InDel molecular marker for identifying sal-family wild pseudosciaena crocea population and application of InDel molecular marker

By developing an identification method based on InDel molecular markers, using multiplex PCR and capillary electrophoresis, six InDel sites were screened, primer sets were designed and detected, solving the identification problem of wild large yellow croaker from Naozhou group, and realizing rapid and accurate germplasm resource identification and assisted breeding.

CN120924692AActive Publication Date: 2025-11-11SOUTHERN MARINE SCIENCE & ENGINEERING GUANGDONG LABORATORY (ZHANJIANG)
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511465731.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-14
Publication Date
2025-11-11
Estimated Expiration
2045-10-14

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately distinguish wild large yellow croaker from other large yellow croaker populations, leading to difficulties in germplasm resource identification.

Method used

We developed an identification method based on InDel molecular markers. Using multiplex PCR and capillary electrophoresis, we screened out six InDel sites on five chromosomes, designed primer sets and performed detection, and combined the maximum likelihood estimation method for population typing.

Benefits of technology

It enables rapid and accurate identification of wild large yellow croaker from Naozhou, improving identification effectiveness and detection throughput. It is applicable to various genetic analysis instruments and supports efficient germplasm resource identification and assisted breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120924692A_ABST
    Figure CN120924692A_ABST
Patent Text Reader

Abstract

The invention discloses an InDel molecular marker for identifying a sal ammoniac wild pseudosciaena crocea population and application of the InDel molecular marker. The InDel molecular marker comprises InDel3-47980327, InDel13-30626931, InDel14-14131930, InDel16-3391547, InDel16-3393826 and InDel17-8655298, and is characterized in that the InDel molecular marker comprises InDel3-47980327, InDel13-30626931, InDel14-14131930, InDel16-3391547, InDel16-3393826 and InDel17- The invention also discloses a primer group for amplifying the InDel molecular marker, a kit containing the primer group, a method for identifying a sal-family wild pseudosciaena crocea group by using the primer group or the kit, and application of the primer group, the kit or the method in identification of the sal-family wild pseudosciaena crocea group. According to the marker and the method, the identification effectiveness of the sal wild pseudosciaena crocea is greatly improved, the typing is more effective, the operation is faster, the detection flux is higher, and meanwhile, the accuracy is higher.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of fish genetic identification technology, specifically relating to an InDel molecular marker for identifying wild large yellow croaker populations of the Naozhou group and its application. Background Technology

[0002] Large yellow croaker ( Larimichthys crocea It belongs to the order Perciformes, family Sciaenidae, and genus *Cichlidae*. Larimichthys The large yellow croaker, also known as yellow croaker, is a warm-temperate migratory fish that lives in the northwestern Pacific Ocean.

[0003] Resequencing is a bioinformatics method that involves obtaining the genome sequence information of an organism, comparing it with existing genomes, and identifying differences in sequence information to explore the organism's genetics, evolution, and biological characteristics. In recent years, whole-genome resequencing has been increasingly applied to various vertebrates, such as the Korean cattle (Korean cattle). Bos taurus var. coreana , Lee K.-T., Chung W.-H., Lee S.-Y., et al.Whole-genome resequencing of Hanwoo (Koreancattle) and insight into regions of homozygosity[J]. Bmc Genomics, 2013,14, domestic pig ( Sus scrofa var. domesticus , Moon S., Kim T.-H., Lee K.-T., et al.A genome-widescan for signatures of directional selection in domesticated pigs[J].BmcGenomics, 2015,16), jungle fowl ( Gallus gallus In population genetic studies of vertebrates such as Yi G., Qu L., Liu J., et al. Genome-wide patterns of copy number variation in the diversified chicken genomes using next-generation sequencing[J]. Bmc Genomics, 2014, 15), whole-genome resequencing is increasingly used in fish, including carp (…). Cyprinus carpio, Xu P., Zhang X., Wang selection[J].Bmc Genomics,2016,17(1): 610), goldfish ( Carassius auratus Chen D., Zhang Q., Tang W., et al. The evolutionary origin and domestication history of goldfish (Carassius auratus)[J]. Proc Natl Acad Sci USA, 2020, 117(47):29775-29785. Researchers used whole-genome resequencing to analyze the population structure and evolutionary history of fish, and elucidated the molecular mechanisms of fish genetic traits by screening candidate genes and population genome datasets related to genomic regions.

