Application of soybean GmTHIC gene in improving thiamin content and enhancing salt tolerance
By overexpressing the GmTHIC gene in soybeans, the problems of insufficient thiamine and poor salt tolerance in soybeans under salt stress were solved, thereby increasing the thiamine content and salt tolerance of soybeans and improving soybean yield and quality.
Patent Information
- Application Number
- CN202511462669.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-13
- Publication Date
- 2025-12-30
- Estimated Expiration
- 2045-10-13
AI Technical Summary
Soybeans face challenges from abiotic stresses such as extreme temperatures, nutrient deficiencies, drought, and salt stress during their growth, which affect yield and quality. Furthermore, their thiamine content is insufficient, and existing technologies have failed to effectively improve their salt tolerance and thiamine content.
By overexpressing the soybean GmTHIC gene into soybean plants, the amino acid sequence encoded by the GmTHIC gene (as shown in SEQ ID NO: 2) is used to enhance the synthesis and accumulation of thiamine and improve the tolerance of soybeans to salt stress. Recombinant vectors such as pCAMBIA3301 and Agrobacterium EHA105 are used for genetic engineering improvement.
It significantly increased the thiamine content in soybean leaves and grains, enhanced soybean tolerance to salt stress, improved soybean yield and quality, and provided a molecular breeding strategy for stress resistance breeding and nutritional fortification.
Smart Images

Figure CN120924591B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering, specifically relating to soybeans. GmTHIC The application of genes in improving soybean quality and stress resistance, especially in soybeans GmTHIC Application of genes in increasing thiamine levels and enhancing salt tolerance. Background Technology
[0002] Soybeans Glycine max As a crucial oilseed and protein crop globally, soybeans face continuous challenges from abiotic stresses such as extreme temperatures, nutrient deficiencies, drought, and salt stress during their growth. These environmental pressures severely impact soybean yield and quality, thus threatening global food security. Soil salinization is a major problem facing arable land worldwide, and breeding salt-tolerant varieties is currently the most economical and safest method. Therefore, identifying salt-tolerant genes and elucidating their molecular mechanisms has become an important research direction in soybean breeding.
[0003] Thiamine (vitamin B1) is a water-soluble vitamin that plays a crucial role in plant growth and development, and in responses to abiotic and biotic stresses. Thiamine deficiency leads to decreased metabolic rate, respiration, and photosynthesis in plants, while increasing the accumulation of sucrose and amino acid residues. Thiamine biosynthesis is enhanced during responses to salinity, flooding, low temperature, high temperature, drought, and oxidative stress. Furthermore, thiamine coordinates carbon metabolism and nitrogen assimilation in plants, playing a vital role in balancing plant energy production, metabolism, and yield. Thiamine pyrophosphate (TPP) acts as a coenzyme in cellular metabolic pathways such as the citric acid cycle, glycolysis, and pentose phosphate cycle. The biosynthetic pathway of thiamine is controlled by many biosynthetic enzymes, among which THIC and THI1 catalyze key initial reactions specific to the biosynthesis of pyrimidines and thiazoles, respectively. THIC is located in chloroplasts, and a decrease in its expression abundance significantly affects the thiamine content in plants; Arabidopsis thiC mutant seedlings exhibit pale leaves and die during the seedling stage.
[0004] These studies indicate that THIC plays an important role in regulating plant quality and stress tolerance, but its specific functions in soybeans still require further investigation. Summary of the Invention
[0005] Based on existing technology, this invention is the first to discover that... GmTHIC Genes are transferred into the soybean variety to be improved through transgenic technology, causing overexpression in the soybean plants. GmTHIC Genes can increase the thiamine content in soybean leaves and seeds, while also improving soybean's tolerance to salt stress. This can be achieved through analysis... GmTHICThe function of this study in soybeans, and the creation of high-thiamine and salt-tolerant soybean germplasm, are of great significance for soybean stress resistance breeding and nutritional fortification. They can provide new molecular breeding strategies for improving soybean stress resistance, yield and quality.
[0006] In this regard, the technical solutions of the present invention include, but are not limited to, the following:
[0007] In one aspect, the present invention provides soybeans GmTHIC The application of the gene in increasing thiamine content and / or enhancing salt tolerance, characterized by overexpression of the soybean GmTHIC Genes, in which soybeans GmTHIC The gene encodes the amino acid sequence shown in SEQ ID NO: 2.
