Primer group and kit for detecting sheep functional genes based on multiple fluorescent ARMS-PCR

Abstract

The invention belongs to the technical field of biological detection, and particularly relates to a primer group and a kit for detecting sheep functional genes based on multiple fluorescent ARMS-PCR. Target sites detected by the primer group comprise one or more of TBXT (Tetramethylbenzidine), EDAR (Ethylene Diamine Tetraacetic Acid), KRT74, MTNR1A (Methyltransferase Nucleic Acid 1A), ASIP (Accelerated Solvent Induced Protein), FecB, BMP2, SOCS2, FGF5 (Fibroblast Growth Factor Receptor), TSHR (Total Split Hormone Receptor), IBH (Infectious Business Hormone) According to the primer group, the kit and the method for detecting the sheep functional genes through the multiple fluorescent ARMS-PCR, provided by the invention, single-tube multi-site joint detection can be realized, and the detection flux is improved by 40 times. The method based on the fluorescent ARMS PCR is fast in detection, low in cost, extremely high in accuracy and suitable for large-scale sample detection.

Description

Technical Field

[0001] This invention belongs to the field of gene detection service technology, specifically, it relates to a primer set and kit for detecting sheep functional genes based on multiplex fluorescent ARMS-PCR. Background Technology

[0002] Reproductive performance, wool yield, coat color, meat production performance, muscle quality, and fat tail content are important economic traits in sheep, directly impacting their economic benefits. Economically relevant traits in sheep (such as litter size, growth rate, meat quality, wool quality, and disease resistance) are mostly dominated by or closely related to major genes. Detecting major genes allows for targeted selection and mating, which is crucial for improving breeding efficiency, reducing farming costs, and promoting industry upgrading.

[0003] Currently, major genes affecting these traits have been reported. Genetic testing provides direct molecular genetic information for sheep breeding, enabling accurate prediction of sheep traits at an early stage. This avoids errors and uncertainties caused by environmental factors in traditional breeding methods, improving the accuracy and efficiency of selection and accelerating the development of superior breeds. Studies have shown that ewes carrying the BMPR1B gene (FecB mutation), which is related to fertility, have an average increased litter size of 1-2 lambs. Mutations in the MSTN gene (myosin inhibitor), which regulates muscle growth, can significantly increase lean meat percentage and growth rate in sheep (e.g., in "double-muscle" sheep breeds).

[0004] Currently reported methods for gene detection mainly include PCR single-strand conformation polymorphism, allele-specific PCR, PCR restriction fragment length polymorphism, competitive allele-specific PCR (KASP), TaqMan probes and high-resolution melting curves, first-generation sequencing, and second-generation sequencing. However, these detection methods have drawbacks to varying degrees, such as high development difficulty, complex operation, high cost, low accuracy, low throughput, long detection cycle, and incomplete site coverage, which are not conducive to large-scale population detection. Summary of the Invention

[0005] The purpose of this invention is to provide a primer set and kit for detecting sheep functional genes based on multiplex fluorescent ARMS-PCR. This invention is based on a detection method combining fluorescent ARMS PCR and capillary electrophoresis. This method is simple to operate, can detect up to 40 genetic marker sites in a single reaction, has high accuracy, and can be used for large-scale detection of sheep economic benefit genes.

[0006] Therefore, the present invention provides the following technical solution.

[0007] One aspect of the present invention provides a primer set for detecting sheep functional genes based on multiplex fluorescent ARMS-PCR, wherein the target sites detected by the primer set include one or more of TBXT, EDAR, KRT74, MTNR1A, ASIP, FecB, BMP2, SOCS2, FGF5, TSHR, IBH, MC1R, and HOXB13.

[0008] In a preferred embodiment of the present invention, the target sites detected by the primer set include TBXT, EDAR, KRT74, MTNR1A, ASIP, FecB, BMP2, SOCS2, FGF5, TSHR, IBH, MC1R, and HOXB13.