[0004] Maximum likelihood estimation (MLE), a classic statistical method, constructs a probabilistic model based on observational data and infers parameters by maximizing the likelihood function. Due to its theoretical rigor and flexibility, it is widely used in population genetics research. In fish population genotyping, this method is highly compatible with the characteristics of InDel data based on resequencing: each InDel locus in a diploid individual can be considered as two independent samples, and the number of minor alleles naturally follows a binomial distribution, conforming to the random assignment assumption under Hardy-Weinberg equilibrium. Research practice shows that maximum likelihood estimation has been applied in salmon population tracing and Atlantic cod subpopulation analysis. By jointly calculating the probability contribution of multiple InDel loci, it can quantify the matching degree between the test sample and the reference population, combining computational efficiency and interpretability. Compared to Bayesian methods or machine learning models, MLE is more robust in small sample scenarios and avoids the risks of complex prior settings or overfitting. Based on the above biological rationale and technological maturity, using maximum likelihood estimation for population genotyping of large yellow croaker is feasible and can provide a reliable basis for accurately identifying the genetic background of fish.

[0005] The core of identifying the germplasm resources of the Naozhou large yellow croaker is to accurately and quickly distinguish it from other large yellow croaker populations. In 2015, Ao et al. used a strategy combining bacterial artificial chromosomes and whole-genome shotgun sequencing to sequence the whole genome of the large yellow croaker and obtained a fine genome map of the large yellow croaker (Ao JQ, Li J., You XX, et al. Construction of the High-Density Genetic Linkage Map and Chromosome Map of Large Yellow Croaker (Larimichthys crocea)[J]. International Journal of Molecular Sciences, 2015, 16(11): 26237-26248). In 2019, Chen et al. assembled the reference genome of large yellow croaker using third-generation sequencing technology (PacBio single-molecule sequencing) and high-throughput chromosome conformation capture technology (Chen B.H., Zhou ZX, Ke QZ, et al. The sequencing and de novo assembly of the Larimichthys crocea genome using PacBio and Hi-C technologies[J]. Scientific Data, 2019, 6). This highly accurate, chromosome-level reference genome of large yellow croaker provides important genomic resources for supporting the identification and evaluation of large yellow croaker germplasm resources. Currently, the development of genetically specific molecular markers has been applied in large yellow croaker. In 2022, Yu et al., through... dmrt1 and cfap157 The gene loci between the two loci were used to develop a sex-specific molecular marker in the Dai-qu stock large yellow croaker (Larimichthys crocea), providing a useful tool for promoting sex-controlled breeding of the Dai-qu stock large yellow croaker (Yu M., Xie Q.-P., Wei F.-L., et al. Development and identification of a sex-specific molecular marker in Dai-qu stock large yellow croaker (Larimichthys crocea) [J]. Aquaculture, 2022, 555).

[0006] In the South China Sea, it is morphologically difficult to distinguish between the wild large yellow croaker populations of *Naozhouensis*, *Naozhouensis*, and *Naozhouensis* from the eastern Fujian and Guangdong regions, as well as the wild large yellow croaker population from Huidong. Therefore, for the wild large yellow croaker population of *Naozhouensis* in western Guangdong, this population is currently easily confused with other large yellow croaker populations in the South China Sea, and there is a lack of accurate and rapid identification methods. Developing accurate and rapid identification methods for *Naozhouensis* using genetically specific markers could effectively promote research on the distribution of wild large yellow croaker populations along my country's coast.

