Application of GhRPD1 gene in regulation and control of fruit branch included angle of upland cotton

Abstract

The invention discloses application of a GhRPD1 gene in regulating and controlling an included angle of upland cotton fruit branches, and belongs to the technical field of biology. The key gene GhRPD1 for regulating and controlling the fruit branch included angle in upland cotton is identified through genome-wide association analysis (GWAS), and the important effect of the key gene GhRPD1 in cotton plant type regulation and control is disclosed. Experiments prove that by reducing or inhibiting the expression of the GhRPD1 gene, the fruit branch included angle of upland cotton can be obviously increased, the amplification can reach 4-5 degrees, and a clear molecular target is provided for cotton plant type improvement. The cotton plant type structure can be effectively optimized, the fruit branch included angle can be increased to a suitable range, and the method has great significance in promoting upland cotton molecular design breeding and cultivating new varieties suitable for mechanized production and has wide agricultural application prospects.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to the application of the GhRPD1 gene in regulating the angle between fruiting branches of upland cotton. Background Technology

[0002] Cotton (Gossypium hirsutum L.) is an important economic crop, with its fiber, edible oil, and protein production playing a vital role in the agricultural economy. The Northwest Inland Cotton Region has become the core area of ​​cotton production, dominating in both yield and planting area. With the widespread adoption of mechanized cotton harvesting technology, optimizing plant structure has become a key factor in improving production efficiency. Among these factors, the fruit branch angle (FBA) directly affects the plant compactness, planting density, and mechanized harvesting efficiency. A moderate fruit branch angle (45°-60°) balances light penetration, ventilation, and adaptability to mechanized harvesting, while excessively large or small angles can lead to boll shedding, increased pests and diseases, or higher harvest losses. Therefore, identifying key genes regulating the fruit branch angle and applying them to molecular breeding is of great significance for developing new cotton varieties suitable for mechanized production.

[0003] However, current research on upland cotton FBA still has many shortcomings. Regarding genetic mapping, although some studies have located several QTLs controlling fruit branch angles using different populations, the explanatory power of these loci is generally low, and they lack cross-environmental stability verification, making them difficult to directly apply to breeding practices. While genome-wide association studies (GWAS) have identified some SNP loci and candidate genes significantly associated with fruit branch angles, the vast majority of these candidate genes are based solely on bioinformatics predictions and lack molecular biological experimental verification (such as gene editing, overexpression, or RNAi silencing), making it impossible to confirm their function.

[0004] Currently, no major gene capable of stably regulating the fruit-branch angle in upland cotton has been cloned, resulting in a lack of effective targets for molecular design breeding. Therefore, identifying key genes regulating the fruit-branch angle in upland cotton is of great significance for advancing molecular breeding of cotton plant type. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the GhRPD1 gene in regulating the fruiting branch angle of upland cotton, thereby addressing the problems existing in the prior art. This invention, by reducing or inhibiting the expression of the GhRPD1 gene, can significantly increase the fruiting branch angle of upland cotton, providing a clear molecular target for cotton plant architecture improvement. This invention is of great significance for promoting molecular design breeding of upland cotton and cultivating new varieties adapted to mechanized production, and has broad prospects for agricultural application.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides the application of the GhRPD1 gene or related biological materials in regulating the fruit branch angle of upland cotton, reducing or inhibiting the expression of the GhRPD1 gene in upland cotton, thereby increasing the fruit branch angle of the upland cotton; the nucleotide sequence of the GhRPD1 gene is as described in SEQ ID NO.5.

[0008] Optionally, the relevant biological materials include a silencing vector for the GhRPD1 gene and a recombinant microorganism containing the silencing vector.

[0009] Optionally, the upland cotton includes Ji Mian 8.

[0010] The present invention also provides a method for increasing the fruiting branch angle of upland cotton, including the step of reducing or inhibiting the expression of the GhRPD1 gene in the upland cotton; the nucleotide sequence of the GhRPD1 gene is shown in SEQ ID NO.5.

[0011] Optionally, reducing or inhibiting the expression of the GhRPD1 gene in the upland cotton includes silencing the GhRPD1 gene using the VIGS vector system.