[0009] In a preferred embodiment of the present invention, the nucleotide sequences of the primer set are one or more as shown in SEQ ID NO: 1-39.

[0010] In a preferred embodiment of the present invention, the nucleotide sequence of the primer set is shown in SEQ ID NO: 1-39.

[0011] A second aspect of the invention provides the use of the primer set as described above in the preparation of a product for detecting sheep functional genes based on multiplex fluorescent ARMS-PCR.

[0012] In a preferred embodiment of the invention, the product comprises a reagent kit.

[0013] A third aspect of the present invention provides a kit for detecting sheep functional genes based on multiplex fluorescent ARMS-PCR, characterized in that the kit comprises the primer set as described above.

[0014] In a preferred embodiment of the present invention, the concentration of each primer in the kit is 0.13-0.25 µmol / L.

[0015] In a preferred embodiment of the present invention, the kit further comprises amplification reagents and DNA extraction reagents.

[0016] A fourth aspect of the present invention provides a method for detecting sheep functional genes based on multiplex fluorescent ARMS-PCR for non-disease diagnosis or treatment purposes, the method comprising the step of using the primer set or kit as described above for detection.

[0017] By employing the above technical solution, the present invention has at least the following advantages: This invention utilizes a single-tube amplification method to simultaneously detect 13 loci. The detection method is simple, rapid, low-cost, and highly accurate. Furthermore, the detection loci cover 13 marker loci affecting economic traits in meat sheep, aiming to provide a comprehensive, efficient, and feasible detection system for sheep trait improvement.

[0018] The primer set, kit, and method for detecting sheep functional genes using multiplex fluorescent ARMS-PCR provided by this invention enable single-tube, multi-site joint detection, increasing detection throughput by 40 times. This fluorescent ARMS-PCR-based method offers rapid detection, low cost, and extremely high accuracy, making it suitable for large-scale sample testing.

[0019] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention and to implement it in accordance with the contents of the specification, the preferred embodiments of the present invention are described in detail below. Attached Figure Description

[0020] Figure 1 This is a sample detection result diagram of Embodiment 2 of the present invention. Detailed Implementation

[0021] To make the technical means, creative features, achieved objectives, and effects of this invention readily understandable, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are merely some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0022] Example 1: Primer Design and Optimization Primer design The primers described in this invention were designed using Primer5 software, and their specificity was compared using the NCBI website (https: / / www.ncbi.nlm.nih.gov). The primer fragment size was designed to be in the range of 70-500 bp, and the Tm value was controlled at (60±2)℃.

[0023] Thirteen primer pairs were used for single amplification of sheep genomic DNA. Capillary electrophoresis was used to check the amplification efficiency of each primer pair and the presence of non-specific fragments. If low efficiency or the presence of non-specific fragments was observed, primers needed to be replaced or PCR amplification conditions optimized until the efficiency of all 13 primer pairs was approximately consistent and no non-specific fragments were produced.

[0024] Primer pair composition: TBXT, EDAR, KRT74, MTNR1A, ASIP, FecB, BMP2, SOCS2, FGF5, TSHR, IBH, MC1R, HOXB13.

[0025] The final 13 primer pairs obtained are shown in Table 1 below:

[0026] Table 1 Primer Information

[0027]

[0028]

[0029] Primer concentration optimization in composite system The primer groups shown in Table 1 above are divided into three groups of fluorescently labeled primers, each group using a different fluorescent dye. Preferably, the first group of labeled primers (SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:18) uses FAM as the fluorescent dye; the second group of labeled primers (SEQ ID NO:19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34) uses HEX as the fluorescent dye; and the third group of labeled primers (SEQ ID NO:39) uses ROX as the fluorescent dye. Genotyping of multiple labeled sites is achieved by varying the fluorescence and PCR amplification product length. The specific grouping is shown in Table 2 below.