[0007] Therefore, this invention aims to conduct comparative analysis and screen population-specific molecular markers for the large yellow croaker populations of the Naozhou group in western Guangdong, the large yellow croaker populations of the eastern Fujian and Guangdong sea areas, and the large yellow croaker populations of the Huidong group in the Pearl River Estuary, whose geographical distribution is disputed. Summary of the Invention

[0008] The purpose of this invention is to provide an InDel molecular marker for identifying wild large yellow croaker populations from the Naozhou group.

[0009] The present invention also aims to provide a primer set for amplifying the InDel molecular marker, a kit including the primer set, the application of the primer set or kit in identifying wild populations of large yellow croaker, and the application in assisted breeding or germplasm resource identification of large yellow croaker.

[0010] The third objective of this invention is to provide a method for identifying wild populations of large yellow croaker from Naozhou, the application of the method in identifying wild populations of large yellow croaker from Naozhou, and the application of the method in assisted breeding or germplasm resource identification of large yellow croaker.

[0011] The first objective of this invention can be achieved through the following technical solution: an InDel molecular marker for identifying wild large yellow croaker populations of the Naozhou group, wherein the InDel molecular markers include InDel3-47980327, InDel13-30626931, InDel14-14131930, InDel16-3391547, InDel16-3393826, and InDel17-8655298; wherein:

[0012] The InDel3-47980327 is located at position 47980327 of chromosome 3 NC_040013.1 of the large yellow croaker, and there is an insertion / deletion of the sequence fragment as shown in SEQ ID NO:1;

[0013] The InDel13-30626931 is located at position 30626931 on chromosome 13 of the large yellow croaker, NC_040023.1, and contains an insertion / deletion of a sequence fragment as shown in TTCTATAAC;

[0014] The InDel14-14131930 is located at position 14131930 on chromosome 14 of the large yellow croaker, NC_040024.1, and contains an insertion / deletion of the sequence fragment shown in SEQ ID NO:2;

[0015] The InDel16-3391547 is located at position 3391547 on chromosome 16 of the large yellow croaker, NC_040026.1, and contains an insertion / deletion of the sequence fragment shown in SEQ ID NO:3;

[0016] The InDel16-3393826 is located at position 3393826 of chromosome 16 NC_040026.1 of the large yellow croaker, and there is an insertion / deletion of the sequence fragment as shown in SEQ ID NO:4;

[0017] The InDel17-8655298 is located at position 8655298 of chromosome 17 NC_040027.1 of the large yellow croaker, and there is an insertion / deletion of the sequence fragment as shown in SEQ ID NO:5.

[0018] In some embodiments of the present invention, the above-mentioned InDel molecular markers of the present invention can be obtained through the following steps:

[0019] (S1) After whole-genome sequencing of 179 large yellow croaker samples, allele frequency calculation and chi-square test (P<0.05) were used to screen InDels loci of wild-domesticated large yellow croaker.

[0020] (S2) Six InDels with the highest allele frequencies and passing the chi-square test were selected as candidate specific genetic difference loci between the wild large yellow croaker population of Naozhou and other wild large yellow croaker populations (wild large yellow croaker of Fujian and Guangdong, and wild large yellow croaker of Huidong) and were further validated by capillary electrophoresis.

[0021] Based on the above screening, the InDels loci are located on five different chromosomes of the large yellow croaker (chromosome 3 (NC_040013.1), chromosome 13 (NC_040023.1), chromosome 14 (NC_040024.1), chromosome 16 (NC_040026.1), and chromosome 17 (NC_040027.1)), with the following location information: InDel3-47980327, InDel13-30626931, InDel14-14131930, InDel16-3391547, InDel16-3393826, InDel17-8655298; a set of primers for capillary electrophoresis detection that can be used to identify wild populations of the large yellow croaker from the Naozhou group was designed.

[0022] (S3) Use multiplex PCR reaction system to perform typing experiments to verify whether the six labeling reaction systems can identify wild large yellow croaker samples from Naozhou group in a wild large yellow croaker population consisting of wild large yellow croaker from Naozhou, wild large yellow croaker from Fujian and Guangdong, and wild large yellow croaker from Huidong.