[0008] In another aspect, the present invention provides a product containing soybeans. GmTHIC The application of recombinant vectors of genes in increasing thiamine content and / or enhancing salt tolerance, characterized by overexpression of the soybean gene. GmTHIC Genes, the soybean GmTHIC The gene encodes the amino acid sequence shown in SEQ ID NO: 2. Preferably, the recombinant vector contains soybean... GmTHIC The pCAMBIA3301 vector for the gene.
[0009] In another aspect, the present invention provides the application of genetically engineered bacteria in increasing thiamine content and / or enhancing salt tolerance in soybeans, characterized in that the genetically engineered bacteria comprises soybeans... GmTHIC Recombinant vectors of the gene, overexpressing the soybean GmTHIC Genes, the soybean GmTHIC The gene encodes the amino acid sequence shown in SEQ ID NO: 2. Preferably, the genetically engineered bacterium is Agrobacterium, and more preferably, Agrobacterium EHA105.
[0010] In another aspect, the present invention provides a method for increasing thiamine content and / or enhancing salt tolerance in soybeans, characterized in that the method comprises: overexpressing soybeans GmTHIC Genes, the soybean GmTHIC The gene encodes the amino acid sequence shown in SEQ ID NO: 2.
[0011] In another aspect, the present invention provides a method for obtaining soybean plants with improved traits, characterized by comprising the following processing steps:
[0012] (1) Infecting soybean tissues with genetically engineered bacteria; and
[0013] (2) Infected soybean tissue was cultured into soybean plants;
[0014] The genetically engineered bacteria contained soybean GmTHIC Recombinant vectors of the gene, overexpressing the soybean GmTHIC Genes, the soybean GmTHIC The gene encodes the amino acid sequence shown in SEQ ID NO: 2.
[0015] In one aspect, the soybean tissue is the cotyledonary node of a soybean seed, which serves as an explant.
[0016] In one aspect, the method further includes inducing the generation of clustered buds on the explant prior to step (2).
[0017] In one aspect, the improved properties described in this invention refer to increased thiamine content and / or enhanced salt tolerance.
[0018] In one aspect, the soybeans described in this invention GmTHIC The coding sequence of the gene is shown in SEQ ID NO: 1.
[0019] In one aspect, in the recombinant vector of the present invention, the soybean GmTHIC The gene is manipulated by the 35S or Glycinin promoter.
[0020] In one aspect, the sequence of the 35S promoter of the present invention is shown in SEQ ID NO: 3.
[0021] In one aspect, the sequence of the Glycinin promoter described in this invention is shown in SEQ ID NO: 4.
[0022] In another aspect, the present invention provides the use of soybean GmTHIC protein in increasing thiamine content and / or enhancing salt tolerance, the amino acid sequence of which is shown in SEQ ID NO: 2.
[0023] Preferably, the carrier described in this invention is the pCAMBIA3301 carrier.
[0024] Preferably, the genetically engineered bacterium of the present invention is Agrobacterium. More preferably, the genetically engineered bacterium of the present invention is Agrobacterium EHA105.
[0025] Preferably, the soybean variety described in this invention is Tianlong No. 1. Tianlong No. 1 exhibits moderate resistance to soybean mosaic virus and is expected to be applied in large-scale fields in the future.
[0026] The gene described in this invention GmTHIC The application in the breeding of high-thiamine and salt-tolerant soybean germplasm refers to... GmTHICGenes can be transferred into soybean varieties that are to be improved through transgenic technology. This can increase the thiamine content in the leaves and seeds of soybean varieties, and at the same time improve the soybeans' tolerance to salt stress.
[0027] In one aspect, the improvement of thiamine content as described in this invention refers to increasing the thiamine content in soybean leaves.
[0028] In one aspect, the improvement of thiamine content as described in this invention refers to increasing the thiamine content in soybean seeds.
[0029] In one aspect, the improvement of thiamine content as described in this invention refers to increasing the thiamine content in soybean leaves and seeds.
[0030] The advantages and value of this invention lie at least in the fact that salt tolerance and nutritional fortification breeding of soybeans are among the important goals of soybean variety selection today. The invention identifies... GmTHIC The gene can increase the accumulation of thiamine in soybean plants and enhance their salt tolerance. It can be introduced into soybean varieties with superior agronomic traits through transgenic methods to deeply improve the recipient varieties, enhance the tolerance of soybean varieties to salt stress and the nutritional grade of soybeans, expand the planting area and utilization rate of soybeans, thereby ensuring the yield and quality of soybeans and increasing the supply rate of domestic soybeans. Attached Figure Description
[0031] Figure 1 show GmTHIC Agarose gel electrophoresis was performed on the PCR amplification products. The DNA marker was Trans2K® Plus II from Beijing TransGen Biotech Co., Ltd. GmTHIC This is the result of cDNA amplification.