[0030] Table 2 Fluorescence grouping

[0031] Based on the above grouping, after completing the single primer screening and design, the single primers were mixed according to the grouping and subjected to multiplex amplification to adjust the primer concentration. During the initial multiplex amplification, equimolar amounts of primers should be added to the reaction system, and then the concentration ratio of each primer pair should be adjusted according to the reaction results. Finally, through extensive screening experiments, the primer sequences and optimal concentrations were determined, as shown in Table 3 below:

[0032] Table 3 Primer Concentration Locus Sequence Final concentration of primer in PCR multiplex amplification system (μmol / L) TBXT-R GCCATGTACTCCTTCCTGC 0.13 TBXT-WF GCTCTGGCTTGCCCGC 0.13 TBXT-MF1 ttaGGCTCTGGCTTGCCGCA 0.13 EDAR-R ACTAGATTCAAGCTCCTGGCC 0.13 EDAR-WF2 AGCCTGTGCATTCCCTTCACT 0.13 EDAR-MF gtatAGCCTGTGCATTCCCTTCAAC 0.13 KRT74-R TGAAGGAGGCGAACTTGTTGT 0.13 KRT74-WF ATCCACCAGGTCGTCGTGC 0.13 KRT74-MF ATATATCCACCAGGTCGTCGTTA 0.13 MTNR1A-F CAGCAAATGGCAAAGAGGACA 0.13 MTNR1A-WR1 AGTTCCGATGCTCGTAGGCG 0.13 MTNR1A-MR GTATAGTTCCGATGCTCGTAGTGA 0.13 ASIP-F TAGTCCGAGGAGTTCCCAGG 0.13 ASIP-WR GGGTTGAGCACGCGGTA 0.13 ASIP-MR1 AATAGGGTTGAGCACGCGTCT 0.13 FecB-WF TTCATGCCTCATCAACACCGTAT 0.13 FecB-MF TGCCTCATCAACACCGACC 0.13 FecB-R GCCACCTCGGAAACCCATAT 0.13 BMP2-F TGCACTTCTTTGGAGCAGGA 0.2 BMP2-WR GTTAGACACTTTCCCTTTCTAATTCG 0.2 BMP2-MR ATAAGTTAGACACTTTCCCTTTCTAAATTT 0.2 SOCS2-R CAGAGGTGGTGCTGATGTGT 0.2 SOCS2-WF GAGCTGGACCAACTAATCGTC 0.2 SOCS2-MF2 GTATGAGCTGGACCAACTAATCTGC 0.2 FGF5-R GCTGTGTCCAAGAAGTTGCC 0.2 FGF5-WF ATTCAAGCAATCGGAGCAGACA 0.2 FGF5-MF AAGCAATCGGAGCAGGCG 0.2 TSHR-R GTAACAGGCACAGACGATGATAA 0.2 TSHR-WF AATTCTTCACCGTCTTTGCCAAC 0.2 TSHR-MF CTTCACCGTCTTTGCCTGG 0.2 IBH-R CCCACTTGACTTCCCACTCC 0.2 IBH-WF GATCTTCCTGACCCACGG 0.2 IBH-MF AAACGATCTTCCTGACCCAGCA 0.2 MC1R-R GTGTGGTTGTAGTAGGTGATGG 0.2 MC1R-WF CAACCTGCACTCCCCGAT 0.2 MC1R-MF AATTCAACCTGCACTCCCCAAA 0.2 HOXB13-WF GATTTTATGAGCTTCTCTCCGCC 0.25 HOXB13-MF GTAGCATGTGGGATCTAGCTCCC 0.25 HOXB13-R CGCCGTCCAAAGTGGTATAATTG 0.25

[0033] Example 2: Detection of sheep economic benefit genes using multiplex fluorescent ARMS-PCR method based on functional locus genotyping in sheep. (1) Collect sheep blood samples; (2) DNA extraction: Genomic DNA was extracted from sheep blood samples using the Tiangen "Blood Genomic DNA Extraction Kit". The concentration and quality of DNA were detected using a NanoDrop 2000 nucleic acid quality analyzer and 1% agarose gel electrophoresis.

