Method for screening fusarium graminearum responding to low-toxicity and high-toxicity DON in silage acid environment

Abstract

The invention relates to a method for screening fusarium graminearum of low-toxicity and high-toxicity DON responding to an ensiling acid environment, belongs to the technical field of microorganisms, and solves the problems that a pH-DON toxicity correlation model is not established at present, low-toxicity and high-toxicity strains under ensiling stress cannot be distinguished, and the screening efficiency is high. And the screened low-toxicity strain still has a large quantity of toxins in a real ensiling environment. According to the method, a screening system of'low-pH silage acid environment simulated strain culture-qPCR detection and DON toxin detection 'is utilized for the first time, the silage acid environment is simulated by the method, so that the silage acid environment is more accurately applied to silage, the toxin production characteristics of different strains after acid response are distinguished from the molecular level, and the low-toxicity / high-toxicity strains are more substantial. The application value of evaluating the potential risk of the strain in the silage by using the acid response difference characteristics is clear, the silage toxin is favorably converted from post detection to source prevention and control, and the toxin is thoroughly prevented from entering a food chain.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and more particularly to a method for screening Fusarium graminearum strains with low and high toxicity (DON) that respond to acidic silage environments. Background Technology

[0002] Silage, as an important source of nutrition in ruminant animal husbandry, effectively preserves the nutritional value of fresh or semi-dry forage through anaerobic fermentation technology. However, the silage process still carries potential risks. If the raw materials have been infected by pathogenic fungi such as *Fusarium graminearum* in the field, these fungi may survive and continue to be active, producing trichothecene toxins, primarily deoxynivalenol (DON). When animals ingest contaminated feed, it not only leads to reduced feed conversion ratios but also affects animal health and production performance, manifesting as decreased feed intake, weakened immunity, and reproductive disorders. More seriously, these toxins may pose a potential threat to human health through the food chain (such as milk), causing significant economic losses and food safety risks.

[0003] The acidic anaerobic environment of silage can effectively inhibit the growth of most putrefactive bacteria and pathogenic fungi, thereby reducing their toxin content. Existing research on Fusarium graminearum and silage mainly focuses on two relatively independent areas: (1) field control to reduce the amount of bacteria carried in raw materials; (2) silage additives (such as chemical preservatives, homo / heterotype fermenting lactic acid bacteria, enzyme preparations) to improve fermentation quality and inhibit harmful microorganisms.

[0004] Current technologies only identify bacterial species, without establishing a pH-DON toxicity correlation model, and cannot distinguish between low-toxicity and high-toxicity strains under silage stress. Furthermore, lactic acid bacteria (such as *Lactobacillus plantarum*) in silage inhibit Fusarium growth through acid production competition, while existing pure culture screening methods ignore microbial antagonism, resulting in low-toxicity strains screened in vitro still producing large amounts of toxins in real silage environments. Summary of the Invention

[0005] In view of the above analysis, the present invention aims to provide a method for screening low-toxicity and high-toxicity DON-responsive Fusarium graminearum in silage acidic environments, in order to solve at least one of the following problems in existing methods: lack of a pH-DON toxicity correlation model in silage, inability to distinguish between low-toxicity and high-toxicity strains under silage stress, and the fact that screened low-toxicity strains still produce large amounts of toxins in real silage environments.

[0006] In a first aspect, the present invention provides a method for screening Fusarium graminearum strains with low and high toxicity DON that respond to acidic silage environments, comprising the following steps:

[0007] (1) Isolation and identification of Fusarium graminearum: Maize stalk rot samples were collected, disinfected on the surface, and then inoculated into a culture medium for purification and culture. Fusarium graminearum was identified by ITS sequence comparison.

[0008] (2) Prepare PDA culture media with different pH values ​​and inoculate Fusarium graminearum: Adjust the pH values ​​of the two PDA culture media to 4 and 7 respectively, sterilize them to make plates, inoculate them with Fusarium graminearum obtained in step (1), and culture.

[0009] (3) qPCR identification of strains with different acid responses: extract DNA and RNA from the hyphae of Fusarium graminearum cultured at two pH values ​​in step (2), and calculate the relative expression levels of different Fusarium graminearum genes based on the expression level of Tri13 gene and internal reference gene detected by qPCR to obtain strains with different acid responses.

[0010] (4) Toxin content detection: Based on the different acid response strains obtained in step (3), select two strains with the most obvious acid response, freeze-dry the two strains with the most obvious acid response, and detect the DON content to obtain Fusarium graminearum with low DON and Fusarium graminearum with high DON under acid response.

[0011] Furthermore, in step (1), the collected corn stalk rot samples are cut into small tissue pieces of 0.5×0.5cm to ensure that each tissue piece contains the boundary between diseased and healthy tissue.

[0012] Furthermore, in step (3), the internal reference gene sequence is as follows: FG-GAPDH-F:5'-GTCCACTCCTACACTGCCAC-3', 5'-FG-GAPDH-R:GCCTCCTTGA TGACCTGCTT-3'.

