PLtetO-1-based constitutive promoter mutant and application thereof

Abstract

The invention discloses a constitutive promoter mutant based on PLtetO-1 and application of the constitutive promoter mutant, and belongs to the technical field of molecular biology. The nucleotide sequence of the PLtetO-1 constitutive promoter-based mutant is shown as SEQ ID NO: 2, the mutant can be combined with a fluorescence reporter gene to construct a fluorescence reporter system, the transcription efficiency driven by the mutant is improved by about 9 times compared with that of an original PLtetO-1 promoter through verification, the performance advantage of constitutive expression of the PLtetO-1 constitutive promoter in a tetR-free host is reserved, and the application range of the PLtetO-1 constitutive promoter is widened. And the constructed enhanced report system provides an efficient and reliable analysis tool for gene expression regulation research, and shows important application value in the fields of synthetic biology and metabolic engineering.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a constitutive promoter mutant based on PLtetO-1, comprising an expression cassette of the promoter mutant, a recombinant vector, a recombinant host cell, and a method for enhancing the expression of a target gene. Background Technology

[0002] With the development of synthetic biology and metabolic engineering, research on the precise regulation of target gene expression and the dynamic balance of metabolic flux using regulatory elements has been continuously deepening. Gene regulatory elements, as the core tools in this field, directly determine the efficiency of target product synthesis and host cell adaptability through their design and optimization. Currently, regulatory elements mediating gene expression mainly regulate gene expression at four levels: transcriptional, post-transcriptional, translational, and protein stability. The main regulatory elements include promoters, ribosome binding sites, and terminators. Promoter engineering, due to its ability to directly control transcription initiation rates and its strong responsiveness to dynamic signals, has become the most commonly used transcriptional-level regulatory method.

[0003] In the field of gene expression regulation, promoters are core components controlling the transcription efficiency of exogenous genes, and their performance directly affects the expression levels of downstream genes and the stability of the system. Currently, commonly used promoters mainly include natural promoters (such as lacUV5 and araBAD), artificially modified promoters (such as the T7 system and Ptac), and phage promoters (such as the λ phage PL promoter). These promoters have shown their respective advantages in different application scenarios, but they also have obvious limitations.

[0004] The PLtetO-1 promoter is an artificially constructed promoter composed of the λ phage PL promoter and the tetracycline regulatory system (tetO). In fluorescent reporter systems, the PLtetO-1 promoter functions as a constitutive promoter in tetR-free hosts without relying on inducer regulation, effectively avoiding interference from in vivo inducer concentration fluctuations on fluorescence signals and providing a more stable expression basis for gene function studies.

[0005] Currently, fluorescent reporter systems based on constitutive promoters and fluorescent reporter genes (such as GFP and RFP) are widely used in fields such as microbial plasmid dynamic tracking and in vivo animal imaging. However, the problem of insufficient promoter activity is becoming increasingly prominent: low fluorescence signal intensity and limited tissue penetration, especially in deep tissue detection where it is difficult to achieve the high signal-to-noise ratio imaging requirements. This deficiency leads to multiple challenges for the system: light intensity attenuation weakens the stability of long-term observation, low penetration restricts the accurate localization of deep targets, and the imbalance between nonspecific background signal and signal-to-noise ratio further reduces detection sensitivity. Therefore, optimizing the PLtetO-1 promoter through rational design to construct a novel fluorescent reporter system that combines high intensity, high stability, deep penetration, high specificity, and low operating cost has become a key research direction for breaking through existing technical barriers and improving the accuracy and applicability of gene expression dynamic monitoring.