[0023] (S4) The sequencing results were compared with the results of known marker detection in terms of accuracy and detection rate, proving that the reaction system can identify wild samples of large yellow croaker from Naozhou.

[0024] The second objective of the present invention can be achieved by the following technical solution: a primer set for amplifying the InDel molecular marker, wherein the sequence of the primer set is shown in SEQ ID NO:6 to SEQ ID NO:17, and each pair of nucleic acid sequences in SEQ ID NO:6 to SEQ ID NO:17 constitutes a pair of primers.

[0025] The present invention also provides a kit for detecting the InDel molecular marker, the kit comprising the primer set described above.

[0026] In some embodiments of the present invention, the kit further comprises 10×Buffer I, dNTP, HSTaq, etc.

[0027] The present invention also provides the application of the primer set or the kit described herein in the identification of wild large yellow croaker populations in Naozhou fish.

[0028] In particular, the primer set or the kit described herein is used to identify wild large yellow croaker populations of the Naozhou group in a wild large yellow croaker population consisting of wild large yellow croaker of the Naozhou group, wild large yellow croaker of the Fujian-Guangdong group, and wild large yellow croaker of the Huidong group.

[0029] The present invention further provides the application of the primer set or kit in the auxiliary breeding or germplasm resource identification of large yellow croaker.

[0030] The third objective of this invention can be achieved through the following technical solution: a method for identifying a population of wild large yellow croaker from the Naozhou group, comprising the following steps:

[0031] (1) Using the genomic DNA of the large yellow croaker sample to be tested as a template, multiplex PCR amplification was performed using the primer set or the kit described above to obtain PCR amplification products;

[0032] (2) Perform capillary electrophoresis sequencing on the PCR amplification products;

[0033] (3) Based on the capillary electrophoresis verification results, the maximum likelihood estimation method is used to classify the population samples: the overall log-likelihood value of all sites of all samples is calculated according to the maximum likelihood method, and the largest overall log-likelihood value of each population calculated according to the on-machine detection results of the sample to be tested is classified as the corresponding reference population.

[0034] Among the methods for identifying the above-mentioned wild large yellow croaker populations of the Naozhou group:

[0035] Preferably, the large yellow croaker sample to be tested in step (1) is a wild large yellow croaker population from Naozhou, a wild large yellow croaker population from Fujian and Guangdong, or a wild large yellow croaker population from Huidong.

[0036] Preferably, in step (2), a 3730XL sequencer is used to perform capillary electrophoresis sequencing on the PCR amplification products.

[0037] The present invention also discloses the application of the above-mentioned method in the identification of wild populations of Naozhou large yellow croaker, especially in the identification of Naozhou wild large yellow croaker populations in wild large yellow croaker populations composed of Naozhou wild large yellow croaker, Fujian-Guangdong wild large yellow croaker, and Huidong wild large yellow croaker.

[0038] The present invention further discloses the application of the above-mentioned method in assisted breeding or germplasm resource identification of large yellow croaker.

[0039] The present invention has the following advantages:

[0040] (1) Based on the co-detection system of 6 effective InDel sites, this invention can identify wild large yellow croaker of Naozhou in wild population samples of large yellow croaker with only a simple multiplex PCR reaction system and capillary electrophoresis typing detection. This system can be operated on a variety of genetic analysis instruments and can automatically type and identify wild large yellow croaker of Naozhou. Compared with the current methods for identifying wild large yellow croaker of Naozhou, this method is more effective in typing, faster in operation, has higher detection throughput, and has a higher accuracy.

