CeMV resistance in celery

By introducing mutations in a specific genomic region on chromosome 10 of celery plants, the problem of CeMV infection in celery was solved, achieving highly efficient resistance to CeMV, ensuring healthy celery growth, and applicable to various celery types.

CN120936247APending Publication Date: 2025-11-11BEHO SEEDS LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202480018931.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-08-15
Filing Date
2024-03-11
Publication Date
2025-11-11

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control celery mosaic virus (CeMV) infection in celery, leading to plant disease, which has become a significant problem, especially in western states of the United States, Florida, and Australia. Traditional hostless control methods are inefficient.

Method used

CeMV resistance was achieved by introducing specific genomic mutations, including deletions, insertions, or substitutions, into a genomic region between 80,545 and 80,589 cM on chromosome 10 of celery plants. Specifically, this involved alterations in multiple amino acid sequence domains at positions 88-103, 120-163, and 183-228, with a preferred mutation at positions 586 and/or 1593 in the amino acid sequence of SEQ ID No. 9, where the genomic sequence homozygous for this region was found.

Benefits of technology

It achieves highly efficient resistance to CeMV, ensuring that celery plants are not infected by the virus and maintain healthy growth. It is suitable for stem celery, root celery or leaf celery, and provides a stable antiviral genomic region.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005594404320000081
    Figure BDA0005594404320000081
  • Figure BDA0005594404320000091
    Figure BDA0005594404320000091
  • Figure BDA0005594404320000101
    Figure BDA0005594404320000101
Patent Text Reader

Abstract

The present invention relates to CeMV resistant celery plants, methods for identifying CeMV resistant celery plants, methods for producing CeMV resistant celery plants, and means for producing or identifying CeMV resistant celery plants. In particular, the present invention relates to a CeMV resistant celery plant comprising a genomic region on chromosome 10 between 80, 545 and 80, 589 cM wherein the genomic region comprises one or more mutations that cause resistance to said CeMV.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to CeMV-resistant celery plants, methods for identifying CeMV-resistant celery plants, methods for producing CeMV-resistant celery plants, and ways of producing or identifying CeMV-resistant celery plants. Background Technology

[0002] Celery (Apium graveolens) is a member of the Apiaceae family, a family of aromatic flowering plants that includes carrots, parsnip, parsley, coriander, fennel, and dill. Three morphologically distinct types of celery are typically cultivated: stalk celery (A. graveolens var. dulce) is cultivated for its long, sturdy petioles (leaf stalks); root celery (A. graveolens var. rapaceum) is cultivated for its thickened stems (hypocotyls); and leaf celery (A. graveolens var. secalinum) is cultivated for its slender leaves.

[0003] Celery is a popular vegetable consumed worldwide. In North America and Europe, the crisp stalks (leaf stalks) of celery are often eaten raw or used as an ingredient in salads, juices, and soups. In Europe, the thickened hypocotyl of the root celery is chopped and used in salads. Celery leaves have a strong flavor and are used to flavor soups or stews, or as a dried herb. Celery seeds contain a variety of substances with potentially health-promoting properties and are therefore used in dietary supplements and alternative medicines. The seeds can also be crushed and mixed with salt to make celery salt, used for seasoning food, but in some cases, celery salt is also made from root extracts or using dried leaves.

[0004] Celery has a long history of cultivation. Linnaeus first described celery in 1753 in *Species Plantarum*. While it may have originated in the salt marshes of Europe and the Mediterranean, it is now grown in many parts of the world, including Australia, South Africa, and South America. The largest producer of stalk celery is the United States (especially California), followed by Mexico. Root celery mainly grows in Europe, while Chinese celery, or leaf celery, is the most common type of celery grown in Asia.

[0005] Celery grows best in mild or cool temperate climates. Stalk celery is grown from seeds sown in heated beds or open gardens, depending on the season. When the plants reach a height of 15 to 20 cm, they are transplanted into deep trenches, which are gradually filled with soil to limit sun exposure. This process, known as blanching, produces plants with lower bitterness, a milder flavor, and a sweeter, more aromatic taste. Many modern cultivars spontaneously blanch without this treatment, a process known as self-blanching. Due to the very high uniformity of modern cultivars, the field is harvested only once, approximately three months after planting. After removing the leaves and stalks, celery can be stored for several weeks at 0 to 2°C.