[0013] Furthermore, in step (4), the strain with the highest difference in relative gene expression under the two pH treatments is selected as the strain with the most obvious acid response.

[0014] Furthermore, in step (4), the DON content is detected using an ELISA kit.

[0015] Furthermore, in step (4), the Fusarium graminearum with low toxicity DON under acid response is Fusarium graminearum FG-HB-CSR120-3AcDON with preservation number CGMCCNo.41887;

[0016] The Fusarium graminearum strain that exhibits high DON toxicity under acid response is Fusarium graminearum FG-NX-CSR209-15AcDON, with preservation number CGMCC No.41888.

[0017] Furthermore, the acid-responsive Fusarium graminearum with low DON toxicity contains the 16S rDNA shown in SEQ ID NO.1, and the acid-responsive Fusarium graminearum with high DON toxicity contains the 16S rDNA shown in SEQ ID NO.2.

[0018] Secondly, the present invention provides a Fusarium graminearum FG-HB-CSR120-3AcDON strain with preservation number CGMCC No.41887 that exhibits low toxicity of DON under acidic silage conditions.

[0019] Thirdly, the present invention provides a Fusarium graminearum FG-NX-CSR209-15AcDON strain with preservation number CGMCC No.41888 that exhibits high toxicity of DON under acidic silage conditions.

[0020] Fourthly, the present invention provides an application of the above-mentioned Fusarium graminearum in the control of toxins in silage.

[0021] Compared with the prior art, the present invention can achieve at least one of the following beneficial effects:

[0022] This invention pioneers a screening system utilizing a "low-pH simulated acidic silage environment for bacterial culture - qPCR detection and DON toxin detection" approach. This method simulates the acidic environment of silage, making its application in silage more accurate. It distinguishes the toxin-producing characteristics of different bacterial strains in acid response at the molecular level, making the identification of low-toxicity / high-toxicity strains more concrete. This clarifies the application value of using acid response differences to assess the potential risks of bacterial strains in silage, and facilitates a shift from "post-detection" to "source control" of silage toxins, completely preventing toxins from entering the food chain.

[0023] In this invention, the above-described technical solutions can be combined with each other to achieve more preferred combinations. Other features and advantages of this invention will be set forth in the following description, and some advantages may become apparent from the description or be learned by practicing the invention. The objects and other advantages of this invention can be realized and obtained from the description and drawings, which are particularly pointed out. Attached Figure Description

[0024] The accompanying drawings are for illustrative purposes only and are not intended to limit the invention. Throughout the drawings, the same reference numerals denote the same parts.

[0025] Figure 1 These are the 7 strains of Fusarium graminearum screened in Example 1 of this invention;

[0026] Figure 2 The relative expression levels of genes in the seven Fusarium graminearum strains screened in Example 1 of this invention;

[0027] Figure 3 The colors of mycelia 120 and 209 in this invention under different acid treatments;

[0028] Figure 4 The expression levels of the DON synthesis gene in bacteria 120 and 209 in this invention;

[0029] Figure 5 The results show the DON content of bacteria 120 and 209 in this invention;

[0030] Figure 6 The results of the KEGG annotation analysis in Experiment Example 1 of this invention are shown;

[0031] Figure 7 This is the PCR identification result in Experiment Example 3 of the present invention. Detailed Implementation

[0032] The preferred embodiments of the present invention will now be described in detail with reference to the accompanying drawings, which constitute a part of the present invention and are used together with the embodiments of the present invention to illustrate the principles of the present invention, but are not intended to limit the scope of the present invention.

[0033] The Fusarium graminearum strain with low DON responsiveness to acid described in this invention is Fusarium graminearum FG-HB-CSR120-3AcDON (hereinafter referred to as 120), with accession number CG MCC No. 41887. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with accession number CGMCC No. 41887, and the deposit date is April 11, 2025.

[0034] The *Fusarium graminearum* strain with highly toxic DON under acid response described above is *Fusarium graminearum* FG-NX-CSR209-15AcDON (hereinafter referred to as 209), with accession number CGMCC No. 41888. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with accession number CGMCC No. 41888, and deposit date of April 11, 2025.

[0035] A specific embodiment of the present invention discloses a method for screening Fusarium graminearum strains with low and high toxicity DON that respond to acidic silage environments, comprising the following steps:

[0036] (1) Isolation and identification of Fusarium graminearum: Maize stalk rot samples were collected, disinfected on the surface, and then inoculated into a culture medium for purification and culture. Fusarium graminearum was identified by ITS sequence comparison.

[0037] (2) Prepare PDA culture media with different pH values ​​and inoculate Fusarium graminearum: Adjust the pH values ​​of the two PDA culture media to 4 and 7 respectively, sterilize them to make plates, inoculate them with Fusarium graminearum obtained in step (1), and culture.