[0006] In industrial-scale protein production, although the PLtetO-1 promoter performs well in terms of regulatory range and leakage expression, its constitutive expression level is still inferior to that of the T7 promoter, which represents a significant gap for applications requiring high-level production of exogenous proteins. To achieve ideal yields of target products, the development of a toolkit for regulating the expression of key genes in the product synthesis pathway is essential. Therefore, it is necessary to obtain more efficient constitutive promoters based on PLtetO-1 through random mutation and targeted screening to meet the demands of industrial production for high expression levels. Summary of the Invention

[0007] This invention systematically optimizes the PLtetO-1 promoter and, through synergistic innovation of gene mutation technology and the pUC19 plasmid vector system, successfully constructs a novel recombinant plasmid expression vector with significantly improved performance. Based on a high-throughput screening strategy, combined with single-colony screening and sequencing verification techniques, a promoter library was successfully constructed. Fluorescence intensity monitoring technology was used to verify candidate elements, screening for novel promoter variants with significantly improved and stable transcription efficiency. This invention, through optimization of the PLtetO-1 promoter, aims to develop constitutive promoters with higher expression levels and low leakage, providing a more ideal solution for gene function research and industrial-scale protein production.

[0008] This invention includes the following technical solutions:

[0009] In a first aspect, the present invention provides a polynucleotide mutant with promoter activity, characterized in that the polynucleotide with promoter activity is as shown in SEQ ID NO:1, the mutant has a mutation corresponding to the nucleotide sequence shown in SEQ ID NO:1, and the nucleotide sequence of the mutant is as shown in SEQ ID NO:2.

[0010] The information for the promoter-active polynucleotide sequence (SEQ ID NO:1) is as follows:

[0011] GTATCACGAGGCCCTTTCGTCTTCACCTCGAGTCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACATCAGCAGGACGCACTGACCGAATTCATTAAAGAGGAGAAAGGTACC

[0012] The nucleotide sequence information (SEQ ID NO:2) of the polynucleotide mutant with promoter activity is as follows:

[0013] CGTATCACGAGGCCCTTTCGTCTTCACTCGAGTCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACATCAGCAGGACGCACTGACCGAATTCATTAAAGAGGAGAAAGGTACC

[0014] The polynucleotides or polynucleotide mutants described in this invention also include modified nucleotides, such as methylated or capped nucleotides or nucleotide analogs, and sequences that are predictably inversely complementary to the polynucleotide sequence.

[0015] In a second aspect, the present invention provides an expression cassette, characterized in that the expression cassette comprises a polynucleotide mutant with promoter activity as described in the first aspect of the present invention.

[0016] Furthermore, the expression cassette also includes a target gene, which is operatively linked to the promoter-active polynucleotide mutant. The operative linking described in this invention refers to any method of linking gene fragments known to those skilled in the art.

[0017] The target gene is selected from fluorescent protein genes or other target genes that have a driving transcriptional adaptation to the polynucleotide mutant.

[0018] In a preferred embodiment of the present invention, the target gene is a fluorescent protein gene, which includes, but is not limited to, gfp, mCherry, or rfp.

[0019] In some specific embodiments of the present invention, the fluorescent protein gene is selected from gfp.

[0020] In a third aspect, the present invention provides a recombinant vector, characterized in that the recombinant vector comprises a polynucleotide mutant with promoter activity as described in the first aspect of the present invention, or an expression cassette as described in the second aspect of the present invention.

[0021] The vector is selected from any one of plasmids, lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, and transposons.

[0022] In some embodiments of the present invention, the vector is selected from plasmids.

[0023] In a specific embodiment of the present invention, the vector is a pUC19 plasmid.

[0024] In a fourth aspect of the invention, the invention provides a recombinant host cell, characterized in that the recombinant host cell comprises the recombinant vector described in the third aspect of the invention, or the recombinant host cell chromosome integrates a promoter-active polynucleotide mutant described in the first aspect of the invention or an expression cassette described in the second aspect of the invention.

[0025] Preferably, the recombinant host cell includes, but is not limited to, Escherichia coli or Gram-negative bacteria, Gram-positive bacteria, yeast cells, or mammalian cells other than Escherichia coli.

[0026] In a fifth aspect, the present invention provides any one of the following uses in the preparation of a fluorescent reporter system:

[0027] i) The multinucleotide mutant with promoter activity as described in the first aspect of the present invention;

[0028] ii) The expression box described in the second aspect of the present invention.