[0012] Optional, specific steps include:

[0013] Amplify the silenced fragment of the GhRPD1 gene;

[0014] The silenced fragment is ligated into a silenced vector to obtain a vector that silences the GhRPD1 gene;

[0015] The vector that silences the GhRPD1 gene is transformed into Agrobacterium to obtain recombinant Agrobacterium carrying the vector that silences the GhRPD1 gene;

[0016] The recombinant Agrobacterium was used to infect the upland cotton, thereby silencing the GhRPD1 gene in the upland cotton.

[0017] Optionally, the amplification primers for the silenced fragment are shown in SEQ ID NO.3-4.

[0018] Optionally, the upland cotton includes Ji Mian 8.

[0019] The present invention discloses the following technical effects:

[0020] This invention identified GhRPD1, a key gene regulating the fruiting branch angle in upland cotton, through genome-wide association analysis (GWAS), and revealed its important role in cotton plant architecture regulation. Experiments confirmed that reducing or inhibiting GhRPD1 gene expression can significantly increase the fruiting branch angle in upland cotton by 4-5°, providing a clear molecular target for cotton plant architecture improvement.

[0021] This invention effectively optimizes cotton plant structure, increases the fruiting branch angle to a suitable range, thereby improving light penetration and ventilation in cotton fields, reducing boll shedding rate, and enhancing mechanized harvesting efficiency. This invention is of great significance for promoting molecular design breeding of upland cotton and cultivating new varieties adapted to mechanized production, and has broad prospects for agricultural application. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 Manhattan plot and QQ plot for correlation analysis of fruit branch angle of BLUP upland cotton in five different planting environments;

[0024] Figure 2 LD linkage disequilibrium analysis of significant SNP sites on chromosomes A06(A) and D04(B);

[0025] Figure 3 The distribution frequency of different haplotypes of the GhRPD1 gene in two varieties with extreme fruit branch angles;

[0026] Figure 4 Box plots showing the fruit branch angle phenotypes corresponding to different haplotypes of the GhRPD1 gene;

[0027] Figure 5 The expression level of the GhRPD1 gene in the fourth, fifth, and sixth fruit branches of the extreme fruit branch angle variety;

[0028] Figure 6 The images show the relevant vector maps used for gene silencing, where A is the pCloneEZ-TOPO cloning vector map and B is the CLCrV vector map.

[0029] Figure 7 The results are for the amplification of the target fragment and the PCR identification of positive bacterial cultures.

[0030] Figure 8 For the silencing efficiency test of GhRPD1;

[0031] Figure 9 Phenotypic analysis of GhRPD1 silent plants, where A represents the fruit branch angle phenotype of silent plants and B represents the phenotypic statistical analysis of silent plants. Detailed Implementation

[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0033] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0034] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0035] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0036] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0037] Example 1: Genome-wide association analysis of the fruit-branch angle in upland cotton

[0038] 1. Experimental materials and phenotypic identification

[0039] Sixty-nine upland cotton germplasm accessions were selected and planted in 2020 at the Shihezi and Korla experimental stations of the Cotton Research Institute of the Xinjiang Academy of Agricultural Sciences, the Dunhuang cotton experimental station of the Gansu Academy of Agricultural Sciences, and the Alar experimental station in Xinjiang. These accessions were named SHZ20, KEL20, DH20, and ALE20. In 2021, they were planted at the Shihezi and Korla experimental stations of the Cotton Research Institute of the Xinjiang Academy of Agricultural Sciences and named SHZ21 and KEL21. These upland cotton germplasm accessions exhibited stable genetic characteristics through self-pollination. After screening, 418 core upland cotton germplasm accessions were finally selected for genome-wide association analysis.

[0040] The angles of the middle fruiting branches (4th, 5th, and 6th fruiting branches) of natural populations of upland cotton germplasm grown in the above six environments were measured, and the average value of the middle fruiting branch angles (FBA) was calculated. 456 The best linear unbiased predictor value (BLUP) of the phenotype was calculated using a mixed linear model, with a generalized heritability of 74.66%.