[0034] (3) Configure the reaction system After vortexing all reaction reagents (2.5×PCR Mix, primer mixture, and nuclease-free purified water), prepare the PCR reaction mixture according to the volume ratio (except for the template). Aliquot 9 μL into PCR reaction tubes. Finally, add 1 μL of DNA template to each reaction tube, centrifuge, and proceed to the next step of PCR amplification. The composition of the reaction system is shown in Table 4 below:

[0035] Table 4 Reaction System Component Name Volume (μL) 2.5×PCR Mix 4 primer mixture 1 Nuclease-free pure water 4 DNA template 1 Total volume 10 (4) Set up the PCR reaction program: Place the PCR reaction tubes on the amplification instrument and design and run the following program: Step 1: Denaturation at 95℃ for 5 minutes; Step 2: Denaturation at 95℃ for 10 seconds; Step 3: Annealing at 58℃ for 2 minutes; repeat steps 2 and 3 30 times; Step 4: Extension at 60℃ for 45 minutes. After the PCR program is completed, the obtained PCR amplification products can be immediately used for subsequent detection; or stored at 2~8℃ and detected within 24 hours; or stored at -20℃ and detected within three days. Please avoid repeated freeze-thaw cycles as much as possible, or the number of freeze-thaw cycles should not exceed 3.

[0036] (5) Capillary electrophoresis detection Take 1 μL of the PCR amplification product obtained above (original solution or diluted product), add 8.8 μL of HIDI and 0.2 μL of LIZ500, mix and let stand for a few minutes, then denature at 95℃ for 3 minutes, immediately in an ice bath for 3 minutes, centrifuge and place on an ABI 3730 sequencer for detection.

[0037] (6) Data Analysis After detection, Genemapper 6.0 was used to interpret the genotyping results. Panels and bins were set according to the product fragment size, and the genotyping of each site was determined based on the peak position and fluorescence color. Results are shown below. Figure 1 .

[0038] like Figure 1As shown, the genotyping results of the samples are as follows: TBXT, wild type (W / W); EDAR, wild type (W / W); KRT74, heterozygous mutant (W / M); MTNR1A, wild type (W / W); ASIP, heterozygous mutant (W / M); FecB, wild type (W / W); BMP2, heterozygous mutant (W / M); SOCS2, wild type (W / W); FGF5, heterozygous mutant (W / M); TSHR, homozygous mutant (M / M); IBH, heterozygous mutant (W / M); MC1R, wild type (W / W); HOXB, heterozygous mutant (W / M).

[0039] Example 3: Species-specificity verification Peripheral blood samples were collected from five common animal species (human, dog, pig, cow, and cat). Genomic DNA was extracted from the blood samples according to the method described in Example 2 above. Multiplex fluorescent ARMS-PCR amplification was performed on the DNA from each sample using the primers and concentrations specified in Table 3 and the reaction system and procedure specified in Table 4. The amplified products were detected by capillary electrophoresis to verify species specificity; each sample was tested three times. The results showed no non-specific DNA was generated after multiple experiments, indicating that the primers and concentrations specified in Table 3 and the reaction system and procedure specified in Table 4 of this invention can only specifically identify sheep DNA samples and cannot detect DNA samples from other common animal species (human, dog, pig, cow, and cat). This demonstrates that the kit of this invention has superior specificity.