[0032] Figure 2 For soybeans GmTHIC Subcellular localization results diagram.
[0033] Figure 3 For soybeans GmTHIC A schematic diagram of the construction of the overexpression vector driven by the 35S promoter.
[0034] Figure 4 For soybeans GmTHIC A schematic diagram of the construction of an overexpression vector driven by the seed-specific Glycinin promoter.
[0035] Figure 5 Showing GmTHIC In wild type (TL1) and GmTHIC Overexpression lines (35S:GmTHIC and P) Glycinin The expression level of the gene in the offspring of :GmTHIC).
[0036] Figure 6 For wild type (TL1) and GmTHIC Overexpression lines (including 35S:GmTHIC and P) Glycinin :GmTHIC) Identification of total thiamine in leaves and grains.
[0037] Figure 7 Wild type (TL1) and GmTHIC Expression levels of other related genes in the thiamine synthesis pathway during the seedling stage of overexpression lines (35S:GmTHIC#3, 35S:GmTHIC#9, 35S:GmTHIC#13).
[0038] Figure 8 show GmTHIC Phenotypic and aboveground fresh weight of overexpression lines (35S:GmTHIC#3, 35S:GmTHIC#9, 35S:GmTHIC#13) after salt stress.
[0039] Figure 9 show GmTHIC The reactive oxygen species (ROS) content of the overexpression lines (35S:GmTHIC#3, 35S:GmTHIC#9, 35S:GmTHIC#13) was determined by DAB staining after salt stress.
[0040] Figure 10 show GmTHIC Results of POD and CAT antioxidant enzyme activities in overexpression lines (35S:GmTHIC#3, 35S:GmTHIC#9, 35S:GmTHIC#13) after salt stress.
[0041] Figure 11 show GmTHIC Results of chlorophyll content determination in overexpression lines (35S:GmTHIC#3, 35S:GmTHIC#9, 35S:GmTHIC#13) after salt stress.
[0042] Figure 12 show GmTHIC Results of photosynthetic-related parameters measured in overexpression lines (35S:GmTHIC#3, 35S:GmTHIC#9, 35S:GmTHIC#13) after salt stress. Detailed Implementation
[0043] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent manufacturers.
[0044] Example 1 GmTHIC Gene fragment acquisition
[0045] 1) RNA extraction:
[0046] Take 0.1g of leaves from the soybean variety Williams 82 and place them in a centrifuge tube. Add liquid nitrogen and grind rapidly. Then add 1ml of TRIPURE Reagent (Boretz Company), mix well, and let stand for 5min. Add 0.2mL of chloroform, vortex and mix for 15sec, and let stand for 2min. Centrifuge at 12000 rpm for 10min, and take 600μL of the supernatant and add it to 600μL of isopropanol and mix well. Centrifuge for 10min, discard the supernatant, add 1mL of 75% ethanol and vortex for 1min. Centrifuge for 5min, discard the supernatant, and place in a fume hood to dry. Add 50μL of ddH2O for later use.
[0047] 2) Synthesis of first-strand cDNA:
[0048] First-strand cDNA synthesis was performed using a HiScript II Q RT SuperMix for qPCR (+gDNA wiper) (Novizan). 2 μL of the above RNA, 1 μL of Oligo dT Primer, and RNase-free ddH2O were added to a 12 μL PCR tube. After mixing thoroughly, the mixture was incubated at 65°C for 5 min, followed by rapid cooling on ice. 4 μL of 4×gDNA wiper Mix was added, and the mixture was incubated at 42°C for 2 min. 2 μL of 10×RT Mix and 2 μL of HiScript II Enzyme Mix were then added to the above mixture and mixed thoroughly by pipetting. The PCR reaction was performed using the following program: 25°C, 5 min; 50°C, 45 min; 85°C, 2 min.
[0049] 3) PCR amplification and gene cloning
[0050] Based on the soybean genome database (http: / / phytozome.jgi.doe.gov / pz / portal.html), specific primers were designed using Primer 5.0 software: upstream primer F1: 5'- CTGTAGATTCGGGCCAAGA-3', downstream primer R1: 5'- ATACAAGTTGACATAAGACGGAGTT-3'. PCR amplification was performed using the above cDNA as a template. The amplification enzyme used was Borrez 2×Super-Fidelity Premix. The PCR amplification reaction system (50 μL) consisted of: 25 μL 2×Super-Fidelity Premix, 1.5 μL Primer 1 (10 μM), 1.5 μL Primer 2 (10 μM), 2 μL of the amplification product from Example 1, and 20 μL ddH2O. The procedure was as follows: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 56℃ annealing for 20 s, 72℃ extension for 30 s, repeated 32 times; 72℃ extension for 5 min; storage at 25℃. All usage instructions were followed precisely. GmTublin was used as a control and as a quality control indicator for cDNA. PCR amplification products were electrophoresed on a 1% agarose gel at 160V for 15 min, then stained with EB dye and observed and photographed under UV light. The results are shown below. Figure 1 .