[0041] 2. Genome-wide association analysis

[0042] Using whole-genome resequencing, 4,452,629 high-quality SNP markers were obtained by screening for MAF ≥ 0.05 and deletion rate ≤ 0.5%. Variance types were annotated using SnpEff software. Subgroups were identified using PCA (VCF2PCACluster), phylogenetic tree (FastME), and Admixture (K = 1–15), with an optimal K = 3. An MLM model using EMMAX software was employed, with population structure as a covariate and a threshold P ≤ 1 × 10⁻⁶. -5 Significantly associated loci were identified. A total of 231 SNPs significantly associated with the fruit branch angle were identified. Based on multiple environmental and BLUP association results, linkage loci significantly associated with the FBA trait were found on chromosomes A06 and D04, indicating the presence of QTLs significantly associated with the FBA trait on chromosomes A06 and D04. Figure 1 Among them, strongly linked blocks exist in the A06 (22.61-23.12Mb) and D04 (5.63-5.79Mb) chromosomal regions. Figure 2 ).

[0043] 3. Functional annotation of candidate genes in genome-wide association analysis

[0044] Significant variant sites were extracted using R language, and with the upland cotton TM-1 genome annotation file as a reference, significant variant sites located in gene promoters and coding sequences (CDS) were screened. Further screening on chromosome A06 revealed three variant sites (A06_23104748, A06_23105351, and A06_23105352) in the coding region of the GhRPD1 gene.

[0045] Further analysis was conducted to determine whether the variant sites led to changes in amino acids, and the candidate genes were functionally annotated using the Zhejiang University upland cotton TM-1 genome database (http: / / cotton.zju.edu.cn / index.htm). Three variant sites (A06_23104748, A06_23105351, and A06_23105352) within the GhRPD1 gene were ultimately identified as SNP variants, with P-values ​​of 5.08, 5.35, and 5.35, respectively. The variant at site A06_23105351 resulted in the replacement of leucine (L) with phenylalanine (F); the variant at site A06_23105352 resulted in the replacement of glutamate (E) with glutamine (Q) (Table 1). This suggests that the variant sites within this gene may lead to changes in gene function and thus participate in the regulation of cotton fruiting branch angle.

[0046] Table 1 Functional annotations of internal variant sites in candidate genes

[0047]

[0048] Example 2: Further identification of key genes in the fruit branch angle of upland cotton.

[0049] 1. Candidate gene association analysis

[0050] Based on resequencing data from 418 core upland cotton germplasms, significant variant sites were extracted from the candidate gene GhRPD1, and haplotypes were constructed. The frequency distribution of haplotypes was analyzed for the 50 extreme varieties with the largest and smallest fruit branch angles, and phenotypic differences between different haplotypes were assessed using t-tests.

[0051] The results showed that the GhRPD1 gene contained three haplotypes: A06_23104748, A06_23105351, and A06_23105352 (Hap1: GGGGGG; Hap2: AACCCC). Based on the haplotype frequency distribution among the 50° angled fruit branches, in varieties with a large fruit branch angle, the frequency of Hap1 in the GhRPD1 gene was 45%, and the frequency of Hap2 was 75%. In varieties with a small fruit branch angle, the frequency of Hap1 in the GhFBA1 gene was 55%, and the frequency of Hap2 was 25%. Figure 3 ).

[0052] A T-test was performed on the phenotypic values ​​corresponding to haplotypes within the GhRPD1 gene in 418 varieties, revealing that the fruit branch angle increased significantly after mutation at the internal loci of the GhRPD1 gene compared to the unmutated varieties. Figure 4 This indicates that internal mutations in the GhRPD1 gene may have a positive effect on the angle between cotton fruit branches.