[0040] Example 4: Sensitivity Detection Based on molecular cloning technology, recombinant plasmids for 13 sheep functional genes (TBXT, EDAR, KRT74, MTNR1A, ASIP, FecB, BMP2, SOCS2, FGF5, TSHR, IBH, MC1R, and HOXB13) were constructed using plasmid pMD18-T as a vector and served as positive standards for testing samples. Taking recombinant plasmid pMD18-TBXT as an example, its specific preparation process includes: using sheep positive nucleic acid as a template, PCR amplification was performed to obtain the target fragment including the TBXT nucleic acid sequence. The PCR product was electrophoresed and then purified by gel extraction to obtain the purified target fragment. The purified target fragment was inserted into the pMD18-T vector (TaKaRa) and then transformed into E. coli DH5α to obtain recombinant E. coli containing the target gene recombinant plasmid pMD18-TBXT. Cultures of *E. coli* containing the recombinant plasmid were plated onto LB agar plates containing Amp and incubated overnight at 37°C. Positive colonies were then screened, and some positive strains were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing verification. Subsequently, bacterial cultures containing the positive recombinant plasmid pMD18-TBXT were incubated overnight at 37°C. The pMD18-TBXT plasmid was extracted using a plasmid mini-extraction kit (Tiangen Biotech, China). The plasmid concentration was determined using a NanoDrop 2000c, and the copy number of the target gene was calculated. pMD18-TBXT plasmid DNA was extracted and purified according to the kit instructions and stored at -20°C for later use. The methods for other recombinant plasmids were the same and will not be described further here.

[0041] First, six concentration gradients were set up for the DNA samples to be tested: 10 ng / μL, 5 ng / μL, 2 ng / μL, 1 ng / μL, 0.5 ng / μL, and 0.2 ng / μL. PCR amplification was performed according to the primers and concentrations determined in Table 3 and the reaction system and procedure in Table 4. Each sample was tested three times. The amplification products were detected by capillary electrophoresis. The capillary electrophoresis loading buffer was prepared with Liz500:Hi-Di at a ratio of 2.5:97.5; the PCR amplification products were loaded with the capillary electrophoresis loading buffer at a ratio of 1:9; after electrophoresis, the data were exported.

[0042] The detection results for each gene are shown in Table 5.

[0043] Table 5. Detection results of each gene Gene 10 ng / μL 5 ng / μL 2 ng / μL 1 ng / μL 0.5 ng / μL 0.2 ng / μL TBXT Detected Detected Detected Detected Detected Not detected EDAR Detected Detected Detected Detected Not detected Not detected KRT74 Detected Detected Detected Detected Detected Not detected MTNR1A Detected Detected Detected Detected Detected Detected ASIP Detected Detected Detected Detected Not detected Not detected FecB Detected Detected Detected Detected Detected Not detected BMP2 Detected Detected Detected Detected Detected Not detected SOCS2 Detected Detected Detected Detected Not detected Not detected FGF5 Detected Detected Detected Detected Detected Detected TSHR Detected Detected Detected Detected Detected Not detected IBH Detected Detected Detected Detected Detected Not detected MC1R Detected Detected Detected Detected Not detected Not detected HOXB13 Detected Detected Detected Detected Detected Not detected The results in Table 5 show that all genes could be detected at a DNA template concentration of 1 ng / μL, while only a portion could be detected at a concentration of 0.5 ng / μL. Therefore, the detection limit of the kit of this invention is 1 ng / μL, exhibiting high sensitivity.

[0044] Example 5: Accuracy Verification Twenty sheep peripheral blood samples were randomly selected, and genomic DNA was extracted according to the method described in Example 2. Multiplex fluorescent ARMS-PCR amplification was performed using the primers and concentrations determined in Table 3 and the reaction system and procedure in Table 4. The amplification products were then detected by capillary electrophoresis: a capillary electrophoresis loading buffer was prepared with a Liz500:Hi-Di ratio of 2.5:97.5; the PCR amplification products were loaded with the capillary electrophoresis loading buffer at a ratio of 1:9; after electrophoresis, the data were exported. Additionally, the 20 blood samples were sequenced using Sanger sequencing.

[0045] Results analysis and interpretation: 0 represents wild-type homozygote; 1 represents heterozygote; 2 represents mutant homozygote.

[0046] The detection results obtained by the method of the present invention were compared and verified with the Sanger sequencing results. The capillary electrophoresis detection results are shown in Table 6, and the Sanger sequencing results are shown in Table 7.