[0038] (3) qPCR identification of strains with different acid responses: extract DNA and RNA from the hyphae of Fusarium graminearum cultured at two pH values ​​in step (2), and calculate the relative expression levels of different Fusarium graminearum genes based on the expression level of Tri13 gene and internal reference gene detected by qPCR to obtain strains with different acid responses.

[0039] (4) Toxin content detection: Based on the different acid-responsive strains obtained in step (3), select two strains with the most obvious acid response, freeze-dry the two strains with the most obvious acid response, and detect the DON content to obtain Fusarium graminearum with low DON under acid response and Fusarium graminearum with high DON under acid response.

[0040] Existing technologies lack a pH-DON toxicity correlation model, making it impossible to distinguish between low-toxicity and high-toxicity strains under silage stress. Furthermore, lactic acid bacteria (such as *Lactobacillus plantarum*) in silage competitively inhibit *Fusarium* growth through acid production, but existing pure culture screening methods ignore microbial antagonism, resulting in low-toxicity strains screened in vitro still producing significant amounts of toxins in real silage environments. Based on these limitations, this invention pioneers a screening system utilizing a "low-pH simulated acidic silage environment for strain cultivation - qPCR detection and DON toxin detection" approach. This method simulates the acidic environment of silage, making its application in silage more accurate, distinguishing the toxin production characteristics of different strains after acid response at the molecular level, and making the distinction between low-toxicity and high-toxicity strains more substantial. This will clarify the application value of using acid response differences to assess the potential risks of strains in silage, and facilitate a shift from "post-detection" to "source control" of silage toxins, completely blocking toxins from entering the food chain.

[0041] Specifically, in step (1), surface disinfection is performed using sodium hypochlorite.

[0042] Specifically, in step (1), the corn stalk disease samples were collected from two regions: Yongning in Ningxia and Zhuozhou in Hebei. The collected corn stalk rot samples were cut into small tissue pieces of 0.5×0.5cm to ensure that each tissue piece contained the boundary between diseased and healthy tissue.

[0043] More preferably, the small tissue pieces are first soaked in 75% alcohol for 10 seconds, and then disinfected with sodium hypochlorite containing 4% available chlorine for 5 minutes. After disinfection, the tissue is rinsed three times with sterile water and then air-dried until the tissue surface is free of moisture.

[0044] Specifically, in step (1), the purification culture includes: first, culturing on a PDA plate medium containing two antibiotics; when a single colony grows at the junction of diseased and healthy tissue in a small tissue piece, picking the colony from the edge and transferring it to the PDA medium for purification culture; after two purification cultures, culturing the hyphae in the PDB medium for sporulation; culturing the PDB liquid on the PDA medium using the plate dilution method for single sporulation; and selecting single sporulations as subsequent reserve fungi.

[0045] Preferably, the antibiotic is a mixture of penicillin and streptomycin in a 1:1 ratio.

[0046] Specifically, in step (1), the concentration of the two antibiotics in the PDA culture medium is 30-70 ng / mL.

[0047] Preferably, in step (1), the temperature of the PDA plate culture medium is 25-28℃ and the humidity is 50-85%.

[0048] Preferably, the temperature for sporulation culture is 25-28℃ and the rotation speed is 180 rpm.

[0049] If instructions are required, the selected single spores should be cultured in PDA medium for 7 days before ITS sequence comparison. The mycelium should be scraped, flash-frozen in liquid nitrogen, cooled, and ground. Genomic DNA extraction should be performed using a kit from TransGenBiotech.

[0050] Specifically, in step (1), the ITS sequence comparison includes the following: PCR amplification is performed using universal ITS primers (primers synthesized by Beijing Liuhe BGI), with a PCR reaction volume of 25 μL. The amplification program is as follows: pre-denaturation at 94℃ for 5 minutes; followed by 35 cycles, each cycle including denaturation at 94℃ for 30 seconds, annealing at 54℃ for 30 seconds, and extension at 72℃ for 59 seconds; finally, extension at 72℃ for 5 minutes. After amplification, the product is sent to BGI for bidirectional sequencing. After sequence assembly, the sequencing results are compared with the NCBI database to identify the fungal species. The strain that matches Fusarium graminearum is used as a backup strain for the next step.

[0051] It should be noted that the components of the PDA culture medium in this invention are shown in Table 1. Specifically, the peeled potatoes are made by peeling the potatoes, cutting them into 1×1cm pieces, adding an appropriate amount of water and boiling until soft, filtering with 8 layers of gauze, and adding the filtered liquid to the culture medium.

[0052] Table 1. Components of PDA culture medium

[0053]

[0054]

[0055] Specifically, in step (2), sodium hydroxide and / or hydrochloric acid are used to adjust the pH value.

[0056] It should be noted that the pH of the PDA medium was adjusted to 4 and 7 respectively, and then sterilized and plates were prepared. The Fusarium graminearum mycelium obtained in step (1) was inoculated into the center of the plate, with 8 plates for each mycelium sample. After sealing with sealing film, the plates were placed in an incubator at 28°C for incubation.

