Plant lactobacillus Z07 and application thereof in prune fermentation

By fermenting prune juice with Lactobacillus plantarum Z07, the problems of insufficient flavor and poor stability of prune juice were solved, and fermented prune juice with blueberry aroma was produced, improving flavor and shelf life.

CN120938017AActive Publication Date: 2025-11-14SICHUAN CHENGDU CENT AGRI UNIV MODERN AGRI IND RES INST +1
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
CN202511475881.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-16
Publication Date
2025-11-14
Estimated Expiration
2045-10-16

AI Technical Summary

Technical Problem

The existing prune juice is prone to producing unpleasant odors during fermentation, with insufficient release of aroma substances or poor stability, resulting in poor flavor harmony and a short shelf life, which limits its transportation and sales scope.

Method used

Fermented prune juice with blueberry aroma was prepared by fermenting prune juice with Lactobacillus plantarum Z07 through enzymatic hydrolysis and pH adjustment. The specific steps included activating the strain, enzymatic hydrolysis of prune pulp, filtration, pH adjustment and fermentation.

Benefits of technology

It significantly enhances the flavor of prune juice, especially the floral and fruity aromas, increases its nutritional value, improves the richness and stability of its flavor, and extends its shelf life.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120938017A_ABST
    Figure CN120938017A_ABST
Patent Text Reader

Abstract

The invention discloses a plant lactobacillus Z07 strain and application thereof in prune fermentation, and belongs to the technical field of microorganisms and food biology. In order to solve the problems that existing fermented prune juice is insufficient in aroma substance release, low in characteristic aroma concentration and insufficient in overall flavor coordination, the prune juice is subjected to enzymolysis treatment before fermentation, so that formation of pleasant flavors such as blueberry aroma is promoted; the fermented prune juice which is better in flavor and quality and particularly has obvious blueberry fragrance characteristics is prepared by further applying the plant lactobacillus Z07.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a strain of Lactobacillus plantarum Z07 and its application in plum fermentation, belonging to the field of microbial and food biotechnology. Background Technology

[0002] Lactobacillus plantarum ( Lactiplantibacillus plantarum Lactobacillus is a Gram-positive lactic acid bacterium, morphologically short rod-shaped, arranged singly, in pairs, or in short chains, typically 0.9-1.2 μm × 3.0-8.0 μm in size. It is a facultative anaerobe, with an optimal growth temperature of 30-37℃ and an optimal pH of around 6.5. It is widely found in fermented foods, on plant surfaces, and in the human gut, and can survive in various environments; therefore, it is frequently used in probiotic preparations.

[0003] *Lactobacillus plantarum* is a widely used lactic acid bacterium in fermented foods, possessing significant flavor-modifying capabilities. During fermentation, it metabolizes sugars and amino acids to produce various flavor compounds, such as organic acids, alcohols, esters, and aldehydes, which collectively impart a unique flavor to the product. Furthermore, *Lactobacillus plantarum* can break down bitter precursors, reducing the astringency of fermented foods and improving the overall harmony of the taste. Due to its strong adaptability, stable growth, and abundant metabolic products, this bacterium is widely used in fermented foods such as yogurt, kimchi, and fruit and vegetable juices, becoming an important microbial resource for enhancing the natural flavor and texture of these foods.

[0004] Currently, most prune drinks on the market are processed using fresh-squeezing. While this method preserves the natural color and nutrients of prunes well, fresh-squeezed prune juice has a relatively simple flavor. Furthermore, fresh-squeezed prune juice has a short shelf life and usually requires refrigeration, limiting its transportation and sales scope. In contrast, fermentation utilizes microbial metabolism to produce lactic acid, alcohols, and esters, giving prune juice a unique sweet-sour balance and complex aroma, improving its flavor richness and appeal. In addition, fermentation can increase the nutritional value of prune juice, offering potential health benefits. However, fermented prunes still have the following problems to be solved: unpleasant odors are easily produced during fermentation, which can mask the inherent fruity aroma of prunes to some extent. Also, insufficient release or poor stability of aroma substances under different processing techniques leads to low concentrations of characteristic aromas that are prone to decay during storage, making it difficult to maintain the product's flavor. Furthermore, some samples have a prominent sour taste and an unbalanced sweet-sour ratio, resulting in insufficient overall flavor harmony. Therefore, how to obtain fermented prune juice with a prominent fruity aroma through suitable strains and processes remains a problem to be solved. Summary of the Invention

[0005] Technical issues The technical problem to be solved by the present invention is to provide an improved prune juice fermentation process, and in particular, to provide a preparation process for fermented prune juice with blueberry aroma.