[0047] Table 6. Verification results of the accuracy of capillary electrophoresis detection Sample number TBXT EDAR KRT74 MTNR1A ASIP FecB BMP2 SOCS2 FGF5 TSHR IBH MC1R HOXB13 D01 1 0 2 0 1 1 0 1 2 1 2 1 0 D02 0 1 0 0 0 1 0 1 0 1 1 1 0 D03 0 2 1 1 1 0 2 1 1 1 2 0 1 D04 2 0 1 1 0 0 2 1 0 1 2 1 1 D05 1 1 2 1 1 1 0 1 2 1 2 1 1 D06 1 1 0 1 0 0 1 1 0 1 1 0 1 D07 2 2 1 1 0 1 1 0 0 1 1 0 2 D08 1 0 1 1 0 1 0 0 1 0 2 0 1 D09 0 1 1 2 1 1 2 0 1 1 1 1 2 D10 1 0 1 1 0 1 1 0 1 0 1 0 1 D11 1 2 1 0 1 0 2 1 1 1 0 1 0 D12 2 1 1 2 1 1 1 1 0 1 1 2 1 D13 1 0 2 0 2 1 0 1 1 0 0 1 2 D14 0 0 1 0 0 0 1 1 1 0 1 1 0 D15 0 2 1 2 1 2 1 2 0 1 1 0 2 D16 0 1 1 1 1 0 1 0 0 1 1 1 0 D17 2 1 1 0 1 1 0 1 1 2 1 0 1 D18 1 2 2 1 1 1 1 2 1 1 2 1 1 D19 1 2 1 1 0 1 0 1 1 0 0 1 2 D20 1 1 2 0 0 1 1 2 1 2 0 0 0

[0048] Table 7. Validation results of the accuracy of Sanger sequencing. Sample number TBXT EDAR KRT74 MTNR1A ASIP FecB BMP2 SOCS2 FGF5 TSHR IBH MC1R HOXB13 D01 1 0 2 0 1 1 0 1 2 1 2 1 0 D02 0 1 0 0 0 1 0 1 0 1 1 1 0 D03 0 2 1 1 1 0 2 1 1 1 2 0 1 D04 2 0 1 1 0 0 2 1 0 1 2 1 1 D05 1 1 2 1 1 1 0 1 2 1 2 1 1 D06 1 1 0 1 0 0 1 1 0 1 1 0 1 D07 2 2 1 1 0 1 1 0 0 1 1 0 2 D08 1 0 1 1 0 1 0 0 1 0 2 0 1 D09 0 1 1 2 1 1 2 0 1 1 1 1 2 D10 1 0 1 1 0 1 1 0 1 0 1 0 1 D11 1 2 1 0 1 0 2 1 1 1 0 1 0 D12 2 1 1 2 1 1 1 1 0 1 1 2 1 D13 1 0 2 0 2 1 0 1 1 0 0 1 2 D14 0 0 1 0 0 0 1 1 1 0 1 1 0 D15 0 2 1 2 1 2 1 2 0 1 1 0 2 D16 0 1 1 1 1 0 1 0 0 1 1 1 0 D17 2 1 1 0 1 1 0 1 1 2 1 0 1 D18 1 2 2 1 1 1 1 2 1 1 2 1 1 D19 1 2 1 1 0 1 0 1 1 0 0 1 2 D20 1 1 2 0 0 1 1 2 1 2 0 0 0 As shown in Tables 6 and 7, the method of this invention is consistent with the results of Sanger sequencing, and its detection accuracy reaches 100%.

[0049] Example 6: Repeatability Detection Ten sheep peripheral blood samples with even-numbered labels (D02, D04, D06, D08, D10, D12, D14, D16, D18, and D20) were selected for repeatability verification. Genomic DNA was extracted according to the method described in Example 2, and multiplex fluorescent ARMS-PCR amplification was performed on DNA samples with a concentration of 10 ng / μL using the primers and concentrations determined in Table 3 and the reaction system and reaction procedure in Table 4. The intra-batch and inter-batch repeatability of the kit of this invention were tested. Intra-batch repeatability: the same batch was repeated three times, and the experimental results are shown in Tables 8-10; inter-batch repeatability: the above samples were tested three times in three separate tests, and the results are shown in Tables 11-13.