[0057] Specifically, in step (3), samples are collected after culturing at different pH values ​​for 10 days.

[0058] Specifically, in step (3), the internal reference gene sequence is as follows: FG-GAPDH-F:5'-GTCCACTCCTACACTGCCAC-3', FG-GAPDH-R:5'-GCCTCCTTGATG ACCTGCTT-3'.

[0059] It should be noted that in step (3), to avoid excessive error during material collection, the culture dish was divided into 4 equal parts, and one part was scraped from each culture dish into a 1.5 mL centrifuge tube. The scraped mycelium was flash-frozen with liquid nitrogen, and after thorough pre-cooling, it was ground in a grinder. Genomic DNA was extracted using a DNA extraction kit from TransGen Biotech, Beijing. This DNA was used for quantification of Fusarium graminearum. RNA was extracted using an RNA extraction kit from TransGen Biotech, Beijing. Then, the RNA was reverse transcribed into cDNA using a reverse transcription kit from TransGen Biotech, Beijing. This cDNA was used to determine the expression level. The target gene was determined using the primer pair Tri13P1: 5'-CTCSACCGCATCGAAGASTCTC-3' (forward primer) and Tri13P2: 5'-GAASGTCGCARGACCTTGTTTC-3' (reverse primer). The Fusarium graminearum gene (FG-GAPDH-F:GTCCACTCCTACACTGCCAC, FG-GAPDH-R:GCCTCCTTGATGACCTGCTT) was used as an internal control gene. The PCR reaction mixture consisted of 5 μL of 2×PowerUp™ SYBR™ Green Master Mix (Thermo Fisher Scientific), 0.8 μL of primers, 0.5 μL of cDNA, and 3.7 μL of water. PCR reactions were performed using an ABI QuantStudio 1 instrument (Applied Biosystems, USA). The PCR program was as follows: 40 cycles of pre-denaturation at 95°C for 30 s, denaturation at 95°C for 45 s, annealing at 54°C for 30 s, extension at 72°C for 1 min, and a final extension at 72°C for 10 min. The relative gene expression levels were calculated using the 2-ΔΔCt method. Each PCR result was from at least four biological replicates, and the data are presented as mean ± SD.

[0060] Specifically, in step (4), the mycelium of the two strains with the most obvious acid response was freeze-dried after being cultured in a petri dish for 10 days.

[0061] Preferably, the freeze-drying process involves pre-freezing at -40°C and then freeze-drying under a vacuum of <10Pa for 48–72 hours until constant weight is achieved.

[0062] Specifically, in step (4), the strain with the highest difference in relative gene expression under the two pH treatments is selected as the strain with the most obvious acid response.

[0063] Specifically, under pH=7 treatment, the strain with the largest difference in relative gene expression was Fusarium graminearum with high DON toxicity under acid response (i.e., 209), while under pH=4 treatment, the strain with the largest difference in relative gene expression was Fusarium graminearum with low DON toxicity under acid response (i.e., 120).

[0064] Specifically, in step (4), the DON content is detected using an ELISA kit.

[0065] The ELISA kit in this invention is manufactured by Jiangsu Enzyme Biotechnology Co., Ltd.

[0066] Specifically, in step (4), the Fusarium graminearum strain with low toxicity DON under acid response is Fusarium graminearum FG-HB-CSR120-3AcDON (hereinafter referred to as 120) with accession number CGMCC No. 41887. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with accession number CGMC C No. 41887 and deposit date of April 11, 2025.

[0067] Preferably, the acid-responsive, low-toxicity DON Fusarium graminearum contains the 16S rDNA shown in SEQ ID NO.1.

[0068] Specifically, in step (4), the Fusarium graminearum strain with highly toxic DON under acid response is Fusarium graminearum FG-NX-CSR209-15AcDON (hereinafter referred to as 209) with accession number CGMCC No. 41888. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with accession number CGM CC No. 41888 and deposit date of April 11, 2025.

[0069] Preferably, the acid-responsive, highly toxic DON-containing Fusarium graminearum contains the 16S rDNA shown in SEQ ID NO.2.

[0070] Another specific embodiment of the present invention discloses a Fusarium graminearum FG-HB-CSR120-3AcDON strain with preservation number CGMCC No.41887 that exhibits low toxicity of DON under acidic silage conditions.

[0071] Another specific embodiment of the present invention discloses a Fusarium graminearum FG-NX-CSR209-15AcDON strain with preservation number CGMCC No.41888 that exhibits high toxicity of DON under acidic silage conditions.

[0072] Another specific embodiment of the present invention discloses the application of the above-mentioned low-toxicity DON or high-toxicity DON in acid response Fusarium graminearum in the control of toxins in silage.