[0051] Example 2 Subcellular localization of GmTHIC-GFP
[0052] Using F2: 5'-TTTACGAACGATAGGGTACCATGATTCGGGCCAAGATGG-3' and R2: 5'-TCTTTGTAGTCCATGGATCCAGTCCTCTTGGAACTAACGTA-3' as primers, and the PCR product from Example 1 as a template, amplification was performed to obtain the target gene containing homologous arms. GmTHIC The coding sequence (CDS) fragment was obtained (with the stop codon removed). The vector pBinGFP4 (obtained from BioVector NTCC) was digested with restriction endonucleases BamHI and KpnI. The digestion reaction system (50 μL) was: 43 μg of vector plasmid, 1 μL of each restriction enzyme, and 5 μL of 10xNEB Buffer. After mixing, the mixture was digested at 37 °C for 3 h.
[0053] After purifying the amplification product and the pBinGFP4 vector digestion product, the two were recombined using a homologous recombinase. The reaction system (10 μL) was as follows: 5 μL of 2x MultiF Seamless Assembly Mix homologous recombinase, 2 μL of linearized vector, 1 μL of PCR amplification product fragment, and ddH2O added to a final volume of 10 μL. The mixture was incubated in a metal bath at 50 °C for 30 min and then placed on ice.
[0054] The recombinant product was transformed into Escherichia coli DH5α competent cells and cultured overnight at 37°C. Colony PCR was performed using primers F3: 5'-CAAGCAATCAAGCATTCTAC-3' and R3: 5'-CGGACACGCTGAACTTGTGG-3'. Positive single clones were selected for sequencing.
[0055] The sequencing sequence was entered into the biological software BIOXM to locate its largest open reading frame, and the PCR reaction was performed. GmTHIC The gene fragment has the nucleotide sequence shown in SEQ ID NO: 1. Each 3 bases were translated into one amino acid, encoding a total of 652 amino acid residues, and the resulting amino acid sequence is shown in SEQ ID NO: 2. This indicates that the pBinGFP4-GmTHIC:GFP expression vector has been successfully constructed. Plasmid extraction was performed on correctly sequenced single clones using a shaking inoculation method. The plasmid was then transformed into Agrobacterium strain EHA10 via heat shock. After culturing at 28°C for 2 days, single clones were picked and added to LB liquid medium containing kanamycin and rifampin antibiotics, and cultured until OD. 600 =0.8, centrifuged, and resuspended in resuspending buffer (10mM MaCl2, 10mM MES, 100µM AS, pH=5.6), then injected into tobacco epidermal cells. Green fluorescence signal was captured using a laser confocal microscope (LSM 900) 48 hours later. Results are as follows: Figure 2 The green fluorescent signal of pBinGFP4-GmTHIC:GFP mainly appears in chloroplasts and cytoplasm.
[0056] Example 3 Construction of recombinant plasmid (35S:GmTHIC and P) Glycinin :GmTHIC)
[0057] Using primers F4: 5'-GAACACGGGGGACTCTTGACCATGATTCGGGCCAAGATGGC-3' and R4: 5'-GCTGGTCACCTGTAATTCACACGTGAGTCCTCTTGGAACTAACGTA-3' as a template, PCR amplification was performed to obtain the target gene (fragment 1) containing homologous arms. Furthermore, using primers F5: 5'-AGCTATGACCATGATTACGAATTCTTAATCAAAATAACCACAAAC-3' and R5: 5'-GTGATGCCATCTTGGCCCGAATCATGGTGATGACTGATGAGTGTTTA-3', the promoter P of the seed-specific Glycinin gene (Glyma.03G163533) was obtained from the soybean genome. Glycinin Sequence (fragment 2, SEQ ID NO: 4).