[0029] The fluorescence reporter system described in this invention provides a visualization tool for monitoring plasmid-mediated gene transfer and tracking plasmids in the in vivo gut.

[0030] In a sixth aspect, the present invention provides use in the production of a target protein in any of the following ways:

[0031] i) The multinucleotide mutant with promoter activity as described in the first aspect of the present invention;

[0032] ii) The expression box as described in the second aspect of the present invention;

[0033] iii) The recombinant vector described in the third aspect of the present invention;

[0034] iiii) The recombinant host cell described in the fourth aspect of the present invention.

[0035] The target protein is selected from fluorescent proteins or proteins that can be transcribed and expressed by polynucleotide mutants.

[0036] In some embodiments of the present invention, the target protein is a fluorescent protein, including but not limited to GFP, mCherry, or RFP.

[0037] In a seventh aspect, the present invention provides a method for enhancing the expression of a target gene, characterized in that the method comprises operatively linking a promoter-active polynucleotide mutant as described in the first aspect of the present invention to the target gene.

[0038] The target gene is selected from fluorescent protein genes or other target genes that have a driving transcriptional adaptation to the polynucleotide mutant.

[0039] In a preferred embodiment of the present invention, the target gene is a fluorescent protein gene, which includes, but is not limited to, gfp, mCherry, or rfp.

[0040] In some specific embodiments of the present invention, the fluorescent protein gene is selected from gfp.

[0041] The term "operable linking" refers to any method of linking gene fragments that is known to those skilled in the art.

[0042] In an eighth aspect of the present invention, the present invention provides a method for preparing a fluorescent reporter system, characterized in that the method comprises operably linking a promoter-active polynucleotide mutant as described in the first aspect of the present invention with a fluorescent protein gene to construct a fluorescent reporter system.

[0043] The fluorescent protein genes include, but are not limited to, gfp, mCherry, or rfp.

[0044] In some specific embodiments of the present invention, the fluorescent protein gene is selected from gfp.

[0045] In a ninth aspect of the invention, the invention provides a method for producing a target protein, characterized in that the method comprises culturing the recombinant host cell described in the fourth aspect of the invention, inducing expression, and obtaining the target protein.

[0046] Preferably, the method further includes separating and purifying the target protein using conventional methods.

[0047] The target protein is selected from fluorescent proteins or proteins that can be transcribed and expressed by polynucleotide mutants.

[0048] In some embodiments of the present invention, the target protein is a fluorescent protein, including but not limited to GFP, mCherry, or RFP.

[0049] Given the limitations of existing promoters in terms of regulatory range, leakage expression, and expression intensity, the technical solution of this invention has the following technical advantages:

[0050] 1) The constitutive promoter mutant constructed in this invention enhances gene expression levels, sensitivity, and a wider dynamic range.

[0051] This patent systematically optimizes the PLtetO-1 promoter. Through synergistic innovation of gene mutation technology and the pUC19 plasmid vector system, a novel recombinant plasmid expression vector with significantly improved performance was successfully constructed. Based on a high-throughput screening strategy, combined with single-colony screening and sequencing verification techniques, a promoter library was successfully constructed. Candidate elements were verified using fluorescence intensity monitoring technology, and novel promoter variants with significantly improved and stable transcription efficiency were screened. A fluorescence reporter system constructed based on this was quantitatively analyzed and confirmed to have approximately 9-fold increased transcriptional activity compared to the original PLtetO-1 promoter. This achievement not only retains the performance advantages of the PLtetO-1 constitutive promoter in constitutive expression in tetR-free hosts, but also provides an efficient and reliable analytical tool for gene expression regulation research, demonstrating significant application value in synthetic biology and metabolic engineering.

[0052] 2) The novel constitutive promoter constructed in this invention can not only be applied to fluorescence reporter systems to provide a visualization tool for monitoring plasmid-mediated gene transfer and tracking plasmids in the in vivo gut, but also be used as a protein expression tool to provide a more efficient and stable basis for industrial-grade protein production.