[0006] Technical solution This invention first isolates and purifies a strain of *Lactobacillus plantarum* from a plum sample. Lactiplantibacillus plantarum The Z07 strain, when used to ferment prune juice, significantly enhances its flavor, especially in terms of floral and fruity aromas.

[0007] This invention provides the application of Lactobacillus plantarum ( L. plantarum The method for fermenting prune juice, wherein the plant lactobacillus ( L. plantarum The sample is Lactobacillus plantarum Z07, which was deposited on May 30, 2025 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34721 and address at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The method includes the following steps: (1) Activated Lactobacillus plantarum ( L. plantarum Z07 was used to prepare a seed culture of *Lactobacillus plantarum* Z07. (2) Prune pulp was enzymatically hydrolyzed using pectinase, and then filtered to obtain prune juice; (3) Adjust the pH of the prune juice to 5 and sterilize it; (4) Inoculate the sterilized prune juice with Lactobacillus plantarum Z07 seed liquid for fermentation to obtain fermented prune juice with blueberry aroma.

[0008] In some embodiments of the present invention, the blueberry aroma is evaluated in the fermented plum juice according to the standards in the national standard GB / T 29605-2013 "Sensory Analysis Guidelines for Sensory Quality Control of Food". The content of the volatile substances corresponding to the blueberry aroma is approximately as follows: phenylethanol 12349.91±183.43 μg / L, isoamyl alcohol 9138.56±654.32 μg / L, eugenol 639.83±68.89 μg / L, phenethyl acetate 344.85±12.47 μg / L, linalool 199.89±9.47 μg / L, and damascene 193.79±23.97 μg / L.

[0009] In some embodiments of the present invention, step (1) involves: transferring 100 μL of bacterial culture from a thawed glycerol storage tube to 8 mL of MRS broth medium and culturing at 37°C for 24 h for initial activation. Then, 100 μL of the bacterial culture from the initial activation medium is transferred to 8 mL of MRS broth medium and cultured at 37°C for 24 h for secondary activation. The bacterial culture obtained after secondary activation is centrifuged at 10000 r / min and 4°C for 5 min, and the supernatant is discarded. The OD of the bacterial culture is adjusted with sterile physiological saline. 600 The value is 0.9, used as seed solution.

[0010] In some embodiments of the present invention, step (2) involves adding 0.2% (v / v) of pectinase XXL to the prune pulp, reacting at 50°C for 2 hours, and then filtering with 100-mesh gauze to obtain prune juice.

[0011] In some embodiments of the present invention, step (3) involves adjusting the pH of the prune juice to approximately 5.00 using food-grade baking soda, so that the pH of the prune juice is conducive to the growth of *Lactobacillus plantarum*. Then, the prune juice is pasteurized; optionally, the core temperature of the prune juice is maintained at 65°C for 30 minutes.

[0012] In some embodiments of the present invention, step (4): after the sterilized prune juice is cooled, the seed liquid is added to the prune juice at an inoculation rate of 1% (V / V), and fermented in a constant temperature incubator at 37 ℃ for 4 days. After the fermentation is completed, fermented prune juice with blueberry aroma is obtained.

[0013] This invention provides *Lactobacillus plantarum* for fermenting prune juice (… Lactiplantibacillus plantarum Lactobacillus plantarum Z07 was deposited on May 30, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 34721, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Its 16S rDNA nucleotide sequence is shown in SEQ ID NO:1.

[0014] The present invention provides a microbial preparation containing the aforementioned Lactobacillus plantarum Z07.

[0015] In one embodiment of the present invention, the number of *Lactobacillus plantarum* Z07 cells in the microbial preparation is not less than 1 × 10⁻⁶. 8 CFU / mL or 1×10 8 CFU / g.

[0016] The present invention provides a product containing the aforementioned Lactobacillus plantarum Z07 or a product containing the aforementioned microbial preparation.

[0017] In one embodiment of the present invention, the product includes food, medicine, or daily chemical products.

