick a small amount of bacterial cells from the plate with a sterile toothpick, and mix them evenly in a PCR tube containing 20 μL of 0.025 mM sodium hydroxide solution.
[0084] (2) Treat at 98℃ for about 20-25 min, then briefly centrifuge. After brief centrifugation, take 1 μL of the supernatant lysis buffer as a PCR template. Use identification primers TUP1-JD-A and D-TUP1-S to identify the recombinant engineered strain △TUP1, and identification primers D-SSN6-S and SSN6-JD-A to identify the recombinant engineered strain △SSN6. Colony PCR identification was performed using a high-fidelity Fx KOD system. The PCR reaction program was as follows: 94℃ pre-denaturation for 4 min, 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 68℃ extension for 1 min / kb, 30 cycles, followed by 68℃ extension for 5 min.
[0085] (3) Perform PCR products on 1% agarose gel electrophoresis. A single colony that identifies the target band is a positive transformant.
[0086] The identification primers are shown below:
[0087] TUP1-JD-A: 5'-CTGCAGCTGTTTGATCTCGGTTGC-3' (SEQ ID NO. 19);
[0088] D-TUP1-S:5'-GAACAACGCCCTAGATATAGTGACCC-3' (SEQ ID NO. 11);
[0089] D-SSN6-S:5'-GCATATATACGTGATTCATATGAAGG-3' (SEQ ID NO. 15);
[0090] SSN6-JD-A: 5'-CCATGGCGGGAAAGGGGTAACAGA-3' (SEQ ID NO. 20).
[0091] 5. Colony PCR identification results of recombinant engineered strains.
[0092] The identification bands of the recombinant strain after successful knockout of the TUP1 and SSN6 genes were approximately 2000 bp in length. The band length of the TUP1 gene without successful knockout was 4181 bp, and the band length of the SSN6 gene without successful knockout was 5020 bp. Colony PCR identification was performed (see...). Figure 1 Four strains with TUP1 knocked out and two strains with SSN6 knocked out were successfully obtained. Shake-flask performance tests were conducted on the successfully knocked-out engineered strains.
[0093] Example 2
[0094] Shake-flask fermentation test of recombinant engineered strains.
[0095] I. Experimental Procedure.
[0096] 1. Inoculate the successfully knocked-out engineered strain into a wort tube and culture overnight, then transfer it to a 250mL Erlenmeyer flask containing 50mL of wort and culture overnight.
[0097] 2. Control the initial OD 600 =0.5, inoculate into a 500mL Erlenmeyer flask containing 200mL wort, attach the fermentation plug, and liquid seal.
[0098] 3. Incubate at 20℃ for 7 days. During fermentation, record the changes in fermentation broth mass regularly. Compare the fermentation rates of different strains by CO2 loss mass, plot the fermentation broth mass loss versus time curves, and compare the fermentation rates of each strain. Furthermore, at the end of fermentation, centrifuge and collect the supernatant to detect and analyze the differences in sugar composition, flavor, degree of fermentation, and organic acids among the strains.
[0099] II. Experimental Results.
[0100] The results show that: Figure 2As shown in Figure -A, during the first three days of fermentation, the fermentation rate of strain △TUP1 was significantly higher than that of the starting strain ZPJ303-1, while the fermentation rate of strain △SSN6 was the lowest. By day 4, there was no significant difference in fermentation rate among the strains. By day 5, the fermentation rate of strain △SSN6 was slightly higher than that of the other two strains, mainly due to the higher residual amount of fermentable sugars in the fermentation broth. By tracking fermentation performance data, significant differences in fermentation rate were found among the three strains (see Figure -A). Figure 2 -B). Specifically, the fermentation degree of strain △TUP1 increased to 68.15% ± 0.15, a significant increase of 4.55% compared to the control ZPJ303-1's 63.6% ± 0.5. Conversely, the fermentation degree of strain △SSN6 decreased to 51% ± 0.3. These results indicate that knocking out the TUP1 gene can significantly improve the fermentation rate of strain ZPJ303-1, thereby further increasing the final fermentation degree.
[0101] The peak area results of the sugar components of the starting strain and the recombinant engineered strain are as follows: Figure 3 As shown, compared with the control ZPJ303-1, the residual sugar content of monosaccharides, disaccharides and trisaccharides in strain △TUP1 was significantly lower than that in control ZPJ303-1.
[0102] The results of organic acid synthesis of the starting strain and the recombinant engineered strain are as follows: Figure 4 As shown, from Figure 4 It can be seen that the synthesis of each organic acid in strain △TUP1 is not significantly different from that of the starting strain ZPJ303-1, indicating that knocking out TUP1 does not affect the synthesis of organic acids in the strain. However, knocking out the SSN6 gene has a significant impact on the synthesis of acetic acid in the strain.
[0103] The 4-VG synthesis amounts of the starting strain and the recombinant engineered strain are as follows: Figure 5 As shown, the flavor synthesis amounts of the starting strain and the recombinant engineered strain are as follows: Figure 6 As shown, from Figure 5 and Figure 6 It can be seen that the synthesis of 4-VG and flavor in strain △TUP1 was not significantly different from that in the starting strain ZPJ303-1, indicating that knocking out TUP1 does not affect the synthesis of 4-VG and flavor in the strain. However, knocking out the SSN6 gene has a negative impact on the synthesis of 4-VG and flavor in the strain. This indicates that the effect of the TUP1 gene on the strain is more specific, while the SSN6 gene affects multiple characteristics of the strain.
[0104] In summary, the development of CRISPR / Cas9 gene editing technology targeting Ale yeast, which resulted in the recombinant engineered strain △TUP1 by knocking out the global repressor TUP1, significantly improved the final fermentation degree without significantly affecting the synthesis of organic acids, 4-VG, and flavor components, and without altering other properties of the strain. This also indicates that it can better overcome the repression caused by glucose in the wort during the early stages of fermentation, significantly increasing the fermentation rate.
[0105] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0106] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. An alfalfa, characterized in that, The preservation number of this *A. aeruginosa* is CGMCC NO.35020, and the preservation institution is the China General Microbiological Culture Collection Center.
2. The yeast according to claim 1, characterized in that, The transcription factor TUP1 gene was knocked out in the *Aureobasidium*.
3. An expression system for *Ayersia elegans*, characterized in that, The expression system includes a dual expression cassette and a donor fragment; the dual expression cassette includes an sgRNA expression cassette and a Cas protein; the dual expression cassette and the donor fragment are introduced into competent cells for gene knockout to obtain *Ayersia elegans* as described in any one of claims 1-2.
4. The expression system according to claim 3, characterized in that, The sgRNA expression cassette includes a first sequence and a second sequence, the first sequence being shown in SEQ ID NO.1 and the second sequence being shown in SEQ ID NO.
2.
5. The expression system according to claim 3, characterized in that, The Cas protein includes Cas9.
6. The expression system according to claim 3, characterized in that, The donor fragment includes an upper homologous arm and a lower homologous arm, the sequence of which is shown in SEQ ID NO.3 and the sequence of which is shown in SEQ ID NO.
4.
7. The method for constructing *Aystomachus* according to any one of claims 1-2, characterized in that, The process includes the following steps: introducing the expression system of any one of claims 3-6 into competent cells for gene knockout to obtain the yeast of any one of claims 1-2.
8. The application of the expression system according to any one of claims 3-6 or the construction method according to claim 7 in strain selection.
9. A method for strain selection, characterized in that, The process includes the following steps: obtaining *Ayers yeast* using the construction method described in claim 7.