[0053] 2. Differences in the expression of candidate genes in extreme varieties

[0054] To further investigate the expression patterns of candidate genes in varieties with extreme fruit branch angles, the fourth, fifth, and sixth fruit branches of the small-angle variety Jimian 8 and the large-angle variety Shan 689 (both provided by Xinjiang Academy of Agricultural Sciences) were selected as experimental materials, and qRT-PCR was used for detection. The expression levels of the target genes were normalized using the housekeeping gene GhActin. The relative expression levels of each tissue were calculated using a 2-1 ratio. -ΔΔCT The method was calculated. Finally, significance testing was performed using SPSS 26.0 software. The primers used in the qRT-PCR assay are as follows:

[0055] qGhRPD1-F: CTGAAAGCGGGGTCATTGGA, SEQ ID NO.1;

[0056] qGhRPD1-R: GTGGCATCACAAGTTCCCGT, SEQ ID NO. 2.

[0057] The results showed that the expression of the GhRPD1 gene differed significantly among the fourth, fifth, and sixth fruit branches. Figure 5 This further suggests that it may play an important role in the formation and regulation of the fruit branch angle.

[0058] Example 3: Functional Verification of Key Genes for the Fruit Branch Angle in Upland Cotton

[0059] In this embodiment, to further verify the function of key genes, the silenced fragments of key genes were cloned, and the CLCrV expression vector was constructed. Endogenous gene silencing was performed on the upland cotton variety Jimian 8 with a small angle, and its role in regulating the fruit branch angle of upland cotton was explored.

[0060] 1. Experimental materials

[0061] The test materials were upland cotton varieties Zhongmian 113, Jimian 8 (small angle), and Shan 689 (large angle), provided by the Xinjiang Academy of Agricultural Sciences.

[0062] The VIGS vector systems (CLCrVA, CLCrVB, and CLCrV-ChⅡ) used for gene silencing were donated by the Transgenic Research Group of the Cotton Research Institute, Chinese Academy of Agricultural Sciences. The vectors, such as... Figure 6 As shown.

[0063] 2. Cloning of the target gene silencing fragment

[0064] RNA was extracted from leaves of Zhongmian 113 and reverse transcribed into cDNA. This cDNA served as a template for amplification. The target gene was amplified using designed specific silencing primers (GhRPD1-F: GACTAGTTGGACGTGAACCGGGTATAA, SEQ ID NO.3; GhRPD1-R: AGGCGCGCCCTTCCAAAGCAACAATGGGCA, SEQ ID NO.4) and Taq 2×PCRMix with Dye V2 premix (containing dye). The sequence of the silenced target gene fragment is as follows:

[0065] Silent GhRPD1 gene fragment (SEQ ID NO.5):

[0066]

[0067] The PCR reaction system was as follows: 10 μL of Taq 2×PCRMix with Dye V2 (dye pius), cDNA template (100 ng / μL) with a final concentration of <500 ng, 1.6 μL of primer-F (2.5 μM), 1.6 μL of primer-R (2.5 μM), and ddH2O to make up to 20 μL.

[0068] The reaction program was set as follows: 94℃ pre-denaturation for 30s, 98℃ denaturation for 10s, 58℃ annealing for 30s, 65℃ extension for 1min, for a total of 30 cycles, and finally 65℃ final extension for 5min.

[0069] After agarose gel electrophoresis, the PCR products were excised and the target fragment was recovered using a DNA purification and recovery kit. The purified product was ligated into the pCloneEZ-TOPO vector (C5866) at room temperature for 5 minutes and transformed into DH5α competent cells. The transformation system was incubated on ice for 30 minutes, heat-shocked at 42°C for 30 seconds, and then added to LB liquid medium with shaking at 37°C for 1 hour. The cells were plated on LB agar plates containing Kan+ and incubated at 37°C. Single colonies were then picked and inoculated into LB liquid medium containing Kan+ and incubated at 37°C for 8 hours. PCR amplification was performed using the bacterial culture as a template, and positive clones were screened by electrophoresis. Plasmids were extracted from the positive bacterial cultures using the AFT Spin PlasmidMin Kit and then sequenced. The results are as follows: Figure 7 Electrophoresis analysis showed that the size of the target band in the recombinant plasmid CLCrV-gene was as expected.