[0018] In one embodiment of the present invention, the food includes health food.

[0019] Beneficial effects This invention involves enzymatic hydrolysis of the prune pulp before fermentation to promote the formation of pleasant flavors such as blueberry aroma. Furthermore, it utilizes Lactobacillus plantarum Z07 for fermentation to produce fermented prune juice with even better flavor and quality, especially with a distinct blueberry aroma.

[0020] This invention utilizes *Lactobacillus plantarum* ( L. plantarum Fermentation of prune juice using Z07 significantly enhanced its blueberry aroma. The fermented prune juice contained 12349.91±183.43 μg / L of phenylethyl alcohol, 9138.56±654.32 μg / L of isoamyl alcohol, 639.83±68.89 μg / L of eugenol, 344.85±12.47 μg / L of phenethyl acetate, 199.89±9.47 μg / L of linalool, and 193.79±23.97 μg / L of damascene.

[0021] The plant lactobacillus (Lactobacillus plantarum) provided by this invention L. plantarum Z07 exhibits antibacterial properties, with inhibition zones of 15.83±0.18 cm, 20.87±0.06 cm, and 21.17±0.18 cm against Staphylococcus aureus, Escherichia coli, and Listeria monocytogenes, respectively. It demonstrates good tolerance to bile salts and the gastrointestinal environment; after 12 hours of culture in 0.3% bile salts, the survival rate was 110.00±3.50%; after 6 hours of culture in a low-acid environment at pH 2.0, the survival rate was 98.66±1.26%; and after in vitro digestion, the survival rate was 74.11%. *Lactobacillus plantarum* Z07 has sufficient safety, exhibiting no hemolysis and suitable antibiotic resistance.

[0022] Preservation of biological materials Lactobacillus plantarum ( Lactiplantibacillus plantarum Z07, taxonomically named Lactiplantibacillus plantarum It was deposited on May 30, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34721, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0023] Figure 1 Image of Lactobacillus plantarum Z07 colonies; Figure 2 Phylogenetic tree of Lactobacillus plantarum Z07; Figure 3 A bar chart showing the acid resistance of Lactobacillus plantarum Z07; Figure 4 A bar chart showing the bile salt tolerance of Lactobacillus plantarum Z07; Figure 5 Bar chart showing the resistance of Lactobacillus plantarum Z07 to in vitro digestion; Figure 6 A bar chart showing the hydrophobicity of Lactobacillus plantarum Z07; Figure 7 Bar chart showing the self-aggregation ability of Lactobacillus plantarum Z07; Figure 8 Image showing hemolytic activity of *Lactobacillus plantarum* Z07; Staphylococcus aureus is in the center of the plate, and the three outermost colonies are all *Lactobacillus plantarum* Z07; Figure 9 Bar chart showing the antioxidant capacity of Lactobacillus plantarum Z07; Figure 10 The diagram shows the pH changes during the fermentation of prune juice by Lactobacillus plantarum Z07, LP90, and LP3. Figure 11 A bar chart for determining the viable count of *Lactobacillus plantarum* Z07, LP90, and LP3 in fermented prune juice; Figure 12 Bar chart showing the reducing sugar content of prune juice and prune juice fermented with Lactobacillus plantarum Z07, LP90, and LP3; Figure 13 Sensory evaluation scores for prune juice and prune juice fermented with Lactobacillus plantarum Z07, LP90, and LP3 are shown in the graph. Figure 14 Radar graph of aroma descriptors for prune juice fermented with Lactobacillus plantarum Z07, LP90, and LP3. Detailed Implementation

[0024] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the experimental materials used in the following examples are all available through conventional commercial channels. Pectinase XXL was purchased from Novozymes.

[0026] The experimental materials involved in the following experiments are as follows: Lactobacillus plantarum ( L. plantarumStrain Z07 was isolated from plum samples collected in Kashgar, Xinjiang, China, and stored in glycerol tubes at -80°C. Under normal circumstances, colonies can be obtained by inoculating the strain onto the surface of MRS solid medium plates and incubating them upside down in a 37°C anaerobic incubator for 24 hours. Fermentation broth can be obtained by picking single colonies and culturing them in MRS liquid medium.