[0058] One digestion product was obtained by digesting the vector pCAMBIA3301-GUS (purchased from UBO Biotechnology) with restriction endonucleases NcoI and PmlI. A second digestion product was obtained by digesting the vector pCAMBIA3301 with EcoRI and PmlI. The digestion reaction system (50 μL) consisted of 43 μg of vector plasmid, 1 μL of each restriction enzyme, and 5 μL of 10xNEB Buffer. After mixing, the mixture was digested at 37 °C for 3 h.
[0059] After purifying the amplified products of fragment 1 and fragment 2, as well as the enzyme digestion product of the pCAMBIA3301 vector, fragment 1 and pCAMBIA3301 (NcoI and PmlI) fragments were recombined using multi-fragment homologous recombinase, and fragment 1, fragment 2, and pCAMBIA3301 (EcoRI and PmlI) fragments were recombined. The reaction system (10 μL) was as follows: 5 μL of 2x MultiF Seamless AssemblyMix homologous recombinase, 2 μL of linearized vector, 1 μL of PCR fragment, and ddH2O added to a final volume of 10 μL. The reaction was carried out in a metal bath at 50 °C for 30 min, and then placed on ice.
[0060] The recombinant product was transformed into Escherichia coli DH5α competent cells and cultured overnight at 37°C. Colony PCR was performed using primers F6: 5'-ATGCAGCTGGCACGACAGG-3' and R6: 5'-ATAATCATCGCAAGACCGGC-3', and positive single clones were selected for sequencing.
[0061] The obtained recombinant vectors were named pCAMBIA3301-35S:GmTHIC ( Figure 3 pCAMBIA3301-P Glycinin :GmTHIC( Figure 4 ).
[0062] Example 4: Soybean Gene GmTHIC Obtaining and identifying transgenic plants with overexpression
[0063] This embodiment uses Agrobacterium EHA105-mediated genetic transformation to transform the two soybean varieties constructed in Example 1. GmTHIC Gene overexpression vectors were transformed into Agrobacterium EHA105 strain using a freeze-thaw method. Then, soybean variety Tianlong 1 (TL1) was transformed by Agrobacterium infection of soybean cotyledonary nodes. Bar test strips were used to identify clustered shoots emerging from the explants, with newly grown leaves approximately 0.5-1 cm in length being selected. 2 Place the sample into a 1.5 mL centrifuge tube, grind the leaves with a grinder, add 200 μL of extraction solution and stir well. Insert the rapid test strip into the mixture in the marked direction and observe the results after 5 minutes. A positive result is indicated by the simultaneous appearance of both the test band and the control band; a negative result is indicated by the appearance of only the control band. Transplant the successfully transformed induced buds (T0) into nutrient soil. Harvest the seeds after they mature. Sow the harvested seeds (T1 generation) in pots. Identify the seeds after the first compound leaf has fully unfolded, ensuring they meet the following criteria:
[0064] 1) Herbicide resistance identification
[0065] Simultaneously, TL1 wild-type plants and the aforementioned transgenic plants were sprayed or coated with glufosinate (10% stock solution diluted 200 times, with 0.1% (v / v) Tween added). After 3-5 days, the transgenic plants maintained a normal state, while the leaves of TL1 and the isolated non-transgenic plants began to turn yellow and wilt. Using this method to identify up to the T2 generation, transgenic lines that all exhibit glufosinate resistance are considered homozygous lines.
[0066] 2) PCR molecular identification
[0067] Leaves were collected from plants that survived herbicide application, and genomic DNA was extracted for PCR amplification. The PCR primers were F7: 5'-CTGCTGATTTAGCCAAAGGTC-3' and R6 5'-ATAATCATCGCAAGACCGGC-3'. The PCR products were detected by 1% agarose gel electrophoresis. The target band was detected in positive plants, with a band size of approximately 500 bp, while it was not detected in negative plants.
[0068] 3) GmTHIC Detection of gene expression levels
[0069] The identified and screened in step 2) GmTHICLeaves were taken from transgenic seedlings, thoroughly ground after being frozen in liquid nitrogen, and RNA was extracted using the Trizol method. 2 µg of RNA was used to obtain cDNA using a reverse transcription kit, which was then used as a template for qRT-PCR detection. GmTubulin As an internal reference gene, it was detected using the 2×Universal SYBR Green qPCR Mix (No ROX Premixed) (QP0605, BOLAZ) kit in a Bio-Rad CFX96 real-time PCR instrument. GmTHIC Gene expression levels. Used GmTubulin Primers for gene quantification (F8: 5'-GGAGTTCACAGAGGCAGAG-3' and R8: 5'-CACTTACGCATCACATAGCA-3') and GmTHIC Primers for gene quantification (F7: 5'-CTGCTGATTTAGCCAAAGGTC-3' and R9: 5'-CTTCCTCACATCCTCCGTTAT-3').