[0006] As with most crops, a variety of pathogens pose a challenge to the cultivation of celery and root celery. Examples include the ascomycete *Septoria apiicola*, which causes celery leaf spot or late blight; *Fusarium oxysporum*, an ascomycete fungus that causes Fusarium wilt (also known as Fusarium yellow blight); and *Cercospora apii*, a fungus that causes early blight. Other pathogens are known, such as viruses and various insects, such as leaf miners and shield moths (*Graphosoma sp.*).

[0007] Celery mosaic virus (CeMV) is a commercially important pathogen affecting celery and a member of the largest family of plant-positive RNA viruses: Potatovirus Y family, Potatovirus Y genus. Viruses in this genus are typically transmitted by aphids and / or mechanically. The aphid *Myzus persicae* (Sulz.) is a known CeMV vector. Besides celery, CeMV is known to infect parsley, carrots, cilantro, parsnip, and dill. Infected plants exhibit the following symptoms: narrowed leaves, mosaic and / or spotted patterns on leaves, vein removal, yellowing of leaves, and twisting of branches and leaves. Plants may appear stunted or show signs of weakness. Currently, CeMV is present globally (e.g., in Chile, Poland, Iran), but it is a significant problem in western US states, Florida, and Australia.

[0008] One approach to controlling the disease is to introduce a two- to three-month host-free period during which celery is not grown in the area. However, this method is inefficient when other host crops such as carrots, parsley, and cilantro are grown in the area, as the virus can persist on these crops. The presence of weeds that can also serve as hosts for CeMV further diminishes the effectiveness of such control measures. An example of such weeds is wild hemlock in England.

[0009] In view of the above, there is a need in the field to provide gene-encoded resistance to CeMV in celery. Summary of the Invention

[0010] Among other things, the purpose of this invention is to satisfy the above-mentioned needs in the art.

[0011] According to the present invention, as outlined in the appended claims, the above requirements are satisfied.

[0012] Specifically, the above requirements are met by providing CeMV-resistant celery plants containing a genomic region on chromosome 10 between 80,545 and 80,589 cM, said genomic region containing one or more mutations that cause said CeMV resistance.

[0013] According to a preferred embodiment, the present invention relates to CeMV-resistant celery plants containing a mutated genomic region of 8.8 Mbp between base pair positions 80,246,438 and 89,075,890 in the celery genome.

[0014] According to a particularly preferred embodiment, the genomic region of this mutation is derived from, originates from, or is derived from a celery plant deposited on March 2, 2023, at NCIMB (National Centre for the Preservation of Bacterial Cultures in the Food Industry and Marine Sciences, Wellheads Place, Dyce, Aberdeen, AB21 7GB, United Kingdom) with accession number 44126.

[0015] According to another particularly preferred embodiment, the CeMV-resistant celery of the present invention contains one or more mutations that cause the deletion of a protein encoded by a cDNA sequence represented by SEQ ID No. 8 in the celery plant.

[0016] Preferably, one or more mutations of the present invention are located in the genomic region represented by SEQ ID No. 7. One or more mutations of the present invention are deletions, insertions, or substitutions in the genomic region represented by SEQ ID No. 7 that result in the absence of the protein encoded by SEQ ID No. 8.

[0017] Also preferably, one or more mutations in the present invention are deletions, insertions, or substitutions in the cDNA sequence represented by SEQ ID No. 8 that result in the absence of the protein encoded by SEQ ID No. 8.

[0018] According to a particularly preferred embodiment, the present invention relates to CeMV-resistant celery plants, wherein one or more mutations of the invention comprise:

[0019] a) At least four consecutive amino acids are deleted from one or more domains of the amino acid sequence of SEQ ID No. 9, wherein the domains are selected from the group consisting of the domains at positions 88-103, 120-163, 183-228, 327-350, 485-497, 691-733, 860-886, 940-994, 1022-1092, 1119-1150, 1185-1210, 1562-1580, 1690-1722 and 1754 to the C-terminus; and / or