[0027] MRS solid culture medium containing calcium carbonate: 5g beef extract, 10g peptone, 4g yeast extract, 2g triammonium citrate, 3g anhydrous sodium acetate, 20g glucose·H2O, 2g dipotassium hydrogen phosphate, 1mL Tween 80, 0.2g MgSO4·7H2O, 0.037g manganese sulfate, 5g CaCO3, 15g agar. Add deionized water to make up to 1L, adjust pH to 6.5, autoclave at 121℃ for 20min, and prepare MRS plates.

[0028] MRS liquid culture medium: 5g beef extract, 10g peptone, 4g yeast extract, 2g triammonium citrate, 3g anhydrous sodium acetate, 20g glucose·H2O, 2g dipotassium hydrogen phosphate, 1mL Tween 80, 0.2g magnesium sulfate·MgSO4·7H2O, 0.037g manganese sulfate, add deionized water to make up to 1L, adjust pH to 6.5, autoclave at 121℃ for 20min to prepare MRS liquid culture medium.

[0029] Example 1: Lactobacillus plantarum ( L. plantarum Isolation and Identification of Strain Z07 Lactobacillus plantarum ( L. plantarum The Z07 strain was isolated from plum samples collected in Kashgar, Xinjiang, China, as follows: One kg of plums harvested from Kashgar, Xinjiang, was naturally fermented in a sterile Erlenmeyer flask. One g of the sample was taken daily and suspended in 9 mL of sterile physiological saline solution (0.85% (w / v)). The mixture was shaken thoroughly to obtain a plum bacterial suspension. One mL of this plum bacterial suspension was then thoroughly mixed with 9 mL of sterile water to obtain 10... -2 Gradient, and so on, dilution to obtain 10 -3 10 -4 10 -5 and 10 -6 The concentrations were determined. Using sterile pipettes, 100 μL volumes of each serial dilution were evenly spread onto MRS agar plates in petri dishes and incubated at 37°C for 2 days. Colonies with calcified zones and milky-white protrusions were selected, and single colonies were then streaked onto fresh MRS agar plates and incubated at 37°C for 48 hours to obtain pure bacterial colonies. The results are as follows: Figure 1 As shown.

[0030] The purified bacterial colonies were transferred to MRS slant agar, and the 16S rDNA of the isolated strain was sequenced using universal 16S rDNA primers (F: AGAGTTTGATCCTGGCTCAG, R: TACGGCTACCTTGTTACGACTT) at Sangon Biotech Ltd. The 16S rDNA sequence is shown in SEQ ID NO:1. The obtained sequence was compared with the NCBI Genome database using BLAST. The results showed that strain Z07 is similar to the known *Lactobacillus plantarum* (…). Lactiplantibacillus plantarum The 16S rDNA sequence showed >99% homology and was subjected to evolutionary analysis with homologous strains. Figure 2 This confirms that the strain is a different strain of the same species of Lactobacillus plantarum.

[0031] The *Lactobacillus plantarum* Z07 has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34721, on May 30, 2025, and is classified as *Lactobacillus plantarum*. Lactiplantibacillus plantarum .

[0032] SEQ ID NO:1: Example 2: Prebiotic Performance Test of Lactobacillus plantarum Z07 The acid and bile salt resistance, in vitro digestion resistance, surface hydrophobicity and self-aggregation ability, antibacterial ability, safety and antioxidant capacity of Lactobacillus plantarum Z07 were tested.

[0033] The details are as follows.

[0034] A: Detection of the acid and bile salt tolerance of Lactobacillus plantarum Z07 The pH of the MRS liquid culture medium was adjusted to 2, 2.5, and 3 using hydrochloric acid, respectively. The activated *Lactobacillus plantarum* Z07 culture medium was then inoculated with 1×10⁻⁶ hydrochloric acid. 8 Inoculation with CFU / mL was performed in culture media at different pH values ​​and incubated statically at 37°C. After 3 hours of incubation, the fermentation broth was diluted to appropriate gradients and inoculated onto MRS solid medium. After 24 hours of incubation at 37°C, viable bacteria were counted. The control group consisted of viable bacteria after 0 hours of acid treatment. The survival rate of lactic acid bacteria was calculated using the following formula: Survival rate (%) = 3h viable bacteria count / 0h viable bacteria count × 100%.