[0053] 2.1) Fluorescence Reporting System

[0054] The highly efficient PLtetO-1 promoter mutant obtained by screening in this invention can be combined with fluorescent reporter genes (such as GFP and RFP) to construct a fluorescent reporter system for real-time tracking of plasmid transfer in vivo. This system can achieve highly sensitive monitoring of plasmid transfer events without relying on external inducers. The constructed fluorescent reporter system can not only be used to observe the horizontal transfer of plasmids in microbial communities, but also for real-time tracking of plasmid transfer in vivo, which is of great significance for providing a more efficient and stable foundation for in vivo imaging technology.

[0055] 2.2) Industrial protein production

[0056] This invention systematically modifies the PLtetO-1 promoter to develop an optimized variant with breakthrough transcriptional activity. Quantitative analysis confirms that the transcription efficiency driven by this variant is approximately 9 times higher than that of the PLtetO-1 promoter, increasing protein yield without relying on T7 RNA polymerase (eliminating the need for DE3 lysing agents) and inducers, significantly simplifying the expression system construction process. Attached Figure Description

[0057] Figure 1 Growth curves of recombinant bacteria expressing GFP with different promoters.

[0058] Figure 2 Relative fluorescence intensity of recombinant bacteria expressing GFP with different promoters.

[0059] Figure 3 Unit copy number fluorescence of recombinant bacteria expressing GFP with different promoters.

[0060] Figure 4 Fluorescence intensity of the control group and M-25 in a bright field environment. Detailed Implementation

[0061] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0062] Research Methods: Construction and Identification of Fluorescent Reporter Systems

[0063] 1. Construction of PLtetO-1-gfp plasmid

[0064] Using the in vitro synthesized PLtetO-1+gfp sequence (SEQ ID NO.3) as a template, the promoter PLtetO-1 and gfp (encoding gene of green fluorescent protein) were amplified by PCR using Q5 Hot Start High-Fidelity DNA Polymerase. The products were identified by agarose gel electrophoresis and then purified using the GeneJET PCR purification kit.

[0065] Table 1. Primers for PLtetO-1-gfp amplification

[0066]

[0067] pUC19 was extracted using a plasmid miniprep kit and digested with restriction endonucleases Q.CutBamH1 and Q.CutXba1, respectively. After purification and recovery, it was used... The Uni Seamless Cloning and Assembly Kit uses a seamless cloning method to simultaneously ligate the linearized vector pUC19, the promoter PLtetO-1, and gfp to construct the green fluorescent plasmid PLtetO-1-gfp. This plasmid is then transferred to competent DH5α cells and plated overnight on LB agar plates containing an appropriate amount of ampicillin. Single colonies isolated from the ampicillin plates are then isolated, screened, and amplified by shaking, followed by sequencing and subsequent fluorescence validation.

[0068] 2. Construction of the inducible promoter Plac-gfp plasmid

[0069] Using the in vitro synthesized PLtetO-1+gfp sequence (SEQ ID NO.3) as a template, the gfp was amplified by PCR using Q5 Hot Start High-Fidelity DNA Polymerase. After identification by agarose gel electrophoresis, the product was purified using the GeneJET PCR purification kit.

[0070] Table 2 GFP amplification primers

[0071]

[0072] pUC19 was extracted using a plasmid miniprep kit and digested with restriction endonucleases Q.Cut HindⅢ and Q.CutXba1, respectively. After purification and recovery, it was used... The Uni Seamless Cloning and Assembly Kit was used to ligate the product gfp to form the recombinant plasmid Plac-gfp. This plasmid was then transferred to competent DH5α cells and plated on LB agar plates containing an appropriate amount of ampicillin for overnight culture. Single colonies were then isolated from the ampicillin plates, screened, and amplified by shaking. These colonies were then sent to the company for sequencing and subsequent fluorescence verification. The resulting recombinant strain was named PLAC.