[0020] b) Amino acid substitutions in one or more domains of the amino acid sequence of SEQ ID No. 9, wherein the domains are selected from the group consisting of the domains at positions 88-103, 120-163, 183-228, 327-350, 485-497, 691-733, 860-886, 940-994, 1022-1092, 1119-1150, 1185-1210, 1562-1580, 1690-1722 and the domains from position 1754 to the C-terminus; and / or

[0021] c) A single amino acid deletion in one or more domains of the amino acid sequence of SEQ ID No. 9, wherein the domains are selected from the group consisting of the domains at positions 88-103, 120-163, 183-228, 327-350, 485-497, 691-733, 860-886, 940-994, 1022-1092, 1119-1150, 1185-1210, 1562-1580, 1690-1722 and 1754 to the C-terminus; and / or

[0022] d) An amino acid insertion in one or more domains of the amino acid sequence of SEQ ID No. 9, wherein the domains are selected from the group consisting of the domains at positions 88-103, 120-163, 183-228, 327-350, 485-497, 691-733, 860-886, 940-994, 1022-1092, 1119-1150, 1185-1210, 1562-1580, 1690-1722 and 1754 to the C-terminus.

[0023] According to another particularly preferred embodiment, the present invention relates to CeMV-resistant celery plants, wherein one or more mutations of the invention comprise:

[0024] a) The amino acid sequence of SEQ ID No. 9 contains a deletion of at least four consecutive amino acids within the 20 amino acids at positions 586 and / or 1593; and / or

[0025] b) Amino acid substitutions in the amino acid sequence of SEQ ID No. 9 within the 20 amino acids at positions 586 and / or 1593; and / or

[0026] c) A single amino acid deletion within 20 amino acids at positions 586 and / or 1593 in the amino acid sequence of SEQ ID No. 9; and / or

[0027] d) An amino acid insertion in the amino acid sequence of SEQ ID No. 9 within 20 amino acids at positions 586 and / or 1593.

[0028] Most preferably, the CeMV-resistant celery plant of the present invention comprises the genome sequence of SEQ ID No. 10, or a sequence having at least 90% sequence identity with SEQ ID No. 10, or a protein comprising the amino acid sequence of SEQ ID No. 12, or a sequence having at least 90% sequence identity with SEQ ID No. 12.

[0029] According to the present invention, the genomic regions or genomic sequences of the present invention are homozygous in the resistant celery plants of the present invention.

[0030] The present invention also relates to a gene providing CeMV resistance in celery, wherein the gene comprises the genomic sequence of SEQ ID No. 10, or a sequence having at least 90% sequence identity with SEQ ID No. 10; a protein encoded by a nucleotide sequence comprising SEQ ID No. 11, or a sequence having at least 90% sequence identity with SEQ ID No. 11; and a protein comprising an amino acid sequence comprising SEQ ID No. 12, or a sequence having at least 90% sequence identity with SEQ ID No. 12.

[0031] The CeMV-resistant celery plant of the present invention is preferably stem celery, root celery or leaf celery.

[0032] In view of the beneficial properties of CeMV celery plant as defined above, the present invention also relates to its seeds or plant parts.

[0033] The present invention also relates to a method for identifying CeMV-resistant celery plants, the method comprising the following steps:

[0034] - Isolate genomic DNA from the celery plant; and

[0035] - Identify the presence of one or more sequences selected from groups consisting of Seq ID Nos. 1 to 6 or 10 in the genome of the celery plant; or

[0036] A method for identifying CeMV-resistant celery plants, the method comprising the following steps:

[0037] - Isolate mRNA from the celery plant; and

[0038] - Determine that the isolated mRNA does not contain cDNA represented by SEQ ID No. 8 and / or contains SEQ ID No. 11.

[0039] The disclosure of the present invention provided herein allows for a method of providing CeMV-resistant celery plants, the method comprising the step of introducing, preferably homozygous, a mutated genomic region as defined above into the genome of a celery plant (preferably a susceptible celery plant) or SEQ ID No. 10.

[0040] The present invention also relates to isolated DNA sequences selected from the group consisting of SEQ ID No. 1 to 6 and SEQ ID No. 10 to 12. Attached Figure Description

[0041] The invention will be further described in detail in the following embodiments. In the embodiments, reference will be made to... Figure 1 ,in

[0042] Figure 1 This shows a sequence alignment of functional proteins originating from susceptible plants with those originating from resistant plants. Figure 1 In the diagram, (*) indicates a position with a single completely conserved residue; (:) indicates conservation between groups with strong similarity properties that score greater than 0.5 on the PAM 250 matrix; and (.) indicates conservation between groups with weak similarity properties that score less than or equal to 0.5 on the PAM 250 matrix.