[0070] The relative expression level was calculated using the 2-ΔΔCt method, and the results are as follows: Figure 5 As shown, in the TL1 blade GmTHIC relatively GmTubulin The expression level was 1, and three families of 35S:GmTHIC were found. Figure 5 A) and P Glycinin :GmTHIC has two lineages ( Figure 5 B) GmTHIC The relative expression level of the gene was high, so families with high expression levels were selected for subsequent experiments.
[0071] Example 5: Soybean Gene GmTHIC The thiamine content in overexpressing transgenic plants was measured.
[0072] For testing GmTHIC Changes in thiamine content in plants after overexpression, comparing TL1 (control) and... GmTHIC Homozygous overexpressing lines were grown in a glass greenhouse. Samples were taken from the second leaf from the top before flowering and stored at -80 ℃. After flowering, the samples were marked, and seeds at the R6 stage were collected. Approximately 0.1 g of each sample was used for determination. Thiamine content was determined using a thiamine assay kit (ml077010, mlbio) manufactured by Shanghai Enzyme-Linked Biotechnology Co., Ltd., according to the instructions. Each line was subjected to three biological replicates.
[0073] The results showed that, compared with TL1, the thiamine content in leaves and grains was significantly increased in the three 35S promoter-driven overexpression lines (#3, #9, and #13). Figure 6(A and B), approximately 1.2-2 times higher. Furthermore, the seed-specific promoter P... Glycinin Significant increases were also observed in the seeds of both overexpression lines driven by the gene, with one family showing a 4-fold increase in thiamine content in its seeds. Figure 6 C). Furthermore, qRT-PCR revealed other related genes in the thiamine synthesis pathway ( GmTHI1 , GmTH1 , GmTH2 , GmTPK1 and GmTPK2 The expression level of ) in GmTHIC The expression was also significantly increased in overexpressing plants. Figure 7 The primer sequences are as follows: GmTHI1 (F10:5'-CCTCCAGTCCTTCAAATTCCAGC-3' and R10: 5'-ACGTCGGTGTCGGCGTAGGTTAT-3'); GmTH1 (F11: 5'-TTTATCCCACTAATACAAAGGCAAAC-3' and R11: 5'-GCCAAATAGAGCAGAAACGACAG-3'); GmTH2 (F12: 5'-CCTCTGATGGTTTCCAGGCTACT-3' and R12: 5'-AGATGGCGGACGAATCAACTACG-3'); GmTPK1 (F13: 5'-GATGGAGGTGCCAATAGGGTGTA-3' and R13: 5'-GGGTGAGGTCACGTATGTATGCC-3'); GmTPK2 (F14: 5'-GAACGTGAACCAGCGTCACAAAG-3' and R14: 5'-GGTCCCAGAGCAGAGGAGCAAAT-3').
[0074] Explanation of soybeans GmTHIC Gene overexpression lines can significantly increase the thiamine content in soybean plants and grains, thereby improving the quality and nutritional value of soybeans.
[0075] Example 6: Salt tolerance identification of soybean GmTHIC overexpression transgenic plants
[0076] For further research GmTHIC Regarding the function of soybean salt tolerance, TL1 (wild type) and GmTHICHomozygous overexpression lines (#3, #9, and #13) were planted in an artificial climate chamber with a 2:1 mixture of potting soil and vermiculite. Two seedlings were planted in each pot, alternating between wild-type and transgenic materials. Salt treatment was initiated when the first compound leaf had fully unfolded. Each pot was watered with 250 mL of 200 mM NaCl every 3 days, while the control group was watered normally. Each treatment was replicated in triplicate. Plant condition was observed and photographed after 14 days. It was found that TL1 (wild-type) plants exhibited weaker growth after salt treatment, and the lower leaves withered and fell off. GmTHIC The homozygous overexpression lines still showed good growth. Figure 8 A). Furthermore, measurements of the fresh weight of the aboveground parts of both species revealed that the aboveground fresh weight of TL1 (wild type) after salt treatment was significantly lower than that of wild type. GmTHIC Homozygous overexpression lines ( Figure 8 B).