[0073] 3. Construction of the inducible promoter Para-gfp plasmid

[0074] Using the in vitro synthesized PLtetO-1+gfp sequence (SEQ ID NO.3) as a template, the gfp was amplified by PCR using Q5 Hot Start High-Fidelity DNA Polymerase. After identification by agarose gel electrophoresis, the product was purified using the GeneJET PCR purification kit.

[0075] Table 3. Primers for GFP amplification

[0076]

[0077] pBad-HisA was extracted using a plasmid miniprep kit and digested with restriction endonucleases Q.Cut HindⅢ and Q.Cut Xho1, respectively. After purification and recovery, it was used... The Uni Seamless Cloning and Assembly Kit was used to ligate the product gfp to form the recombinant plasmid Para-gfp. This plasmid was then transferred into competent DH5α cells and plated on LB agar plates containing an appropriate amount of gentamicin for overnight culture. Single colonies isolated from the gentamicin plates were then isolated, screened, and amplified by shaking, followed by sequencing and subsequent fluorescence verification. The resulting recombinant strain was named PARA.

[0078] 4. Construction of promoter mutation libraries

[0079] Control group: The constitutive promoter PLtetO-1-gfp plasmid constructed in step 1 was used as the control group.

[0080] Mutant group: Using PLtetO-1-gfp (control group) DNA as a template, a promoter mutation library was constructed using the Quick Mutation™ Gene Random Mutation Kit, and PCR amplification was performed using the primers shown in Table 1.

[0081] pUC19 was extracted using a plasmid miniprep kit and digested with restriction endonucleases Q.CutBamH1 and Q.CutXba1, respectively. After purification and recovery, it was used... The Uni Seamless Cloning and Assembly Kit ligates random mutation products to form recombinant plasmids, i.e., mutant plasmid libraries. These mutant plasmid libraries are transformed into competent DH5α cells, plated on LB agar plates containing appropriate ampicillin antibiotics, and cultured overnight. Single colonies are then isolated and screened from the ampicillin plates for amplification by shaking. Colonies with significantly increased fluorescence intensity compared to control colonies are selected under a fluorescence microscope and sent to the company for sequencing. Types without mutated gfp genes are selected for subsequent fluorescence verification.

[0082] 5. Sorting and Validation of High Fluorescence Intensity Mutants

[0083] 5.1) Sorting of high fluorescence intensity mutants

[0084] Experimental group: Based on the sequencing data, duplicate mutant samples were removed. The mutant plasmid library constructed in this invention was screened and a total of 27 mutant plasmids were finally selected for the fluorescence verification experiment. The recombinant strains formed by introducing them into competent DH5α cells were named M1-M27 respectively. Single colonies activated on plates were picked and inoculated into test tubes containing 4 mL of LB liquid medium and cultured overnight at 30℃ and 220 r / min. The bacterial culture was adjusted to an initial McFarland turbidity of MCF = 6 and inoculated into 96-well plates at an appropriate concentration.

[0085] Control group: (1) IPTG at concentration gradients of 0.1, 0.5, and 1 mmol / L and arabinose inducer at concentration gradients of 0.1%, 0.2%, and 0.5% were added to control strains PLAC and PARA containing Plac-gfp and Para-gfp plasmids, respectively. (2) Strains containing the PLtetO-1 promoter were used as controls, and two parallel groups were set up, namely Con-1 and Con-2.

[0086] The above-mentioned strains were cultured under the same conditions, and OD values ​​were measured at 1, 2, 3, 4, 5, 6, 7, and 8 hours. 600 And fluorescence intensity, 3 replicates per sample. OD 600 Dilute to an appropriate concentration and measure using a microplate reader. Measure fluorescence intensity using a multi-functional continuous microplate reader, measuring OD values ​​separately. 600 The fluorescence value was measured at an excitation wavelength of 560 nm and an emission wavelength of 607 nm. The fluorescence intensity was calculated as the measured fluorescence value / OD. 600 .