[0043] Figure 2 This shows a comparison of genomic DNA sequences originating from susceptible plants with those originating from resistant plants. Detailed Implementation

[0044] Example

[0045] Generally, breeding for resistance begins with hybridization between a source of resistance and susceptible genetic material with high agronomic qualities. Resistant progeny are selected using DNA markers and repeatedly backcrossed into agronomically superior parent lines. This process ultimately results in resistant plants with desirable agronomic traits.

[0046] The celery plant Apium graveolens 2290733-1850869-2180293 according to the present invention was deposited on March 2, 2023, with accession number NCIMB 44126 at the British Food Industry and Marine Bacteria Culture Collection (NCIMB Mimitted), Wellheads Place, Dyce, Aberdeen, AB21 7GB, United Kingdom.

[0047] Example 1. Celery mosaic virus (CeMV) disease experiment.

[0048] Sow untreated seeds, allow them to germinate, and grow them in soil for 4 weeks at a diurnal temperature range of 20°C / 10°C and a photoperiod of 16 hours (“day”). After 4 weeks, transplant the plants into 10×5cm pots and allow them to regrow for 3 weeks at 20°C / 18°C. Each plant should have at least 20 individual plants.

[0049] CeMV was used to freeze-dry celery leaves at 4°C. To propagate the virus, susceptible celery plants were mechanically inoculated with CeMV 6 weeks prior to the experiment. Subsequently, CeMV was applied at a concentration of 10 mL. Virus inoculum was prepared from infected leaves using 2g of the inoculum in a buffer (pH 7.0). 15g of carborundum was added to every 500mL of inoculum. The virus suspension was then mechanically inoculated by rubbing the inoculum onto the leaves (three times per leaf). Each test plant was inoculated twice (two days apart).

[0050] The experiment was conducted with a 16-hour photoperiod and a diurnal temperature range of 20°C / 18°C. Three weeks after inoculation, all leaves were removed from the plants. Six weeks after inoculation, virus symptoms were visible in susceptible controls, and the experiment was evaluated using R (resistance) or S (susceptibility).

[0051] Table 1

[0052] plant score NCIMB 44126 R Golden Spartan S

[0053] Following disease trials, the presence of CeMV in the resistance score NCIMB 44126 and the susceptibility score Golden spartan was examined using ELISA (enzyme-linked immunosorbent assay). Leaves were sampled from four plants (including one dummy inoculation) of each genotype. CeMV was detected by ELISA using an RT-0148 apparatus from the Leibniz Institute DSMZ (German Center for Microbial and Cell Culture Collection).

[0054] Leibniz Institute, German Collection of Microbial and Cell Cultures. https: / / www.dsmz.de / collection / catalogue / details / culture / RT-0148

[0055] The ELISA test was negative for NCIMB 44126, indicating the absence of CeMV. The Golden Spartan sample tested positive in the ELISA test, indicating the presence of CeMV. All scores collectively support the claim that NCIMB 44126 is resistant, while Golden Spartan is susceptible to CeMV.

[0056] Example 2. Molecular characterization of CeMV gene-encoded resistance.

[0057] F1S1 populations were formed by crossing a resistant source with a susceptible celery line, and the resulting F1 plants were then self-pollinated. At least 2000 seeds were harvested from the F1S1 generation, which consisted of a unique resistant source crossed with a susceptible celery line. For QTL mapping, 760 hybrids were grown in a greenhouse and CeMV resistance was tested. Leaf material from each individual plant was used for DNA isolation and serial marker analysis. QTLs were identified on linkage group LG02 using SNP markers covering the entire genome. These QTLs were defined by the SNP markers listed in the table below.

[0058] Table 2

[0059]

[0060] *(Res) resistance allele; (Alt) substitution allele.

[0061] Table 3

[0062]

[0063]

[0064] The abbreviation for nucleotides is based on the UPAC code:

[0065] symbol Nucleotide bases A adenine C Cytosine G Guanine T Thymine N A or C or G or T M A or C R A or G W A or T S C or G Y C or T K G or T V Not T H Not G D Not C B Not A

[0066] Example 3. Breeding of high-quality agricultural celery resistant to CeMV.