[0073] The method of this invention screened two Fusarium graminearum strains with differentiated acid responses. This method is crucial for understanding the differences in toxin production by Fusarium graminearum in silage. This invention has the application value of assessing the potential risks of strains in silage by utilizing the differences in acid response characteristics (this invention achieves the assessment of potential risks in silage by screening low-toxicity and high-toxicity Fusarium graminearum strains, and corresponding antagonistic bacteria are selected based on the screening of low-toxicity and high-toxicity Fusarium graminearum strains; for example, acid treatment can inhibit toxins, and acidic substances can be added, etc.). Furthermore, it facilitates the shift from "post-detection" to "source control" of toxins in silage, completely blocking toxins from entering the food chain.

[0074] The technical solution of the present invention will be further explained below with reference to specific embodiments.

[0075] Example 1

[0076] A method for screening Fusarium graminearum strains with low and high toxicity DON that respond to acidic silage environments includes the following steps:

[0077] (1) Isolation and identification of Fusarium graminearum:

[0078] Maize stalk rot samples were collected in Yongning, Ningxia and Zhuozhou, Hebei. The collected stalk rot tissue samples were cut into 0.5×0.5cm pieces, with at least 50 pieces per sample, ensuring each piece contained the boundary between diseased and healthy tissue. The tissue pieces were then soaked in 75% alcohol for 10 seconds, followed by disinfection with 4% available chlorine sodium hypochlorite for 5 minutes. After disinfection, the tissue pieces were rinsed three times with sterile water and air-dried until the surface was dry. Next, the tissue pieces were inoculated onto PDA agar plates containing 50 ng / mL of dual antibiotics (penicillin and streptomycin) and incubated at 28°C and 50% humidity. When a single colony grew at the boundary between diseased and healthy tissue, the colony was picked from the edge and transferred to PDA agar for purification. After two purification cultures, the mycelia were transferred to PDB agar for sporulation culture (culture conditions: 28°C, 180 rpm). Finally, single-spore cultures were performed on PDA medium using the plate dilution method with PDB liquid, and single spores were picked as subsequent reserve fungi. After the obtained strains were cultured to a confluence on PDA plates (7 days), mycelia were scraped off and flash-frozen in liquid nitrogen. After thorough pre-cooling, they were ground in a grinder, and genomic DNA extraction was performed using a kit from TransGen Biotech. PCR amplification was performed using ITS universal primers (primers synthesized by Beijing Liuhe BGI), with a PCR reaction volume of 25 μL. The amplification program was as follows: 94℃ pre-denaturation for 5 minutes; followed by 35 cycles, each cycle including 94℃ denaturation for 30 seconds, 54℃ annealing for 30 seconds, and 72℃ extension for 59 seconds; a final extension at 72℃ for 5 minutes. After amplification, the products were sent to BGI for bidirectional sequencing. The sequencing results were assembled and compared with the NCBI database to identify the fungal species. The strain that matched *Fusarium graminearum* was selected as a reserve strain.

[0079] Using the above method, seven strains of Fusarium graminearum were isolated. Photos of the front and back of each strain are shown below. Figure 1 As shown, the upper layer is the front, and the lower layer is the back. Seven strains of Fusarium graminearum are... Figure 1 The numbers A through G are denoted as 56, 57, 120, 121, 209, 260, and 261, respectively. Among them, 56, 57, 120, and 121 are separated from Zhuozhou, Hebei, while 209, 260, and 261 are separated from Yongning, Ningxia.

[0080] (2) Prepare PDA culture media with different pH values ​​and inoculate with Fusarium graminearum:

[0081] Peel the potatoes and cut them into 1×1cm pieces. Boil them in water until soft, then filter through 8 layers of gauze. The filtered liquid was qualitatively analyzed, diluted to volume, and other culture medium components were added (see Table 1 for details). The pH of the PDA medium was adjusted to 4 and 7 (using sodium hydroxide and hydrochloric acid), then sterilized and plates were prepared. Fungal mycelia were inoculated into the center of the plates, with 8 replicates per treatment. The plates were sealed with sealing film and incubated at 28°C.

[0082] (3) qPCR identification of strains with different acid responses:

[0083] After culturing *Fusarium graminearum* in culture dishes at different pH treatments for 10 days, samples were collected. To avoid excessive error, the culture dishes were divided into four equal parts, and one portion was scraped from each dish into a 1.5 mL centrifuge tube. The scraped mycelium was flash-frozen in liquid nitrogen, thoroughly pre-cooled, and then ground in a grinder. Genomic DNA was extracted using a DNA extraction kit from TransGen Biotech (Beijing). This DNA was used for quantification of *Fusarium graminearum*. RNA was extracted using an RNA extraction kit from TransGen Biotech (Beijing). Subsequently, the RNA was reverse transcribed into cDNA using a reverse transcription kit from TransGen Biotech (Beijing). This cDNA was used to determine the expression level. The target gene was determined using primers: Tri13P1: 5'-CTCSACCGCATCG AAGASTCTC-3' (forward primer) and Tri13P2: 5'-GAASGTCGCARGACCTTGTTTC-3' (reverse primer). The Fusarium graminearum gene (FG-GAPDH-F:GTCCACTCCTACACT GCCAC, FG-GAPDH-R:GCCTCCTTGATGACCTGCTT) was used as an internal control gene. The PCR reaction mixture consisted of 5 μL of 2×Power Up™ SYBR™ GreenMaster Mix (Thermo Fisher Scientific), 0.8 μL of primers, 0.5 μL of cDNA, and 3.7 μL of water. PCR reactions were performed using an ABI QuantStudio 1 instrument (Applied Biosystems, USA). The PCR program was as follows: 40 cycles of pre-denaturation at 95°C for 30 s, denaturation at 95°C for 45 s, annealing at 54°C for 30 s, and extension at 72°C for 1 min, followed by a final extension at 72°C for 10 min. The relative expression levels of the genes were calculated using the 2-ΔΔCt method. Figure 2 As shown. Each PCR result was from at least 4 biological replicates, and the data are mean ± SD.

[0084] from Figure 2As can be seen, the relative gene expression levels of strains 56, 57, 120, 121, 209, 260, and 261 at pH=7 were 2.45, 1.28, 4.18, 1.02, 0.85, 1.45, and 0.95, respectively, while the relative gene expression levels at pH=4 were 1.00, 1.04, 0.52, 1.00, 2.53, 1.56, and 1.20, respectively. Strains 56, 57, 120, and 121 were inhibited under acid treatment, while strains 209, 260, and 261 were promoted under acid treatment. Strains 120 and 209 showed the most significant responses to different acids and were subsequently selected as representative strains for verification experiments.

[0085] (4) Toxin content detection: Mycelia of *Fusarium graminearum* (i.e., 120 and 209) cultured in petri dishes with different pH treatments for 10 days were collected and freeze-dried to constant weight in a freeze dryer. The freeze-drying conditions were: pre-freezing at -40℃, followed by freeze-drying under vacuum (<10 Pa) for 48 to 72 hours until constant weight was reached. The mycotoxins were then crushed with tweezers and weighed, and specific indicators were determined using appropriate kits. The mycotoxin (DON) content was detected using an ELISA kit (Jiangsu Enzyme Labeling Biotechnology Co., Ltd.).

[0086] The colors of mycelia 120 and 209 under different pH treatments are as follows: Figure 3 As shown, it can be seen that the mycelium of 120 is lighter in color under acid treatment, while the color of 209 is darker under acid treatment.

[0087] Expression levels of the DON synthesis gene (Tri13) in strains 120 and 209 are as follows: Figure 4 As shown, the DON content results are as follows: Figure 5 As shown, from Figure 4 and 5 It can be seen that acid treatment inhibits toxin production of 120, while acid treatment promotes toxin production of 209. In other words, 120 is low in toxicity and 209 is highly toxic in silage.

[0088] Experimental Example 1

[0089] Verification of the two bacterial strains 120 and 209 obtained in Example 1

[0090] (1) Transcriptome data validation: Fusarium graminearum cells 120 and 209 were collected after being treated at pH 4 and pH 7 for 10 days and then rapidly cryopreserved in liquid nitrogen. Subsequently, the samples were sent to MJZol Biotechnology Co., Ltd. for transcriptome sequencing, with three independent biological replicates for each sample. Total RNA was extracted using the MJZol total RNA extraction kit.

[0091] cDNA libraries were constructed using the Stranded mRNA Prep, Ligation method, and RNA-seq paired-end sequencing was performed using Illumina NovaSeqXPlus. The raw sequencing data were processed using FastP (v0.24.1) quality control software to remove adapter sequences and low-quality reads, retaining only clean reads determined based on Q20 and Q30. Bowtie2 (v2.5.4) software was used to align the clean reads to the Fusarium graminearum PH-1 reference genome and the Fusarium verticillioides 7600 reference genome sequences in the NCBI database. RSEM (v1.1.17) software was used to analyze gene expression levels in the sequencing data, with transcripts per million reads (TPM) as the quantitative indicator, and the results were normalized.

[0092] Differentially expressed genes were analyzed using DEseq2 (v1.48.0) software. The specific method was as follows: The fold change (FC) significance level Padj was calculated based on the average read count of each group, and the Benjamini-Hochberg (BH) multiple access correction method was applied to calculate the false discovery rate (FDR). Genes with |log2FC|>1, Padj≤0.05, and FDR≤0.05 were defined as significantly differentially expressed genes (DEGs). Based on the differentially expressed gene detection results, GO functional enrichment analysis and KEGG pathway enrichment analysis were performed. Pathways with Padj<0.05 were defined as significantly enriched pathways. KEGG annotation analysis results showed that, as... Figure 6 As shown.