[0050] Table 8. Results of Intra-Batch Repeatability Validation Sample number TBXT EDAR KRT74 MTNR1A ASIP FecB BMP2 SOCS2 FGF5 TSHR IBH MC1R HOXB13 D02 0 1 0 0 0 1 0 1 0 1 1 1 0 D04 2 0 1 1 0 0 2 1 0 1 2 1 1 D06 1 1 0 1 0 0 1 1 0 1 1 0 1 D08 1 0 1 1 0 1 0 0 1 0 2 0 1 D10 1 0 1 1 0 1 1 0 1 0 1 0 1 D12 2 1 1 2 1 1 1 1 0 1 1 2 1 D14 0 0 1 0 0 0 1 1 1 0 1 1 0 D16 0 1 1 1 1 0 1 0 0 1 1 1 0 D18 1 2 2 1 1 1 1 2 1 1 2 1 1 D20 1 1 2 0 0 1 1 2 1 2 0 0 0

[0051] Table 9. Results of Intra-Batch Repeatability Validation Sample number TBXT EDAR KRT74 MTNR1A ASIP FecB BMP2 SOCS2 FGF5 TSHR IBH MC1R HOXB13 D02 0 1 0 0 0 1 0 1 0 1 1 1 0 D04 2 0 1 1 0 0 2 1 0 1 2 1 1 D06 1 1 0 1 0 0 1 1 0 1 1 0 1 D08 1 0 1 1 0 1 0 0 1 0 2 0 1 D10 1 0 1 1 0 1 1 0 1 0 1 0 1 D12 2 1 1 2 1 1 1 1 0 1 1 2 1 D14 0 0 1 0 0 0 1 1 1 0 1 1 0 D16 0 1 1 1 1 0 1 0 0 1 1 1 0 D18 1 2 2 1 1 1 1 2 1 1 2 1 1 D20 1 1 2 0 0 1 1 2 1 2 0 0 0

[0052] Table 10 Results of Intra-Batch Repeatability Validation Sample number TBXT EDAR KRT74 MTNR1A ASIP FecB BMP2 SOCS2 FGF5 TSHR IBH MC1R HOXB13 D02 0 1 0 0 0 1 0 1 0 1 1 1 0 D04 2 0 1 1 0 0 2 1 0 1 2 1 1 D06 1 1 0 1 0 0 1 1 0 1 1 0 1 D08 1 0 1 1 0 1 0 0 1 0 2 0 1 D10 1 0 1 1 0 1 1 0 1 0 1 0 1 D12 2 1 1 2 1 1 1 1 0 1 1 2 1 D14 0 0 1 0 0 0 1 1 1 0 1 1 0 D16 0 1 1 1 1 0 1 0 0 1 1 1 0 D18 1 2 2 1 1 1 1 2 1 1 2 1 1 D20 1 1 2 0 0 1 1 2 1 2 0 0 0

[0053] Table 11 Results of inter-batch repeatability verification Sample number TBXT EDAR KRT74 MTNR1A ASIP FecB BMP2 SOCS2 FGF5 TSHR IBH MC1R HOXB13 D02 0 1 0 0 0 1 0 1 0 1 1 1 0 D04 2 0 1 1 0 0 2 1 0 1 2 1 1 D06 1 1 0 1 0 0 1 1 0 1 1 0 1 D08 1 0 1 1 0 1 0 0 1 0 2 0 1 D10 1 0 1 1 0 1 1 0 1 0 1 0 1 D12 2 1 1 2 1 1 1 1 0 1 1 2 1 D14 0 0 1 0 0 0 1 1 1 0 1 1 0 D16 0 1 1 1 1 0 1 0 0 1 1 1 0 D18 1 2 2 1 1 1 1 2 1 1 2 1 1 D20 1 1 2 0 0 1 1 2 1 2 0 0 0