[0035] In the human digestive system, the pH value of the stomach is typically between 1.5 and 3.5. Therefore, pH=2.00, pH=2.50, and pH=3.00 are very suitable for simulating the acidic environment of the stomach. The survival of *Lactobacillus plantarum* Z07 in these acidic environments demonstrates the strain's strong acid resistance. Figure 3 As shown, the survival rate was 98.66±1.26% at pH 2, indicating that the strain could still survive and exhibited good acid resistance despite the strong acidity. Particularly at pH 2.5 and pH 3, the survival rates reached 110.70±3.52% and 119.90±1.90%, respectively, even exceeding the initial survival rate at pH 3. Therefore, *Lactobacillus plantarum* Z07 can effectively cross the acidic environment of the stomach and enter the intestines, demonstrating its potential probiotic properties.

[0036] Different concentrations of bile salt solutions (0, 0.15%, 0.3%) (w / v) were prepared, and *Lactobacillus plantarum* Z07, which had been activated twice, was injected with 1×10⁻⁶ bile salts at different concentrations. 8 The inoculum was inoculated at a concentration of CFU / mL into MRS liquid medium containing different concentrations of bile salts (0, 0.15%, 0.3%) and incubated statically at 37°C. After 12 hours of incubation, the fermentation broth was diluted to an appropriate gradient and inoculated into MRS solid medium. After 24 hours of incubation at 37°C, viable bacteria were counted. The control group consisted of viable bacteria with a bile salt concentration of 0%. The survival rate of lactic acid bacteria was calculated.

[0037] Bile salts are important components of digestive fluids in the intestines, with concentrations ranging from approximately 0.1% to 0.3%. Choosing bile salt concentrations of 0%, 0.15%, and 0.3% for tolerance testing reflects the actual conditions of the human intestinal environment. Figure 4 As shown, *Lactobacillus plantarum* Z07 exhibited a survival rate of 104.90 ± 0.90% under 0% bile salt conditions, indicating that the strain can grow normally in the absence of bile salts. With increasing bile salt concentration, the survival rate decreased, but remained high at 0.15% and 0.3% bile salt concentrations, at 100.5 ± 1.40% and 110.0 ± 3.50%, respectively. This indicates that the strain has strong bile salt tolerance and can adapt to the bile acid environment in the intestine. Therefore, *Lactobacillus plantarum* Z07 can grow stably in the intestine and exert its probiotic effects.

[0038] B: Detection of the resistance of Lactobacillus plantarum Z07 to in vitro digestion (1) Preparation of artificial saliva: According to the formula shown in Table 1, prepare 20 mL of oral electrolyte solution and adjust the pH value to 7. Then add 2000 U / mL α-amylase. After it is dissolved evenly, sterilize it with a microporous filter membrane and set it aside.

[0039] (2) Preparation of artificial gastric fluid: According to the formula shown in Table 1, prepare 40 mL of gastric electrolyte solution and adjust the pH value to 3. Then add 2000 U / mL pepsin and 60 U / mL lipase. After they are dissolved evenly, sterilize with microporous filter membrane and set aside. (3) Preparation of artificial intestinal fluid: According to the formula shown in Table 1, prepare 80 mL of intestinal phase electrolyte solution and adjust the pH value to 7. Then add 100 U / mL pancreatic enzyme and 0.3 mg / mL bile salt. After they are dissolved evenly, sterilize with microporous filter membrane and set aside.

[0040] After activating Lactobacillus plantarum Z07 twice, the resulting bacterial solution (with a viable count of 1×10⁻⁶) was... 8 (CFU / mL) was mixed with artificial saliva at a 1:1 volume ratio and incubated at 37℃ for 2 min. Then, the resulting mixture was mixed with artificial gastric juice at a 1:1 volume ratio and incubated at 37℃ with a shaking incubator at 120-150 r / min for 2 h to simulate gastric digestion. Subsequently, the digested mixture was mixed with artificial intestinal juice at a 1:1 volume ratio and incubated at 37℃ for 2 h to simulate intestinal digestion. The survival rate of lactic acid bacteria was calculated by measuring the number of viable bacteria before and after simulated digestion. The results showed that ( Figure 5After in vitro simulated digestion, the viable count of *Lactobacillus plantarum* Z07 decreased from 7.53 lg CFU / mL to 5.58 lg CFU / mL, representing 74.11% of the pre-digestion count. This indicates that the strain maintained high activity during simulated digestion. Simulated digestion mimics the functions of the human oral cavity and gastrointestinal tract, which typically inhibits the growth of probiotics. Therefore, maintaining a near-original viable count demonstrates that *Lactobacillus plantarum* Z07 possesses good digestibility and can survive and enter the intestine under simulated digestive conditions. This result further supports the potential of this strain as a probiotic in the human digestive tract, especially its ability to maintain activity under the harsh conditions of the digestive system, laying the foundation for its probiotic effects.