[0070] 3. Transformation with Agrobacterium GV3101

[0071] Take 1 μL of the successfully sequenced CLCrV-gene plasmid and place it in Agrobacterium GV3101 competent cells. After gently mixing, place the cells on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min. Then add 700 μL of antibiotic-free LB liquid medium and incubate at 28°C and 200 rpm for 2 h. Spread the recovered bacterial culture onto solid medium containing 50 ng / μL Kan+ and 25 ng / μL LRif and incubate at 28°C for 2 days. Pick single colonies and incubate overnight at 28°C. PCR is used to confirm positive strains. Then mix the bacterial culture with 50% glycerol 1:1 and store at -80°C.

[0072] 4. Virus-induced gene silencing

[0073] Successfully transformed Agrobacterium CLCrV:GhRPD1, CLCrVA, CLCrVB, and CLCrV:GhChⅡ were revived in liquid medium (50 ng / μL Kan+, 25 ng / μL L IF). After revival, the bacterial suspension was expanded and cultured. Once the suspension became turbid, the cells were collected by centrifugation at 6000 rpm for 10 min, and the supernatant was discarded. The bacterial cells were resuspended in MMA resuspension to OD200. 600 =1.8, stand in the dark for 3-5 hours. Mix CLCrVB with bacterial suspensions containing CLCrV:GhRPD1, CLCrVA and CLCrV:GhChⅡ at a 1:1 ratio and mix thoroughly.

[0074] Seven days after emergence, healthy and fully expanded cotyledons of the Jimian 8 cotton seedling were selected for the experiment. The cotyledons were punctured on the underside with a needle tip, and a mixed resuspension was injected into the cotyledons using a 1mL syringe, ensuring complete filling. The plants were then placed in darkness for 24 hours, followed by incubation at 25°C in a light incubator (16 hours light / 8 hours darkness). New leaves were sampled when the young leaves of the CLCrV:GhChⅡ plants began to show yellowing. RNA was extracted from the third true leaf of the silenced plants for positive plant detection, and the silencing efficiency was determined by qRT-PCR. Silent plants with gene expression levels below 0.5 compared to the control plants were transplanted (…). Figure 8 () for subsequent trait observation and analysis.

[0075] 5. Phenotypic traits of silent plants

[0076] When comparing the phenotypic performance of silent plants and control plants, it was found that the fruit branch angle of the CLCrV:GhRPD1 silent plants showed a highly significant increase, with an increase of 4-5°. Figure 9 ).

[0077] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of the GhRPD1 gene or related biological materials in regulating the angle between fruiting branches of upland cotton, characterized in that, In upland cotton, reducing or inhibiting the expression of the GhRPD1 gene increases the fruiting branch angle; the nucleotide sequence of the GhRPD1 gene is as described in SEQ ID NO.

5.

2. The application according to claim 1, characterized in that, The relevant biological materials include a silencing vector for the GhRPD1 gene and recombinant microorganisms containing the silencing vector.

3. The application according to claim 1, characterized in that, The upland cotton mentioned includes Ji Mian 8.

4. A method for increasing the angle between fruiting branches of upland cotton, characterized in that, The method includes the step of reducing or inhibiting the expression of the GhRPD1 gene in the upland cotton; the nucleotide sequence of the GhRPD1 gene is shown in SEQ ID NO.

5.

5. The method according to claim 4, characterized in that, Reducing or inhibiting the expression of the GhRPD1 gene in the upland cotton includes silencing the GhRPD1 gene using the VIGS vector system.

6. The method according to claim 5, characterized in that, The specific steps include: Amplify the silenced fragment of the GhRPD1 gene; The silenced fragment is ligated into a silenced vector to obtain a vector that silences the GhRPD1 gene; The vector that silences the GhRPD1 gene is transformed into Agrobacterium to obtain recombinant Agrobacterium carrying the vector that silences the GhRPD1 gene; The recombinant Agrobacterium was used to infect the upland cotton, thereby silencing the GhRPD1 gene in the upland cotton.

7. The method according to claim 5, characterized in that, The amplification primers for the silenced fragment are shown in SEQ ID NO.3-4.

8. The method according to claim 4, characterized in that, The upland cotton mentioned includes Ji Mian 8.

Images