CrRNA sequence and method for detecting mouse hepatitis virus MHV

Abstract

The invention discloses a crRNA sequence and a method for detecting mouse hepatitis virus MHV. Aiming at the early warning requirement of pathogenic microorganisms in an experimental animal barrier environment, environmental dust is used as a medium, a specific recombinase-mediated isothermal amplification RAA primer meeting the requirement for detecting MHV and crRNA adapted to an LwCas13a system are designed, and an RAA-CRISPR / Cas13a detection system is optimized and established. The method has the advantages of strong specificity, high sensitivity, short detection time and no need of complex instruments. Through clinical sample verification, early warning of MHV in an environment sample can be efficiently realized. The method is suitable for rapid screening of pathogenic microorganisms in scenes such as experimental animal facilities and biosafety laboratories. The invention creatively establishes a method for rapidly and accurately detecting MHV by using dust in the environment, and provides technical support for monitoring pathogenic pollution of experimental animals.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a crRNA sequence and method for detecting mouse hepatitis virus (MHV). It is a rapid detection method for mouse hepatitis virus (MHV) in environmental samples based on CRISPR / Cas13a technology combined with recombinase-mediated isothermal amplification (RAA) technology and its application in pathogen early warning in experimental animal facilities. Background Technology

[0002] MHV detection primarily relies on methods such as antigen-antibody detection, real-time quantitative PCR, and sequencing, but these techniques all have limitations. The national standard method, enzyme-linked immunosorbent assay (ELISA), determines infection status by detecting MHV antibodies in animal serum. Its main limitation is that it cannot distinguish whether an animal is currently infectious, nor can it differentiate between recent and past infections. Furthermore, the RT-PCR method also suffers from false positives and requires sophisticated equipment, and may miss samples with low viral loads.

[0003] CRISPR / Cas systems (such as Cas12a / Cas13a) offer advantages in high specificity and room-temperature detection. Current CRISPR detection methods largely rely on PCR pre-amplification, making it impossible to achieve a fully rapid workflow. While RAA isothermal amplification technology simplifies nucleic acid amplification steps, no publicly available protocol has been found to combine it with Cas13a for MHV detection. Summary of the Invention

[0004] This invention provides a crRNA sequence and method for detecting mouse hepatitis virus (MHV).

[0005] This invention addresses the detection of MHV in the environmental media used for housing laboratory animals. To ensure sufficient sensitivity, the following innovative approach is proposed:

[0006] Target selection and primer design: Five MHV strain genome sequences were obtained from the NCBI database. Details are shown in Table 1. The conserved region of the ORF1ab gene was selected as the detection target by comparison. Specific RAA primers (SEQ ID NO: 1-2) were designed to ensure amplification efficiency and compatibility.

[0007] crRNA optimization: Based on the preference of LwCas13a, a 28nt crRNA (SEQ ID NO:3) was designed with its 5' end directly matching the target sequence and a stable hairpin structure added to the 3' end to enhance binding efficiency.

[0008] Detection system construction: The RAA amplification product is mixed with the Cas13a-crRNA complex, and the signal is triggered by cleaving the fluorescent reporter group (such as FAM-UUUUU-BHQ1) to realize the integrated "amplification-detection" process.

[0009] A crRNA sequence for detecting mouse hepatitis virus (MHV) is shown in SEQ ID NO:3.

[0010] SEQ ID NO:3(crRNA):

[0011] ATGAAAGGTACCGTGTATGTTAGACCCAGTTTTAGTCCCCTTCG.

[0012] A reagent for detecting mouse hepatitis virus (MHV) includes: a crRNA sequence.

[0013] A kit for detecting mouse hepatitis virus (MHV) includes a crRNA sequence. The kit further includes a specific RAA primer pair for MHV detection, the nucleotide sequences of which are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0014] SEQ ID NO:1(RAA-F):

[0015] TAATACGACTCACTATAGGGAGATCTCGTTTGGGCATTATACTACTCT;

[0016] SEQ ID NO:2(RAA-R):

[0017] AAAAAAAAAAAAAAAAAAAAAACAATAATGGGTCTAACATACA CGG.

[0018] This invention addresses the need for early warning of pathogenic microorganisms in laboratory animal barrier environments. Using environmental dust as a medium, this invention designs specific RAA primers and crRNA adapted to the LwCas13a system to detect MHV, and optimizes and establishes a RAA-CRISPR / Cas13a detection system. This method is highly specific, sensitive, and has a short detection time, requiring no complex instruments. Validated with clinical samples, it can efficiently achieve early warning of MHV in environmental samples. This method is suitable for rapid screening of pathogenic microorganisms in laboratory animal facilities, biosafety laboratories, and other similar settings. The environmental medium MHV early warning method includes the following steps: collecting dust enriched in the animal rearing environment, extracting RNA, and then detecting it using the established RAA-CRISPR / Cas13a system. This invention creatively establishes a method for rapid and accurate detection of MHV using environmental dust, providing technical support for pathogen contamination monitoring in laboratory animals.