[0093] according to Figure 6It was found that under acid treatment conditions, differentially expressed genes from different strains were mainly enriched in metabolic pathways, particularly carbohydrate and amino acid metabolism pathways, indicating that pH treatment primarily affects the basal metabolic activities of microorganisms. Among the top five pathways, strain 209 showed significantly higher enrichment of differentially expressed genes than strain 120, suggesting that strain 209 may have a more active metabolic regulatory capacity. Further analysis revealed significant enrichment of genes related to nucleotide metabolism, translation, transcription, chromosome structure, and protein folding, sorting, and degradation between pH 4_209 and pH 7_209. Notably, these genes were almost unannotated in strain 120. This finding reveals that strain 209 can activate a wider range of genetic information processing and protein processing pathways under acid stress, which may be the main reason for toxin production in strain 209 under acid stress. On the other hand, significant enrichment of genes related to xenobiotic biosynthesis and metabolism between pH 4_120 and pH 7_120 was observed. This pathway primarily involves the recognition, transformation, degradation, and excretion of exogenous harmful substances (such as toxins, pollutants, and drugs) by organisms. However, these genes were almost unannotated in strain 209, suggesting that strain 120 tends to respond to acid stress by activating detoxification and excretion mechanisms, consistent with the toxin inhibition observed in strain 120 under acid treatment. These results imply that strain 120 is low in toxicity, while strain 209 is highly toxic in silage.

[0094] Experiment Example 2

[0095] Inoculation of strains 120 and 209 into maize plants and silage verification

[0096] (1) Inoculation: 120 and 209 fungal spores were inoculated into mung bean liquid culture medium and cultured at 28℃ with shaking at 180 rpm for 5-7 days to induce abundant spore production. Subsequently, the spore suspension was filtered through a sterile single-layer gauze, the filtered liquid was centrifuged, the supernatant was discarded, and the spore concentration was diluted to 7.3 × 10⁻⁹ with sterile water. 4 -1.5×10 5 The concentration of cfu / mL is to be prepared. The specific inoculation method is as follows: Use a 1cm electric punch to make a hole at one-third of the length of the corn stalk segment. Draw 1mL of spore suspension and slowly inject it into the corn stalk through the hole. Inoculate once every 7 days, for a total of 2 inoculations. Observe the disease situation after 21 days. If all plants have developed the disease, the corn plant stalks will be used for silage production.

[0097] (2) Silage: The corn stalks of each treatment group (120, 209) were cut to 1-2 cm with a guillotine cutter. Each treatment had more than 50 plants. 500g of the mixture was filled into polyethylene bags (28cm×35cm), vacuum sealed with a vacuum sealer, and 4 replicates were prepared for each treatment (1 of which was reserved). The bags were opened and samples were taken at room temperature for different time periods of 0 and 60 days to measure various indicators.

[0098] (3) Toxin content detection: Take 100-200g of silage sample and freeze-dry it to constant weight in a freeze dryer. The freeze-drying conditions are: first pre-freeze at -40℃, then freeze-dry under vacuum (<10Pa) for 48 to 72 hours until constant weight is reached. Then pulverize and pass through a 1mm sieve for later use. The content of 18 toxins (including aflatoxin B1, aflatoxin B2, aflatoxin G1, aflatoxin G2, fumonisin B1, fumonisin B2, fumonisin B3, vomitoxin, ochratoxin A, 3-acetylvomitoxin, 15-acetylvomitoxin, novovulin, fumonisin X, T-2 toxin, HT-2 toxin, snake toxin, zearalenone, and solanacoximilin) ​​were detected by ultra-high performance liquid chromatography-tandem mass spectrometry.

[0099] The specific method is as follows: Weigh (10±0.1) g of the sample to be used into a 250 ml Erlenmeyer flask, add 100 ml of 50% acetonitrile aqueous solution, shake on a shaker (250 r / min) for 1 h, and filter at least 2 ml of filtrate. Transfer 2 mL of filtrate to a test tube and simultaneously add 100 μL of acetic acid, vortex to achieve an acetic acid concentration of 5%, mix well, transfer 750 μL of sample solution from the test tube to the lower end of a MycoSpin™ 400 multifunctional purification column, place it on a 2 mL centrifuge tube, and centrifuge at 10000 r / min for 1 min. After centrifugation, the filtrate remains in the centrifuge tube. Transfer 75 μL of sample solution from the centrifuge tube and add 75 μL of positive ion internal standard and 75 μL of negative ion internal standard, respectively, vortex for 20 s. After centrifugation at 10000 r / min for 3 min, transfer 120 μL of the positive and negative ion mixture to a sample vial with an inner liner, and inject the sample. The toxin detection results are shown in Table 2.

[0100] Table 2 Toxin Content Detection

[0101]

[0102] Note: SEM represents the standard error, and p-value represents the significance of the difference.

[0103] Table 2 shows that among the 18 toxins tested, only three were detected: fumonisin B2 (FUM B1), fumonisin B3 (FUM B2), and vomitoxin (DON). The contents of FUMB1 and FUMB1 in both raw materials and silage at 60 days were lower than the DON content, especially in silage inoculated with 120 and 209, with no significant difference. However, the DON content of 209 was consistently significantly higher than that of 120 in both raw materials and silage. This further demonstrates that 120 is low in toxicity and 209 is highly toxic in silage.