[0067] In the first step, plants resistant to CeMV (the source) were crossed with a superior strain. The offspring of this cross were then backcrossed with the superior strain (Qline), as shown in Table 4 below. The presence of CeMV resistance was tracked using molecular markers during backcrossing and confirmed in the final step.

[0068] Table 4

[0069]

[0070] Example 4. Production of F1 seeds using CMS

[0071] One of the requirements of modern hybrid varieties is to minimize inbreeding that leads to unwanted heteromorphic plants. In celery, a reliable hybrid production system based on cytoplasmic male sterility is available. Applying this characteristic to seed production of both male and female parent lines, hybrids are produced essentially 100% through pure cross-pollination.

[0072] Example 5. Providing a gene for resistance to CeMV in celery.

[0073] The FASTA file containing the genome of celery variety 'Q2-JN11' (Apium graveolens cv. 'Q2-JN11') was downloaded from CeleryDB**, and the presence of the markers in Table 3 was then searched.

[0074] The marker is mapped to a single chromosomal location on chromosome 10 (a region spanning 8.8 Mbp (Chr10:80246438-89075890)), and 41 genes are located within this region. The chromosome number and location (bp) are the same as in CeleryDB**. One of the genes in this region encodes a eukaryotic translation initiation factor 4G-like (eIF4G) protein. Previous studies have linked this protein to a role in the formation of the 5' cap on RNA.

[0075] Previously, it has been shown that mutations in the eIF4 complex can lead to resistance to different potato virus Y. We hypothesize that a mutation exists in the eIF4G encoding gene of CeMV-resistant celery, and that this mutation prevents CeMV highjacking of celery's translational mechanisms, thereby providing resistance.

[0076] In susceptible plants, eIF4G has the sequence (Seq ID No. 7 for genomic DNA; Seq ID No. 8 for cDNA), see Table 5. The cDNA sequence (Seq ID No. 8) is derived from the notes in CeleryDB**. Resistant plants are homozygous and recessive. In resistant plants, the gene encoding eIF4G (Seq ID No. 7 for genomic DNA; Seq ID No. 8 for cDNA) contains at least one mutation that does not result in the production of (fully) functional eIF4G protein.

[0077] One or more mutations can be of the following types: insertion, deletion, frameshift, substitution, mutation, truncation, and rearrangement.

[0078] **Apium_graveolens_genome_v3 is retrieved from: http: / / celerydb.bio2db.com / index.html

[0079] Subsequently, resistant lines with the resistance gene, such as NCIMB 44126, were sequenced using Nanopore sequencing. After base hopping, de novo genome assemblies were created using Flye. The previously mentioned QTLs were identified on the contigs, and the eIF4G sequence was then extracted from the genome assembly. The results are summarized in Table 6 below.

[0080] The clustalO algorithm was used to compare susceptibility and resistance proteins (https: / / www.ebi.ac.uk / Tools / msa / clustalo / ). This comparison revealed many differences between functional proteins originating from susceptible plants and proteins originating from resistant plants – see [link to documentation]. Figure 1 The protein originating from resistant plants, with 1775 amino acids, is shorter than the functional protein originating from susceptible plants (1245 amino acids). The protein originating from resistant plants has numerous deletions compared to the functional protein. Examples of these deletions are given at amino acid positions 88-103, 120-163, 183-228, 327-350, 485-497, 691-733, 860-886, 940-994, 1022-1092, 1119-1150, 1185-1210, 1562-1580, 1690-1722, and from amino acid 1754 onwards, in the sequence of the functional protein from susceptible plants. In addition, at least two insertions are present in the protein originating from the resistant plant, with the positions referenced to the sequence of the functional protein from the susceptible plant (Seq IDNo 9) at positions 586 and 1593.

[0081] Table 5 - Sequences of susceptible plants.

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092] Table 6 - Sequences of resistant plants.

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103] Domain predictions of functional proteins originating from susceptible plants and non-functional proteins originating from resistant plants (InterPro, https: / / www.ebi.ac.uk / interpro / ) revealed that the latter lacked the Med15 domain. It can be inferred that in resistant plants where the protein lacks the Med15 domain, the virus cannot hijack the protein.