[0019] A method for early warning detection of MHV (Hepatitis Virus) in environmental mice, comprising the following steps:

[0020] (1) Collect dust samples from the living environment of the mice to be tested and extract nucleic acids;

[0021] (2) The nucleotide sequences of the specific RAA primer pairs designed for the detection of mouse hepatitis virus (MHV) are shown in SEQ ID NO:1 and SEQ ID NO:2;

[0022] (3) The crRNA sequence for detecting mouse hepatitis virus (MHV) is shown in SEQ ID NO:3;

[0023] (4) The extracted nucleic acid was amplified isothermally using recombinase-mediated isothermal amplification (RAA) technology;

[0024] (5) The amplification products were detected using CRISPR / Cas 13a technology.

[0025] The method specifically includes:

[0026] (1) Dust accumulated in the animal husbandry environment, including but not limited to the filter of the barrier environment ventilation system or the air outlet of the cage of the independent ventilation system.

[0027] (2) Sample RNA extraction method: Take 100 mg of the sample to be tested, transfer it to a 1.5 mL centrifuge tube, add 1 mL of Trizol and mix well, then add 0.2 mL of chloroform, shake well for 15 s, let stand for 2 min, centrifuge at 12000 g for 15 min at 4 °C, take the supernatant to a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, mix well, let stand at room temperature for 10 min, then centrifuge at 12000 g for 15 min at 4 °C and discard the supernatant. Add 1 mL of 75% ethanol, gently wash the precipitate, centrifuge at 12000 g for 15 min at 4 °C, discard the supernatant, invert and air dry, add 100 μL of enzyme-free water to dissolve, and place in a -80 °C refrigerator for testing.

[0028] (3) RAA amplification: Prepare 50 μL of reaction system according to Table 1, shake and mix well, incubate at 37℃ for 30 min, reverse transcribe the sample RNA and amplify it into cDNA to be tested.

[0029] (4) CRISPR / Cas 13a detection method: Prepare CRISPR / Cas 13a detection reagent according to Table 2, mix thoroughly, and place in a real-time PCR instrument at 37℃ for 60 min. Collect the fluorescence signal intensity every 30 s.

[0030] Table 1

[0031]

[0032] Compared with the prior art, the present invention has the following advantages:

[0033] 1. High sensitivity: The lowest detection limit is 10 copies / μL.

[0034] II. Rapid testing: The entire process takes less than 1 hour, requires no thermal cycler, and is suitable for on-site applications.

[0035] III. High specificity: No cross-reactivity with five common experimental animal RNA pathogens: Sendai virus (SV), mouse pneumonia virus (PVM), reovirus type III (Reo-3), mouse encephalomyelitis virus (TMEV), and mouse norovirus (MNV). The source of the strains is shown in Table 2.

[0036] IV. Verification of reliability: The test results of 160 dust samples showed 100% consistency with the PCR method (Kappa value = 1.0).

[0037] Table 2

[0038] Attached Figure Description

[0039] Figure 1 Here is a flowchart of the MHV detection system;

[0040] Figure 2 The results are for RAA-Cas 13a sensitivity testing.

[0041] Figure 3 The results are for RAA-Cas 13a specificity detection. Detailed Implementation

[0042] 1. Materials

[0043] Nucleic acid samples were collected from Sendai virus (SeV), Reovirus 3 (Reo-3), Mouse pneumonia virus (PVM), Mouse encephalomyelitis virus (MEV), Mouse norovirus (MNV), and Mouse hepatitis virus (MHV). 160 dust samples were randomly selected from the exhaust vents of independently ventilated rearing cages within the isolation area for clinical sampling. The barrier environment was maintained at a temperature of 20-26℃ (daily temperature difference ≤4℃), humidity of 35-60%, with a 12-hour light-dark cycle and an air exchange rate ≥15 times / hour. Mice were housed separately in IVCs, with ≤5 mice per cage. Autoclaved corn cobs were used as bedding. Mice had free access to food and water.

[0044] 2 methods

[0045] The testing process is as follows: Figure 1 As shown, the detailed steps are as follows:

[0046] 2.1 RNA extraction from samples

[0047] Take 100 mg of the sample to be tested, transfer it to a 1.5 mL centrifuge tube, add 1 mL of Trizol and mix well, then add 0.2 mL of chloroform, shake thoroughly for 15 seconds, let stand for 2 minutes, centrifuge at 12000 g for 15 minutes at 4 °C, transfer the supernatant to a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, mix well, let stand at room temperature for 10 minutes, then centrifuge at 12000 g for 15 minutes at 4 °C and discard the supernatant. Add 1 mL of 75% ethanol, gently wash the precipitate, centrifuge at 12000 g for 15 minutes at 4 °C, discard the supernatant, invert and air dry, then add 100 μL of enzyme-free water to dissolve, and place in a -80 °C freezer for testing.