[0041] Table 1. Electrolyte solution formulation composition

[0042] C: Detection of surface hydrophobicity and self-aggregation ability of Lactobacillus plantarum Z07 (1) Determination of cell surface hydrophobicity Lactobacillus plantarum Z07 was activated twice, and then cultured to form a bacterial suspension. The suspension was then aliquoted into 50mL centrifuge tubes, centrifuged, washed 2-3 times with PBS, and the OD value was adjusted. 600 The value was 0.5 ± 0.02, recorded as A0; 3 mL of xylene was added to an equal volume of bacterial suspension and vortexed for 1 min; the mixture was then co-cultured at 37 °C for 5 h; after the two phases separated, the aqueous phase was taken and its absorbance at 600 nm was measured and recorded as A2; the independent experiment was repeated three times.

[0043] The formula for calculating hydrophobicity is: Hydrophobicity (%) = (A0 - A2) / A0 × 100%.

[0044] Bacterial affinity for organic reagents is widely used to measure the cell surface characteristics of lactic acid bacteria, and it can also provide a preliminary assessment of the bacteria's ability to bind to host epithelial cells. This experiment evaluated the hydrophobicity of lactic acid bacteria to the organic solvent xylene. Figure 6 It can be seen that the hydrophobicity of *Lactobacillus plantarum* Z07 to xylene is 67.65±2.40%. Under the same conditions, the hydrophobicity of the *Lactobacillus rhamnosus* LGG control group is 42.27±2.46%. The results indicate that *Lactobacillus plantarum* Z07 has a high ability to adhere to cells.

[0045] (2) Determination of self-aggregation ability Adjusting the OD of Lactobacillus plantarum Z07 600 The result was 0.5 ± 0.02, recorded as A0; 4 mL of bacterial suspension was taken and allowed to stand at 37℃ for 24 h; the absorbance of the supernatant was measured at a wavelength of 600 nm and recorded as A. 24Repeat the independent experiment three times.

[0046] The formula for calculating self-aggregation ability is: Self-aggregation ability (%) = (A0 - A 24 ) / A0×100%.

[0047] Self-aggregation ability can be used as a preliminary characterization of the adhesion ability of potential probiotics to intestinal epithelium and other cells. Self-aggregation is mainly the ability of bacteria to interact with the organism in a non-specific way, which is an important condition for intestinal colonization. Figure 7 The study showed that *Lactobacillus plantarum* Z07 exhibited a self-aggregation ability of 78.77±1.95% after incubation at 37℃ for 24 h, which was higher than that of *Lactobacillus rhamnosus* LGG (45.11±1.79%). This strain demonstrated excellent colonization ability in the gut.

[0048] D: Detection of the antibacterial ability of Lactobacillus plantarum Z07 Antibacterial activity was determined using the Oxford cup method, and the antibacterial ability of the strain was expressed as the diameter of the inhibition zone.

[0049] 1. Inoculate *Lactobacillus plantarum* Z07 into MRS broth medium and incubate at 37℃ and 150 r / min on a shaker for 24 h. Then, take the *Lactobacillus plantarum* Z07 bacterial suspension (viable count 1×10⁻⁶). 8 Centrifuge (CFU / mL) to obtain the supernatant for later use.

[0050] 2. Staphylococcus aureus BNCC186335, Escherichia coli BNCC133264, and Listeria monocytogenes BNCC185986 were inoculated into nutrient broth medium and cultured at 37℃ and 150 r / min on a shaker for 24 h to obtain seed cultures for later use. Nutrient agar was sterilized at 121℃ for 30 min and cooled to approximately 55℃. The above pathogenic bacterial seed cultures were then added at a dosage of 0.1% v / v to achieve an inoculation concentration of (1-2) × 10⁻⁶. 5 CFU / mL, pour into a plate, and use after cooling and solidification.