[0087] 5.2) Validation of high fluorescence intensity mutants (per copy number)

[0088] Extraction of bacterial genomic DNA: Single colonies activated on plates were picked and inoculated into test tubes containing 4 mL of LB liquid medium. The culture was incubated overnight at 30°C and 220 rpm. The initial turbidity of the bacterial culture was adjusted to MCF = 6, and the same concentration was inoculated into 4 mL of LB liquid medium. The strains for the experimental and control groups were as shown in Method 5.1. Bacterial genomic DNA was extracted using the TIANamp BacteriaDNA Kit. A real-time quantitative PCR system was prepared according to the CharmQ™ Universal SYBY qPCR Master Mix kit instructions. PCR amplification was performed using GFP-F / R and recA-F / R primers (the design and use of primers are well known to those skilled in the art), and the copy number of each sample was determined.

[0089] 6. Validation and application of the mutant fluorescence reporter system (fluorescence intensity in a bright field environment)

[0090] Single colonies activated on plates were picked and inoculated into ampicillin plates and incubated overnight at 37°C. The fluorescence intensity of the PLtetO-1-gfp control group and the M-25 mutant group was compared in a bright field environment.

[0091] Research Results: Identification Results of the Fluorescent Reporter System

[0092] 1. Growth curves and fluorescence intensity of recombinant bacteria containing different promoters

[0093] This invention successfully constructed fluorescent reporter systems containing different promoters according to the methods provided in Research Methods 1-4. DH5α recombinant bacteria containing different fluorescent reporter systems were inoculated into culture medium and cultured according to the method described in Research Method 5. OD values ​​were then detected using a multifunctional microplate reader. 600 The fluorescence intensity was used to characterize promoter strength, with the fluorescence intensity at 8 hours post-inoculation. The growth of the recombinant bacteria was as follows: Figure 1 As shown, the growth of mutant M-25 was not significantly different from that of the control strain containing PLtetO-1, Plac and Para promoters, indicating that promoter expression of GFP does not affect the growth of the strain.

[0094] Fluorescence intensity detection results are as follows Figure 2 As shown, the fluorescence intensity of all promoters was low in the first 4 hours, gradually increasing from 4 to 8 hours, reaching its peak at 8 hours. Compared with the constitutive promoter PLtetO-1, the fluorescence intensity and expression pattern of the IPTG-inducible control promoter Plac and the arabinose-inducible control promoter Para were the same. Compared with the constitutive promoter PLtetO-1, the M-25 promoter was the constitutive promoter with the highest expression intensity, with a relative fluorescence intensity approximately 9 times that of the constitutive promoter PLtetO-1; the expression intensities of the remaining promoters were all low.

[0095] 2. Unit copy number fluorescence of recombinant strains containing different promoters

[0096] To further evaluate the protein expression effect of the strong promoter GFP, the fluorescence values ​​of single-copy GFP in M-11, M-13, M-25, M-26, and M-27 were verified according to the detection method provided in Research Method 5.2, with the PLtetO-1 promoter (Con-1 and Con-2, respectively) as controls. The results are as follows: Figure 3 As shown, compared with the constitutive promoter PLtetO-1, the mutant promoter GFP exhibited increased copy number fluorescence, with the M-25 promoter showing approximately 10 times the copy number fluorescence value of GFP expressed by PLtetO-1. These results indicate that the M-25 promoter expresses GFP more efficiently.

[0097] 3. Validation and application of the mutant fluorescence reporter system

[0098] Following the method provided in Research Method 6, the bacterial suspension was inoculated onto ampicillin plates and incubated overnight at 37°C. The results are as follows: Figure 4 As shown, in a bright field environment, the fluorescence intensity of the mutant group M-25 was significantly higher than that of the control group.