[0077] In addition, physiological indicators of salt tolerance were measured, including chlorophyll content, photosynthetic index, reactive oxygen species (ROS) content, and antioxidant enzyme activity in leaves taken from fixed locations. ROS content was visualized using the DAB staining method, specifically as follows: A DAB working solution (1 mg / mL, pH 3.8, with the addition of 0.1% (v / v) Tween) was prepared. The leaves were completely immersed and then vacuumed for 10-30 minutes. The mixture was then incubated in a shaker at 25°C in the dark for 8-12 hours. Finally, the leaves were destained with a decolorizing solution (ethanol:acetic acid:glycerol = 3:1:1), and then photographed. The more reddish-brown substances present and the darker the color, the higher the ROS content. GmTHIC In homozygous overexpression lines, leaves of TL1 (wild-type) treated with salt showed a deeper reddish-brown complex in DAB staining, indicating that... GmTHIC The homozygous overexpression lines accumulated only low levels of reactive oxygen species after salt treatment. Figure 9 ).
[0078] Antioxidant enzyme activity assay: The activities of catalase (CAT) and peroxidase (POD) were measured using kits purchased from Solebao (BC0205, BC0095, Beijing Solebao Technology Co., LTD). Approximately 0.1 g of sample was added to 1 mL of extraction buffer and reacted according to the instructions. After the reaction, absorbance was measured at 240 nm and 470 nm using a microplate reader. Each reaction was performed in triplicate. The results showed that, compared to TL1 (wild type), [the activity was significantly higher]. GmTHIC Homozygous overexpression lines showed higher CAT and POD enzyme activities after salt treatment, and were associated with... Figure 9 The results are consistent ( Figure 10 ).
[0079] The method for determining chlorophyll content is as follows: 0.2 g of leaf material was cut into thin strips approximately 1 mm in diameter and immersed in 25 mL of 95% ethanol solution. After incubation overnight in the dark, the values were read using a microplate reader at absorbances of 665 and 649 nm, where Chla (µg / gFW) = (13.95 × A 665 -6.88×A 649 )*V / W*1000,Chlb (µg / g FW)= (24.96×A 649 −7.32×A 665 )*V / W*1000, Chl = Chla + Chlb, where V represents the total volume of the extracted sample and W represents the fresh weight of the sample. The results show that... GmTHIC After salt treatment, the content of chlorophyll a, chlorophyll b, and total chlorophyll in homozygous overexpression lines was significantly higher than that in TL1 (wild type). Figure 11 ).
[0080] Photosynthetic parameters were measured: Plant growth and photosynthetic capacity were assessed using a photosynthesis system (LI-COR 6800). Parameters included net photosynthetic rate (A, µmol m⁻² s⁻¹), transpiration rate (E, mmol m⁻² s⁻¹), and stomatal conductance (gsw, mol m⁻² s⁻¹). The artificial climate chamber was equipped with a light intensity of 415 µmol m⁻² s⁻¹, an indoor temperature of 26℃, and an atmospheric CO₂ concentration of 400 ppm. Results showed that... GmTHIC After salt treatment, the net photosynthetic rate, transpiration rate, and stomatal conductance of the homozygous overexpressing gene lines were significantly or extremely significantly higher than those of TL1 (wild type). Figure 12 ).
[0081] sequence list
[0082] SEQ ID NO: 1
[0083]
[0084] SEQ ID NO: 2
[0085] MIRAKMASLHANVTSVVCKSGNHASQSKFTSSSFLPGFDVVGRASNAWKKELVPSSISLVPRATLTFDPPTTNSDKTKQRKHTVDPASPDFLALPSFEQCFPKSTKEHREVTHEETGHVLKVPFRRVHLSGEEGHFDTYDTSGPQNVNPRTGLPQLRKEWVDRREKLGYPRFTQMYYAKQGIITEEMLYCATRENLDPEFVRSEVARGRAIIPSNKKHLELEPMIVGRNFLVKVNANIGNSAVASSIEEEVYKVQWATMWGADTAMDLSTGRHIHETREWILRNSAVPVGTVPIYQALEKVNGIAEDLNWEVFRDTLIEQAEQGVDYFTIHAGVLLRYVPLTARRMTGIVSRGGSIHAKWCLAYHKENFAYEHWDEILDICNQYDVALSIGDGLRPGSIYDANDTAQFAELLTQGELTRRAWEKDVQVMNEGPGHIPMHKIPENMQKQLEWCSEAPFYTLGPLTTDIAPGYDHITSAIGAANIGALGTALLCYVTPKEHLGLPNRDDVKAGVIAYKIAAHAADLAKGHPYAQAWDDALSKARFEFRWMDQFALSLDPMTAMSFHDETLPADGAKVAHFCSMCGPKFCSMKITEDVRKYAEEHGYGTDEALQRGMDAMSAEFQAAKKTISGEQHGEAGGEIYLPEEYVSSKRT*
[0086] SEQ ID NO: 3 35S promoter