[0104] Example 6. Virus-induced gene silencing assay (VIGS) for silencing the resistance gene encoded in celery.

[0105] Extensive descriptions have been made of VIGS vectors derived from tobacco brittle virus (TRV) for studying gene function in Arabidopsis thaliana, Nicotiana benthamiana, tomato (Lycopersicon esculentum), and other plants. Prior to our experiments, we received plasmids 0155-157pTRV1 and 0158-160pTRV2-MCS from the Arabidopsis Biological Resource Center.

[0106] To confirm that elf4G is involved in the mechanism of resistance to CeMV, VIGS can be used to silence elf4G (as mentioned in Seq ID No. 7 and Seq ID No. 8). For this purpose, a VIGS construct targeting elf4G (Seq ID No. 8) in susceptible plants was designed using siFi21. In addition, a positive VIGS control targeting the PDS gene (plant desaturase) was used. The negative control was an empty vector.

[0107] Susceptible celery plants were targeted with VIGS1, PDS1 (positive control), or an empty plasmid (negative control); the plants were then infected with CeMV (see Example 1). Plants in which VIGS were successfully silenced (for the VIGS1 construct) would develop resistance to CeMV, as confirmed by visual inspection (see Example 1).

[0108]

[0109] Example 7. Crispr-Cas experiment.

[0110] To assess whether wild-type elF4G is indeed an essential gene for CeMV infection in celery plants, it can be knocked out using CRISPR / Cas9. The target site, SEQ ID No. 15, can be used as the guide RNA (gRNA). The CRISPR mechanism (gRNA and Cas9 protein) can be delivered via PEG-mediated transfection of ribonucleoproteins (RNPs) or Agrobacterium-mediated gene transfer. Edited cells are regenerated to obtain live plants, and PCR or sequencing will be used to confirm the CRISPR event. Wild-type plants and mutants can be infected with CeMV, as detailed in Example 1, along with the hypothesis that wild-type plants containing the functional elF4G protein will be infected; mutant plants with edited elF4G will not be infected. Phenotypic scoring can be performed on the experiments.

[0111] target Start termination sequence Seq ID No. 15 eIF4G_cDNA 1382 1406 TTTTCCAAGCGTGGGGAAGCTGCT

[0112]

Claims

1. A CeMV-resistant celery plant comprising a genomic region on chromosome 10 between 80,545 and 80,589 cM, said genomic region containing one or more mutations that cause said CeMV resistance.

2. The CeMV-resistant celery according to claim 1, wherein the mutated genomic region is 8.8 Mbp between base pair positions 80,246,438 and 89,075,890.

3. The CeMV-resistant celery according to claim 1 or 2, wherein the mutated genomic region is derived from, originates from, or is derived from a celery plant deposited in NCIMB with accession number 44126.

4. The CeMV-resistant celery according to any one of claims 1 to 3, wherein one or more mutations result in the absence of a protein encoded by the cDNA sequence represented by SEQ ID No. 8 in the celery plant.

5. The CeMV-resistant celery plant according to any one of claims 1 to 4, wherein one or more mutations are located in the genomic region represented by SEQ ID No.

7.

6. The CeMV-resistant celery plant according to any one of claims 1 to 5, wherein the one or more mutations are deletions, insertions or substitutions in the genomic region represented by SEQ ID No. 7, resulting in the absence of the protein encoded by SEQ ID No. 8 in the resistant celery plant.

7. The CeMV-resistant celery plant according to any one of claims 1 to 6, wherein the one or more mutations are deletions, insertions or substitutions in the cDNA sequence represented by SEQ ID No. 8, resulting in the absence of the protein encoded by SEQ ID No. 8 in the resistant celery plant.