[0099] In summary, this invention successfully developed a novel constitutive promoter for PLtetO-1 variants through gene mutation technology and a targeted modification strategy using the pUC19 plasmid vector. This promoter exhibits high expression efficiency, low leakage expression, and a wide dynamic range. A systematic optimization method combining high-throughput screening (single colony screening + sequencing verification) and fluorescence intensity monitoring was employed to obtain the core promoter element, whose relative fluorescence intensity was approximately 9-fold higher than the original PLtetO-1, achieving stable expression without the need for T7 RNA polymerase and inducer intervention.

[0100] The novel PLtetO-1 variant constitutive promoter obtained in this invention binds to GFP / RFP, enabling dynamic tracking of plasmid transfer, supporting in vivo gut microbiota imaging and research on drug resistance gene propagation mechanisms, and overcoming the limitations of traditional systems in terms of dependence on exogenous inducers and cytotoxicity.

[0101] The novel PLtetO-1 variant constitutive promoter obtained by this invention can significantly improve transcription efficiency, increase the expression level of the target protein by 9 times compared with the original promoter, and is free from T7 RNA polymerase dependence (no need for DE3 lysing of the strain) and inducer requirements (such as anhydrous tetracycline), greatly simplifying the expression system construction process while reducing experimental costs.

[0102] Compared to the inefficient expression of traditional PLtetO-1, the complex dependency of the T7 system, and the high background noise of conventional constitutive promoters, the research results of this invention achieve a dual breakthrough in expression intensity and applicability while retaining the advantages of the PLtetO-1 promoter. It provides a highly sensitive visualization tool for gene function research and constructs an efficient, stable, and low-cost standardized technology platform for industrial-grade protein fermentation production (such as antibodies and enzyme preparations). It has important application value in the fields of synthetic biology element design and biopharmaceutical manufacturing.

[0103] The above specific embodiments are merely illustrative of the invention and do not represent a limitation thereof. Those skilled in the art will recognize that other variations of the specific structure of this invention are possible.

Claims

1. A polynucleotide mutant with promoter activity, characterized in that, The promoter-active polynucleotide is shown in SEQ ID NO:1, and the mutant corresponds to the nucleotide sequence shown in SEQ ID NO:1 with a mutation. The nucleotide sequence of the mutant is shown in SEQ ID NO:

2.

2. An expression box, characterized in that, The expression cassette comprises the polynucleotide mutant with promoter activity as described in claim 1.

3. The expression box according to claim 2, characterized in that, The expression cassette further includes a target gene, which is operatively linked to the promoter-active polynucleotide mutant; the target gene is selected from fluorescent protein genes or other target genes that are adapted to drive transcription with the polynucleotide mutant.

4. A recombinant vector, characterized in that, The recombinant vector comprises the promoter-active polynucleotide mutant of claim 1, or the expression cassette of any one of claims 2-3.

5. Recombinant host cells, characterized in that, The recombinant host cell comprises the recombinant vector of claim 3, or the recombinant host cell chromosome integrates the promoter-active polynucleotide mutant of claim 1 or the expression cassette of any one of claims 2-3.

6. Any one of the following uses in the preparation of a fluorescent reporter system: i) The promoter-active polynucleotide mutant as described in claim 1; ii) The expression box according to any one of claims 2-3.

7. Any of the following uses in the production of the target protein: i) The promoter-active polynucleotide mutant as described in claim 1; ii) The expression box according to any one of claims 2-3; iii) The recombinant vector according to claim 4; iiii) The recombinant host cell according to claim 5; The target protein is selected from fluorescent proteins or proteins that can be transcribed and expressed by polynucleotide mutants.

8. A method for enhancing the expression of a target gene, characterized in that, The method includes operatively linking the promoter-active polynucleotide mutant of claim 1 to the target gene.

9. A method for preparing a fluorescence reporter system, characterized in that, The method involves operatively linking the promoter-active polynucleotide mutant of claim 1 to a fluorescent protein gene to construct a fluorescent reporter system.

10. A method for producing a target protein, characterized in that, The method includes culturing the recombinant host cell as described in claim 5, inducing expression, and obtaining the target protein.

Images