[0041] (2) The system of the present invention is a multi-site identification system for wild large yellow croaker of Naozhou tribe based on capillary electrophoresis technology. This system is developed based on the InDels loci obtained by whole genome resequencing and allele frequency screening of large yellow croaker. The system integrates 6 candidate InDels into multiplex PCR reaction, specifically amplifies and genotypes the accuracy of the 6 loci in the test samples. Through capillary electrophoresis detection and verification of 20 known genotyped large yellow croaker samples, it is proved that the InDels marker system of 6 loci can successfully identify wild large yellow croaker of Naozhou tribe. Compared with the current identification methods and markers, this marker system and detection method greatly improve the identification effectiveness of wild large yellow croaker of Naozhou tribe. It can perform rapid and accurate genotyping on various genetic analyzers, realize the automation of Indel analysis, and can conveniently and efficiently achieve high-throughput detection. Attached Figure Description

[0042] Figure 1 This is the amplification result of capillary electrophoresis primers designed for InDels in Example 2 (taking InDel13-30626931 as an example). Note: If the sample peak shows Del, the genotype is Del / Del; if the sample peak shows Del and Ins, the genotype is Del / In; if the sample peak shows Ins, the genotype is In / In.

[0043] Figure 2 This is the detection peak diagram for the InDel3-47980327 site in Example 2;

[0044] Figure 3 This is the detection peak diagram for the InDel13-30626931 site in Example 2;

[0045] Figure 4 This is the detection peak diagram for the InDel14-14131930 site in Example 2;

[0046] Figure 5 This is the detection peak diagram for the InDel16-3391547 site in Example 2;

[0047] Figure 6 This is the detection peak diagram for the InDel16-3393826 site in Example 2;

[0048] Figure 7 This is the detection peak diagram for the InDel17-8655298 site in Example 2. Detailed Implementation

[0049] The present invention will be further described in detail below through specific embodiments.

[0050] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0051] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0052] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0053] Example 1

[0054] A system for distinguishing wild populations of large yellow croaker (Cyprinus naanensis) from other wild large yellow croaker populations (Cyprinus naanensis from Fujian and Guangdong, and Cyprinus naanensis from Huidong) based on InDels loci using capillary electrophoresis is proposed. The system comprises six InDels with marker-indicating functions, located on five different chromosomes of the large yellow croaker (chromosome 3 (NC_040013.1), chromosome 13 (NC_040023.1), chromosome 14 (NC_040023.1), chromosome 14 (NC_040023.1), chromosome 15 (NC_040023.1), chromosome 16 (NC_040023.1), chromosome 17 (NC_040023.1), chromosome 18 (NC_040023.1), chromosome 19 (NC_040023.1), chromosome 10 (NC_040023.1), chromosome 12 (NC_040023.1), chromosome 13 (NC_040023.1), chromosome 14 ... On chromosomes C_040024.1 (NC_040026.1) and NC_040027.1 (NC_040027.1), the location information is as follows: InDel3-47980327, InDel13-30626931, InDel14-14131930, InDel16-3391547, InDel16-3393826, InDel17-8655298.

[0055] The six InDels were obtained through whole-genome resequencing, variant site detection, and allele frequency screening (chi-square test (P<0.05)). The specific methods are as follows:

[0056] Whole-genome resequencing was performed on 179 individuals of large yellow croaker (reference population, including 63 from the Naozhou group, 56 from the Huidong group, and 60 from the Fujian-Guangdong eastern group). The effective data volume after filtering (Cleanbase) was 1343.11G, with an average of 7.5G per sample. Allele frequencies were calculated and chi-square test was performed on the InDels dataset (P<0.05). Six InDels with the highest allele frequency differences between the Naozhou wild large yellow croaker population and other wild large yellow croaker populations (Fujian-Guangdong eastern large yellow croaker and Huidong wild large yellow croaker) and passed the chi-square test were selected as candidate specific genetic difference loci. InDels expansion validation was performed based on capillary electrophoresis.

[0057] The specific genotypes of the six InDels are shown in Table 1 below.