8. The CeMV-resistant celery plant according to any one of claims 1 to 7, wherein the one or more mutations comprise: a) The amino acid sequence of SEQ ID No. 9 has at least four consecutive amino acids deleted in one or more domains, wherein the domains are selected from the group consisting of the domains located at positions 88-103, 120-163, 183-228, 327-350, 485-497, 691-733, 860-886, 940-994, 1022-1092, 1119-1150, 1185-1210, 1562-1580, 1690-1722, and 1754 to the C-terminus; and / or b) Amino acid substitutions in one or more domains of the amino acid sequence of SEQ ID No. 9, wherein the domains are selected from the group consisting of the domains at positions 88-103, 120-163, 183-228, 327-350, 485-497, 691-733, 860-886, 940-994, 1022-1092, 1119-1150, 1185-1210, 1562-1580, 1690-1722 and the domains from position 1754 to the C-terminus; and / or c) A single amino acid deletion in one or more domains of the amino acid sequence of SEQ ID No. 9, wherein the domains are selected from the group consisting of the domains at positions 88-103, 120-163, 183-228, 327-350, 485-497, 691-733, 860-886, 940-994, 1022-1092, 1119-1150, 1185-1210, 1562-1580, 1690-1722 and 1754 to the C-terminus; and / or d) An amino acid insertion in one or more domains of the amino acid sequence of SEQ ID No. 9, wherein the domains are selected from the group consisting of the domains at positions 88-103, 120-163, 183-228, 327-350, 485-497, 691-733, 860-886, 940-994, 1022-1092, 1119-1150, 1185-1210, 1562-1580, 1690-1722 and 1754 to the C-terminus.

9. The CeMV-resistant celery plant according to any one of claims 1 to 8, wherein the one or more mutations comprise: a) The amino acid sequence of SEQ ID No. 9 has at least 4 consecutive amino acids missing from the 20 amino acids at positions 586 and / or 1593; and / or b) Amino acid substitutions in the amino acid sequence of SEQ ID No. 9 within the 20 amino acids at positions 586 and / or 1593; and / or c) A single amino acid deletion within 20 amino acids at positions 586 and / or 1593 in the amino acid sequence of SEQ ID No. 9; and / or d) An amino acid insertion in the amino acid sequence of SEQ ID No. 9 within 20 amino acids at positions 586 and / or 1593.

10. The CeMV-resistant celery plant according to any one of claims 1 to 9, comprising SEQ The genome sequence of SEQ ID No. 10, or a sequence that has at least 90% sequence identity with SEQ ID No.

10.

11. The CeMV-resistant celery plant according to any one of claims 1 to 10, comprising a protein containing the amino acid sequence of SEQ ID No. 12 or a sequence having at least 90% sequence identity with SEQ ID No.

12.

12. The CeMV-resistant celery plant according to any one of claims 1 to 11, wherein the genomic region as defined in any one of claims 1 to 9, or the genomic sequence of claim 10, is homozygous in the resistant celery plant.

13. A gene providing CeMV resistance in celery, wherein the gene comprises the genomic sequence of SEQ ID No. 10, or a sequence having at least 90% sequence identity with SEQ ID No.

10.

14. Celery provides CeMV resistance to a protein, said protein being composed of SEQ ID NO. The nucleotide sequence of No. 11 encodes a sequence that has at least 90% sequence identity with SEQ ID No.

11.

15. Celery provides a CeMV-resistant protein, wherein the protein comprises the amino acid sequence of SEQ ID No. 12, or a sequence having at least 90% sequence identity with SEQ ID No.

12.

16. The CeMV-resistant celery plant according to any one of claims 1 to 15, wherein the celery plant is stalk celery, root celery, or leaf celery.

17. The seeds or plant parts of the CeMV celery plant according to any one of claims 1 to 16.

18. A method for identifying CeMV-resistant celery plants, the method comprising the following steps: - Isolate genomic DNA from the celery plant; and - Identify the presence of one or more sequences selected from groups consisting of Seq ID No. 1 to 6 or 10 in the genome of the celery plant.

19. A method for identifying CeMV-resistant celery plants, the method comprising the following steps: - Isolate mRNA from the celery plant; and - Determine that the isolated mRNA does not contain cDNA represented by SEQ ID No. 8 and / or contains SEQ ID No.

11.

20. A method for providing CeMV-resistant celery plants, the method comprising the step of introducing a mutated genomic region as defined in any one of claims 1 to 9 into the genome of a celery plant or SEQ ID No. 10, wherein the celery plant is preferably a susceptible celery plant.

21. An isolated DNA sequence selected from the group consisting of SEQ ID No. 1 to 6 and SEQ ID No. 10 to 12.