[0048] 2.2 RAA-Cas 13a Detection Method

[0049] Synthesize primers according to the sequences in the table below:

[0050]

[0051] according to According to the instructions in the Basic / Basic RT kit, prepare a 50 μL reaction system as shown in the table below, vortex to mix, incubate at 37°C for 30 min, reverse transcribe and amplify the sample RNA into the cDNA to be tested.

[0052]

[0053] Prepare the CRISPR / Cas 13a detection reagent according to the table below. After thorough mixing, place it in a real-time PCR instrument at 37°C for 60 min and collect the fluorescence signal intensity every 30 s.

[0054]

[0055] 2.3 Sensitivity Experiment: The standard plasmid MHV-pET-28a was serially diluted in a 10-fold concentration gradient to seven concentrations ranging from 10⁶ to 100 copies / μL. The experiment was conducted according to the RAA-Cas 13a detection method, with each group repeated three times. The lower limit of detection concentration was determined by amplification curves.

[0056] 2.4 Specificity Experiments: RNA from MHV and other common mouse viruses (SeV, Reo-3, PVM, TMEV, MNV, and MHV) was used as templates and detected using the established CRISPR / Cas13a method to verify the existence of cross-reactivity with other viruses and determine the specificity of the method. The RAA-Cas 13a detection method was followed to confirm the pathogenic microorganisms exhibiting amplification curves.

[0057] 2.5 Clinical Sample Testing: Dust samples from clinical samples were tested according to the RAA-Cas 13a test method, and PCR testing was performed according to the "T / CALAS25-2017 Experimental Animal Mouse Hepatitis Virus PCR Detection Method".

[0058] 3 Results

[0059] 3.1 Specificity Detection

[0060] To verify the specificity of CRISPR nucleic acid detection, nucleic acids from six common mouse infection viruses—SeV, Reo-3, PVM, TMEV, MNV, and MHV—were selected for detection. The results are attached. Figure 2 As shown, after 30 minutes of detection, a typical "S"-shaped amplification curve was observed (Ct value = 18.5 ± 0.7), while the fluorescence signals of other viral samples remained at the baseline level. This indicates that the RAA-CRISPR / Cas13a detection method established in this study has high specificity.

[0061] 3.2 Sensitivity Experiment

[0062] Take 1.0 × 10 6 ~1.0×10 0Seven standard plasmids at concentrations of 1.0 × 100 copies / μL were used, with 1.0 × 100 copies / μL as the control group. The RAA-Cas 13a detection method was employed. The fluorescence values ​​for each group were 52917 a.u., 48101 a.u., 38428 a.u., 29618 a.u., 16020 a.u., 9515 a.u., 347 a.u., and 156 a.u., respectively. The results are attached. Figure 3 As shown, the fluorescence values ​​of RNA template with 1.0 × 10¹ copies / μL were significantly different from those of the control group (P < 0.0001), indicating that the RAA-CRISPR / Cas13a detection method established in this study has a sensitivity greater than 1.0 × 10¹ copies / μL, demonstrating extremely high sensitivity.

[0063] 3.3 Clinical Sample Testing

[0064] The RAA-Cas 13a detection method was used to detect dust samples from 160 IVC cages. The results are shown in the table below. The detection results are consistent with those of the PCR method.

[0065]

Claims

1. A crRNA sequence for detecting mouse hepatitis virus (MHV), characterized in that, As shown in SEQ ID NO:

3.

2. A reagent for detecting mouse hepatitis virus (MHV), characterized in that, include: The crRNA sequence of claim 1.

3. A kit for detecting mouse hepatitis virus (MHV), characterized in that, include: The crRNA sequence of claim 1.

4. The reagent kit according to claim 3, characterized in that, Also includes: Primer pairs for MHV detection using recombinase-mediated isothermal amplification technology have nucleotide sequences shown in SEQ ID NO:1 and SEQ ID NO:

2.

5. A method for early warning detection of environmental mouse hepatitis virus (MHV), characterized in that, Includes the following steps: (1) Collect dust samples from the living environment of the mice to be tested and extract nucleic acids; (2) The nucleotide sequences of primer pairs designed for the specific recombinase-mediated isothermal amplification technique for the detection of mouse hepatitis virus (MHV) are shown in SEQ ID NO:1 and SEQ ID NO:2; (3) The crRNA sequence for detecting mouse hepatitis virus (MHV) is shown in SEQ ID NO:3; (4) The extracted nucleic acid was amplified isothermally using recombinase-mediated isothermal amplification technology; (5) The amplification products were detected using CRISPR / Cas 13a technology.

Images