[0058] Table 1. Specific genotypes of the 6 InDels

[0059]

[0060] For InDel, In represents a large fragment insertion, and Del represents a large fragment deletion. The mutation information for each large fragment at each point is as follows:

[0061] D1 (InDel3-47980327):

[0062] CGTAGAAACAGAGTAGAAACAAATGAGAGCCCGTGGCTGAGTCAAACTGGCTGTGGCCCGAGAGCTGCATAGCT(In)→C(Del), that is, at position 47980327 of chromosome 3 of the large yellow croaker, there is an insertion / deletion of CGTAGAAACAGAGTAGAAACAAATGAGAGCCCGTGGCTGAGTCAAACTGGCTGTGGCCCGAGAGCTGCATAGCT as shown in SEQ ID NO:1;

[0063] D2 (InDel13-30626931):

[0064] TTCTATAAC(In)→T(Del), that is, at position 30626931 of chromosome 13 NC_040023.1 of the large yellow croaker, there is an insertion / deletion of the sequence fragment TTCTATAAC as shown in TTCTATAAC;

[0065] D3 (InDel14-14131930):

[0066] ATGAAGGCGCGATTCAC(In)→A(Del), that is, at position 14131930 of chromosome 14.1 of the large yellow croaker, there is an insertion / deletion of the sequence fragment ATGAAGGCGCGATTCAC as shown in SEQ ID NO:2;

[0067] D4 (InDel16-3391547):

[0068] ACTGAAATTTGAGGC(In)→A(Del), that is, at position 3391547 of chromosome 16 NC_040026.1 of the large yellow croaker, there is an insertion / deletion of the sequence fragment ACTGAAATTTGAGGC as shown in SEQ ID NO:3;

[0069] D5 (InDel16-3393826):

[0070] GGTGAGTGGTGAGCGTAGAA(In)→G(Del), that is, at position 3393826 of chromosome 16 NC_040026.1 of the large yellow croaker, there is an insertion / deletion of the sequence fragment GGTGAGTGGTGAGCGTAGAA as shown in SEQ ID NO:4;

[0071] D6 (InDel17-8655298):

[0072] The sequence GGTTCACGTA(In)→G(Del) is located at position 8655298 of chromosome 17 NC_040027.1 of the large yellow croaker, where there is an insertion / deletion of the sequence fragment GGTTCACGTA as shown in SEQ ID NO:5.

[0073] Furthermore, the names and sequences of the amplification primers for the six InDels are shown in Table 2.

[0074] Table 2. Names and sequences of the six InDels amplification primers.

[0075]

[0076] Example 2

[0077] A method for identifying wild large yellow croaker populations of the Naozhou group based on six InDel loci using capillary electrophoresis includes the following steps:

[0078] S1: Genomic DNA was extracted from the fin tissue of large yellow croaker using the phenol-chloroform extraction method;

[0079] S2: Constructing a multiplex PCR reaction system: The PCR reaction system is shown in Table 3, and the reaction procedure is shown in Table 4;

[0080] Table 3 PCR reaction system

[0081]

[0082] Note: The volume of each primer pair is 0.1 μL;

[0083] Table 4 PCR reaction procedure

[0084]

[0085] S3: Detected using a 3730XL sequencer;

[0086] 1) Add 9 μL of a mixture of molecular weight internal standard and formamide (0.5:8.5) and 1.0 μL of PCR product to each well of a 96-well plate;

[0087] 2) Denatured at 95℃ for 3 minutes, then detected using a 3730XL sequencer;

[0088] The amplification results of capillary electrophoresis primers designed for InDels (taking InDel13-30626931 as an example) are as follows: Figure 1 As shown; the detection peak diagram for the InDel3-47980327 site is as follows. Figure 2 As shown in the figure, the detection peak values ​​for the InDel13-30626931 site are as follows: Figure 3 As shown, the detection peak diagram for the InDel14-14131930 site is as follows: Figure 4 As shown, the detection peak diagram for the InDel16-3391547 site is as follows. Figure 5 As shown, the detection peak diagram for the InDel16-3393826 site is as follows: Figure 6 As shown, the detection peak diagram for the InDel17-8655298 site is as follows. Figure 7 As shown;

[0089] 3) GM data analysis: Import the raw data files obtained from the detection into the analysis software Genemapper ID3.2 to analyze the experimental results.