[0104] Experimental Example 3

[0105] After strains 120 and 209 reached confluence on PDA plates (7 days), mycelia were scraped, flash-frozen in liquid nitrogen, and thoroughly pre-cooled before being ground in a grinder. Genomic DNA extraction was performed using a kit from TransGen Biotech (Beijing). The selected specific primers were as follows: forward primer Tri13P1: 5'-CTCSACCGCATCGAAGAS TCTC-3', and reverse primer Tri13P2: 5'-GAASGTCGCARGACCTTGTTTC-3'. These primers were synthesized by Beijing Liuhe Huada Co., Ltd. PCR amplification was performed in a 25 μL system under the following conditions: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 54℃ annealing for 30 seconds, 72℃ extension for 59 seconds, for a total of 35 cycles; and a final extension at 72℃ for 5 minutes. After amplification, electrophoresis was performed on a 0.8% agarose gel to verify the results. The electrophoresis conditions were 140V, 95mA, and 40 minutes.

[0106] PCR amplification of the Tri13 gene showed that a 583 bp fragment produced a 15-AcDON chemotype, while a 644 bp fragment produced a 3-AcDON chemotype. PCR identification results ( Figure 7 The results showed that strain 120 was a 3-AcDON-producing Fusarium graminearum, while strain 209 was a 15-AcDON-producing Fusarium graminearum. Studies have shown that 15-AcDON has a more significant toxic effect when present with other toxins. This further demonstrates that strain 120 is low in toxicity and strain 209 is highly toxic under silage conditions.

[0107] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for screening Fusarium graminearum strains with low and high toxicity (DON) that respond to acidic silage environments, characterized in that, Includes the following steps: (1) Isolation and identification of Fusarium graminearum: Maize stalk rot samples were collected, disinfected on the surface, and then inoculated into a culture medium for purification and culture. Fusarium graminearum was identified by ITS sequence comparison. (2) Prepare PDA culture media with different pH values ​​and inoculate Fusarium graminearum: Adjust the pH values ​​of the two PDA culture media to 4 and 7 respectively, sterilize them to make plates, inoculate them with Fusarium graminearum obtained in step (1), and culture. (3) qPCR identification of strains with different acid responses: extract DNA and RNA from the hyphae of Fusarium graminearum cultured at two pH values ​​in step (2), and calculate the relative expression levels of different Fusarium graminearum genes based on the expression level of Tri13 gene and internal reference gene detected by qPCR to obtain strains with different acid responses. (4) Toxin content detection: Based on the different acid-responsive strains obtained in step (3), select two strains with the most obvious acid response, freeze-dry the two strains with the most obvious acid response, and detect the DON content to obtain Fusarium graminearum with low DON under acid response and Fusarium graminearum with high DON under acid response.

2. The method according to claim 1, characterized in that, In step (1), the collected corn stalk rot samples are cut into small tissue pieces of 0.5×0.5cm to ensure that each tissue piece contains the boundary between diseased and healthy tissue.

3. The method according to claim 1, characterized in that, In step (3), the internal reference gene sequences are as follows: FG-GAPDH-F:5'-GTCCACTCCTACACTGCCAC-3', FG-GAPDH-R:5'-GCCTCCTTGATGACCTGCTT-3'.

4. The method according to any one of claims 1-3, characterized in that, In step (4), the strain with the highest difference in relative gene expression under the two pH treatments is selected as the strain with the most obvious acid response.

5. The method according to any one of claims 1-3, characterized in that, In step (4), the DON content is detected using an ELISA kit.

6. The method according to any one of claims 1-3, characterized in that, In step (4), the Fusarium graminearum with low toxicity DON under acid response is Fusarium graminearum FG-HB-CSR120-3AcDON with preservation number CGMCC No.41887; The Fusarium graminearum strain that exhibits high DON toxicity under acid response is Fusarium graminearum FG-NX-CSR209-15AcDON, with preservation number CGMCC No.41888.

7. The preparation method according to claim 6, characterized in that, The acid-responsive Fusarium graminearum with low DON toxicity contains the 16S rDNA shown in SEQ ID NO.1, and the acid-responsive Fusarium graminearum with high DON toxicity contains the 16S rDNA shown in SEQ ID NO.

2.

8. A Fusarium graminearum FG-HB-CSR120-3AcDO N strain exhibiting low toxicity of DON under acidic silage conditions, with preservation number CGMCCNo.41887.

9. A Fusarium graminearum strain FG-NX-CSR209-15AcDO N exhibiting high toxicity to DON under acidic silage conditions, with preservation number CGMCCNo.41888.

10. The application of Fusarium graminearum as described in claim 8 or 9 in the control of toxins in silage.

Images