[0054] Table 12 Results of inter-batch repeatability verification Sample number TBXT EDAR KRT74 MTNR1A ASIP FecB BMP2 SOCS2 FGF5 TSHR IBH MC1R HOXB13 D02 0 1 0 0 0 1 0 1 0 1 1 1 0 D04 2 0 1 1 0 0 2 1 0 1 2 1 1 D06 1 1 0 1 0 0 1 1 0 1 1 0 1 D08 1 0 1 1 0 1 0 0 1 0 2 0 1 D10 1 0 1 1 0 1 1 0 1 0 1 0 1 D12 2 1 1 2 1 1 1 1 0 1 1 2 1 D14 0 0 1 0 0 0 1 1 1 0 1 1 0 D16 0 1 1 1 1 0 1 0 0 1 1 1 0 D18 1 2 2 1 1 1 1 2 1 1 2 1 1 D20 1 1 2 0 0 1 1 2 1 2 0 0 0

[0055] Table 13 Results of inter-batch repeatability verification Sample number TBXT EDAR KRT74 MTNR1A ASIP FecB BMP2 SOCS2 FGF5 TSHR IBH MC1R HOXB13 D02 0 1 0 0 0 1 0 1 0 1 1 1 0 D04 2 0 1 1 0 0 2 1 0 1 2 1 1 D06 1 1 0 1 0 0 1 1 0 1 1 0 1 D08 1 0 1 1 0 1 0 0 1 0 2 0 1 D10 1 0 1 1 0 1 1 0 1 0 1 0 1 D12 2 1 1 2 1 1 1 1 0 1 1 2 1 D14 0 0 1 0 0 0 1 1 1 0 1 1 0 D16 0 1 1 1 1 0 1 0 0 1 1 1 0 D18 1 2 2 1 1 1 1 2 1 1 2 1 1 D20 1 1 2 0 0 1 1 2 1 2 0 0 0 The intra-batch and inter-batch repeatability test results in Table 8-13 above show that the kit of the present invention has good stability. No non-specific generation and stable signal intensity were observed in multiple intra-batch and inter-batch repeated experiments.

[0056] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the methods and techniques disclosed above without departing from the scope of the present invention to create equivalent embodiments. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A primer set for detecting sheep functional genes based on multiplex fluorescent ARMS-PCR, characterized in that, The target sites detected by the primer set include one or more of TBXT, EDAR, KRT74, MTNR1A, ASIP, FecB, BMP2, SOCS2, FGF5, TSHR, IBH, MC1R, and HOXB13.

2. The primer set according to claim 1, characterized in that, The target sites detected by the primer set include TBXT, EDAR, KRT74, MTNR1A, ASIP, FecB, BMP2, SOCS2, FGF5, TSHR, IBH, MC1R, and HOXB13.

3. The primer set according to claim 1, characterized in that, The nucleotide sequences of the primer set are one or more as shown in SEQ ID NO: 1-39.

4. The primer set according to claim 3, characterized in that, The nucleotide sequence of the primer set is shown in SEQ ID NO: 1-39.

5. The application of the primer set according to any one of claims 1-4 in the preparation of products for detecting sheep functional genes based on multiplex fluorescent ARMS-PCR.

6. The application according to claim 5, characterized in that, The product includes a reagent kit.

7. A kit for detecting sheep functional genes based on multiplex fluorescent ARMS-PCR, characterized in that, The kit comprises the primer set as described in any one of claims 1-4.

8. The reagent kit according to claim 7, characterized in that, The concentration of each primer in the kit is 0.13-0.25 µmol / L.

9. The reagent kit according to claim 7, characterized in that, The kit also includes amplification reagents and DNA extraction reagents.

10. A method for detecting sheep functional genes based on multiplex fluorescent ARMS-PCR for non-disease diagnosis or treatment purposes, characterized in that, The method includes the step of detection using the primer set as described in any one of claims 1-4 or the kit as described in any one of claims 7-8.

Images