[0090] S4: Combining capillary electrophoresis verification results, the differences in allele frequencies at the above 6 loci among the populations of wild large yellow croaker from Naozhou, wild large yellow croaker from Fujian and Guangdong, and wild large yellow croaker from Huidong were analyzed (P<0.05). Since the allele frequencies conform to the binomial distribution Bin(2, p), the maximum likelihood estimation method was used for population genotyping: the overall log-likelihood value of all loci (6 indel loci) of all samples was calculated according to the maximum likelihood method. The population with the largest overall log-likelihood value calculated based on the machine detection results of the samples to be tested was classified into the corresponding reference population; the specific identification rules are as follows:

[0091] ;

[0092] Among them, A, B, and C are reference groups for wild large yellow croaker from Naozhou, wild large yellow croaker from Fujian and Guangdong, and wild large yellow croaker from Huidong, respectively.

[0093] Furthermore, the overall log-likelihood value of the population can be calculated as follows:

[0094] The overall log-likelihood of the population = (frequency of minor alleles in the tested population × 2 × LN (frequency of minor alleles in the reference population) + (frequency of major alleles in the tested population × 2) × LN (frequency of major alleles in the reference population)) × number of samples tested.

[0095] Allele frequencies and suballele frequencies were obtained based on the results displayed by the analysis software Genemapper ID3.2 in step S3.

[0096] Example 3

[0097] The wild large yellow croaker population was identified by using the six InDel loci based on capillary electrophoresis technology in Example 2, and by comparing it with other wild large yellow croaker populations (wild large yellow croaker from Fujian and Guangdong, and wild large yellow croaker from Huidong).

[0098] Based on the above six InDels-based population sample identification methods, reference populations for wild large yellow croaker from Naozhou, wild large yellow croaker from Fujian and Guangdong, and wild large yellow croaker from Huidong were constructed respectively.

[0099] The tested samples were 20 wild large yellow croakers from Naozhou Island. The specific gene frequency detection results are shown in Table 5 below:

[0100] Table 5 Specific gene frequency detection results

[0101]

[0102] The overall population was determined based on the maximum likelihood estimation method. The overall log-likelihood values ​​of the populations were calculated according to three wild reference populations (63 populations of large yellow croaker from Naozhou, 56 populations from Huidong, and 60 populations from eastern Fujian and Guangdong) as shown in Table 6 below:

[0103] Table 6. Overall log-likelihood values ​​calculated based on three wild reference populations.

[0104]

[0105] As shown above, the overall log-likelihood value of the wild large yellow croaker population of Naozhou tribe is the largest. The population to which the sample to be tested belongs is identified as the wild large yellow croaker population of Naozhou tribe, which is consistent with the reference classification.

[0106] Example 4

[0107] The tested samples were 20 non-Naozhou wild large yellow croakers. The specific gene frequency detection results are shown in Table 7 below:

[0108] Table 7 Specific gene frequency detection results

[0109]

[0110] The overall population affiliation was determined based on the maximum likelihood estimation method. The overall log-likelihood values ​​of the population calculated from the three wild reference populations are shown in Table 8 below:

[0111] Table 8. Overall log-likelihood values ​​calculated based on three wild reference populations.

[0112]

[0113] As shown in Table 8 above, the overall log-likelihood value of the wild large yellow croaker population from Naozhou is not the largest. The population to which the sample to be tested belongs is identified as a non-Naozhou wild large yellow croaker population, which is consistent with the reference classification.

[0114] In summary, the population identification method based on 6 InDels in this invention is effective and can be applied to the identification of wild populations of large yellow croaker (Naozhou large yellow croaker, Fujian-Guangdong wild large yellow croaker, and Huidong wild large yellow croaker).

[0115] It should be noted that the above embodiments are merely further illustrations of the present invention and not limitations. Any adjustments or changes made by those skilled in the art within the equivalent meaning and scope of the technical solutions of the present invention should be considered as included within the protection scope of the present invention.