[0087] tgagacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagctatctgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatataaggaagttcatttcatttggagagaaca
[0088] SEQ ID NO: 4 Glycinin promoter
[0089] ttaatcaaataaccacaaactttcataaaaggttcttattaagcatggcatttaataagcaaaaacaactcaatcactttcatataggaggtagcctaagtacgtactcaaaatgccaacaaataaaaaaaaagttgctttaataatgccaaaacaaattaataaaacacttacaacaccggattttttttaattaaaatgtgccatttaggataaatagttaatatttttaataattatttaaaaagccgtatctactaaaatgatttttatttggttgaaaatattaatatgtttaaatcaacacaatctatcaaaattaaactaaaaaaaaaataagtgtacgtggttaacattagtacagtaatataagaggaaaatgagaaatt aagaaattgaaagcgagtctaatttttaaattatgaacctgcatatataaaaggaaagaaaaatccaggaagaaaagaaatgaaaccatgcatggtcccctcgtcatcacgagtttctgccatttgcaatagaaacactgaaacacctttctctttgtcacttaattgagatgccgaagccacctcacaccatg aacttcatgaggtgtagcacccaaggcttccatagccatgcatactgaagaatgtctcaagctcagcaccctacttctgtgacgtgtccctcattcaccttcctctctctccctataaataaccacgcctcaggttctccgcttcacaactcaaacattctctccattggtccttaaacactcatcagtcatcacc
Claims
1. Soybean GmTHIC the use of the gene in soybean for increasing thiamin content and / or enhancing salt tolerance, characterized in that, overexpressing the soybean GmTHIC gene, wherein the soybean GmTHIC gene encodes an amino acid sequence as set forth in SEQ ID NO:
2.
2. The recombinant vector comprising a soybean GmTHIC gene for increasing thiamine content and / or enhancing salt tolerance in soybean, characterized in that, overexpressing the soybean GmTHIC gene, the soybean GmTHIC gene encodes an amino acid sequence as set forth in SEQ ID NO:
2.
3. Use according to claim 2, characterized in that, The recombinant vector is a pCAMBIA3301 vector containing a soybean GmTHIC gene.
4. The use of genetically engineered bacteria in soybeans to increase thiamin content and / or enhance salt tolerance, characterized in that, The genetically engineered bacteria comprise a recombinant vector comprising a soybean GmTHIC gene, the soybean GmTHIC gene is overexpressed, and the soybean GmTHIC gene encodes an amino acid sequence as shown in SEQ ID NO:
2.
5. Use according to claim 4, characterized in that, The genetically engineered bacteria are Agrobacterium.
6. Use according to claim 5, characterized in that, The Agrobacterium is Agrobacterium EHA105.
7. A method for increasing thiamine content and / or enhancing salt tolerance in soybean, characterized by, The method includes: overexpressing soybean GmTHIC Genes, the soybean GmTHIC The gene encodes the amino acid sequence shown in SEQ ID NO:
2.
8. A method of obtaining a soybean plant having an improved trait, comprising, The method comprises the following treatment steps: (1) using genetically engineered bacteria to infect soybean tissue; and (2) culturing the infected soybean tissue into a soybean plant; The genetically engineered bacteria comprise a recombinant vector containing a soybean GmTHIC gene, wherein the genetically engineered bacteria comprise a recombinant vector containing a soybean GmTHIC gene, wherein the soybean GmTHIC gene encodes an amino acid sequence as shown in SEQ ID NO:
2.
9. Use according to any one of claims 1 to 6 or method according to claim 7 or 8, characterized in that, The soybean GmTHIC The coding sequence of the gene is set forth in SEQ ID NO:
1.
10. Use according to any one of claims 2 to 6 or method according to claim 7 or 8, characterized in that, In the recombinant vector, the soybean GmTHIC gene is manipulated by the 35S or Glycinin promoter.
11. Use according to claim 10, characterized in that, The sequence of the 35S promoter is shown as SEQ ID NO:
3.
12. Use according to claim 10, characterized in that, The sequence of the Glycinin promoter is shown as SEQ ID NO:
4.
13. Application of a soybean GmTHIC protein in increasing thiamine content and / or enhancing salt tolerance in soybean, wherein the amino acid sequence of the soybean GmTHIC protein is shown as SEQ ID NO: 2.
Citation Information
Patent Citations
Riboswitches, methods for their use, and compositions for use with riboswitches
US20050053951A1
Genes and uses for plant enhancement
US20160244777A1