Claims

1. An InDel molecular marker for identifying wild large yellow croaker populations of the Naozhou group, characterized in that, The InDel molecular markers include InDel3-47980327, InDel13-30626931, InDel14-14131930, InDel16-3391547, InDel16-3393826, and InDel17-8655298; wherein: The InDel3-47980327 is located at position 47980327 of chromosome 3 NC_040013.1 of the large yellow croaker, and there is an insertion / deletion of the sequence fragment as shown in SEQ ID NO:1; The InDel13-30626931 is located at position 30626931 on chromosome 13 of the large yellow croaker, NC_040023.1, and contains an insertion / deletion of a sequence fragment as shown in TTCTATAAC; The InDel14-14131930 is located at position 14131930 on chromosome 14 of the large yellow croaker, NC_040024.1, and contains an insertion / deletion of the sequence fragment shown in SEQ ID NO:2; The InDel16-3391547 is located at position 3391547 on chromosome 16 NC_040026.1 of the large yellow croaker, and there is an insertion / deletion of the sequence fragment as shown in SEQ ID NO:3; The InDel16-3393826 is located at position 3393826 on chromosome 16 of the large yellow croaker, NC_040026.1, and contains an insertion / deletion of the sequence fragment shown in SEQ ID NO:4; The InDel17-8655298 is located at position 8655298 of chromosome 17 NC_040027.1 of the large yellow croaker, and there is an insertion / deletion of the sequence fragment as shown in SEQ ID NO:

5.

2. A primer set for amplifying the InDel molecular marker of claim 1, characterized in that, The sequences of the primer set are shown in SEQ ID NO:6 to SEQ ID NO:17, and each pair of nucleic acid sequences in SEQ ID NO:6 to SEQ ID NO:17 constitutes a primer pair.

3. A kit for detecting the InDel molecular marker of claim 1, characterized in that, The kit includes the primer set as described in claim 2.

4. The application of the primer set according to claim 2 or the kit according to claim 3 in the identification of wild large yellow croaker populations in Naozhou fish.

5. The application of the primer set according to claim 2 or the kit according to claim 3 in the assisted breeding or germplasm resource identification of large yellow croaker.

6. A method for identifying a population of wild large yellow croaker from Naozhou, characterized in that, Includes the following steps: (1) Using the genomic DNA of the large yellow croaker sample to be tested as a template, multiplex PCR amplification was performed using the primer set described in claim 2 or the kit described in claim 3 to obtain PCR amplification products; (2) Perform capillary electrophoresis sequencing on the PCR amplification products; (3) Based on the capillary electrophoresis verification results, the maximum likelihood estimation method is used to classify the population samples: the overall log-likelihood value of all sites of all samples is calculated according to the maximum likelihood method, and the largest overall log-likelihood value of each population calculated according to the on-machine detection results of the sample to be tested is classified as the corresponding reference population.

7. The method for identifying wild large yellow croaker populations of the Naozhou group according to claim 6, characterized in that, The large yellow croaker samples to be tested in step (1) are wild large yellow croaker populations of Naozhou tribe, wild large yellow croaker populations of Fujian and Guangdong tribes, or wild large yellow croaker populations of Huidong.

8. The method for identifying wild large yellow croaker populations of the Naozhou group according to claim 6, characterized in that, In step (2), the PCR amplification products were sequenced by capillary electrophoresis using a 3730XL sequencer.

9. The application of the method according to any one of claims 6-8 in the identification of wild populations of large yellow croaker from the Naozhou group.

10. The application of the method described in any one of claims 6-8 in assisted breeding or germplasm resource identification of large yellow croaker.

Citation Information

Patent Citations

  • Larimichthys crocea genome-wide SNP and InDel molecular marker method based on double enzyme digestion

    CN105349675A

  • SNP (Single Nucleotide Polymorphism) method for screening rapid growth individuals of Pseudosciaena crocea of sal family

    CN119020464A

  • Construction of rapid identification method for large yellow croaker wild and domesticated populations based on four general InDel loci

    CN119753160A

  • Multi-site sal ammoniac wild pseudosciaena crocea identification method based on SNaPshot technology

    CN120464748A