[0051] 3. Place 3-4 sterile Oxford cups evenly in the plate obtained in step 2, add 200 μL of the supernatant obtained in step 1 to each Oxford cup, incubate at 37℃ for 24 h, measure the diameter of the inhibition zone, and repeat each treatment three times.

[0052] The antibacterial substances produced by probiotics play an important role in regulating the intestinal flora, and their antibacterial activity has great potential in food preservation and antiseptic processes. The results, shown in Table 2, indicate that *Lactobacillus plantarum* Z07 has good inhibitory ability against three common intestinal pathogens, and its effect is superior to the control strain *Lactobacillus rhamnosus* LGG.

[0053] Table 2. Inhibitory effect of Lactobacillus plantarum Z07 on three pathogenic bacteria.

[0054] E: Safety testing of Lactobacillus plantarum Z07 (1) Hemolysis test. The activated Lactobacillus plantarum Z07 strain was streaked onto Columbia blood agar medium and incubated at 37°C for 24 h. Staphylococcus aureus was used as a positive control strain to observe whether hemolysis occurred.

[0055] Because many bacteria produce hemolysins that cause blood cell lysis and death, leading to disease in the host, the safety of these bacteria used in food or pharmaceuticals cannot be guaranteed. Therefore, hemolysis testing is a crucial part of the in vitro safety assessment of probiotics to ensure their safe application in the food and pharmaceutical industries. Figure 8 As shown, the Staphylococcus aureus in the center of the plate exhibits β-hemolysis; the three surrounding spots are all Lactobacillus plantarum Z07, which do not exhibit β-hemolysis, indicating that the hemolytic safety of this strain meets the standards.

[0056] (2) Determination of antibiotic resistance. The susceptibility of the strain to antibiotics was determined by the antimicrobial susceptibility test disc agar diffusion method. The activated Lactobacillus plantarum Z07 strain was cultured overnight for 24 h and then evenly spread on MRS plates. Eight antimicrobial susceptibility test discs for penicillin, erythromycin, kanamycin, tetracycline, chloramphenicol, vancomycin, ciprofloxacin and metronidazole were evenly attached to the surface of the MRS plate. The discs were gently pressed with tweezers to prevent them from falling off. The plates were then incubated at 37℃ for 24 h. The diameter of the inhibition zone of each disc was measured. The average value was taken from three measurements.

[0057] Table 3. Sensitivity of Lactobacillus plantarum Z07 to 8 antibiotics

[0058] Note: d is the diameter of the inhibition zone of antibiotic susceptibility testing discs against lactic acid bacteria, expressed as "-" d≤5mm; "+" 5mm≤d<15mm; "++" 15mm≤d<25mm; "+++" d≥25mm.

[0059] To ensure the safe application of *Lactobacillus plantarum* Z07 in the food and pharmaceutical industries, the safety of the strain was further evaluated in terms of antibiotic susceptibility. Table 3 shows that the strain is sensitive to most of the eight antibiotics tested, particularly erythromycin, tetracycline, chloramphenicol, and vancomycin. However, it exhibits weaker sensitivity or resistance to metronidazole, kanamycin, and vancomycin, but this does not necessarily indicate a safety risk. Studies have shown that probiotics can develop resistance to specific antimicrobial drugs, which could increase their application. These probiotics can work synergistically with antibiotics, helping to restore the gut microbiota.

[0060] F: Detection of antioxidant capacity of Lactobacillus plantarum Z07 After inoculating Lactobacillus plantarum Z07 into MRS liquid medium and culturing for 24 h, the bacterial cells were collected by centrifugation at 10,000 rpm and 4 °C for 5 min. The bacterial cells were washed twice with sterile physiological saline and resuspended to obtain a bacterial suspension with an optical density of 5.0 at 600 nm for subsequent detection.

[0061] Determination of DPPH free radical scavenging capacity. For the sample group, 1 mL of DPPH solution (0.2 mmol / L ethanol solution) was thoroughly mixed with 1 mL of bacterial suspension. After reacting in the dark at room temperature for 30 min, the mixture was centrifuged at 4000 r / min for 5 min, and the absorbance of the resulting supernatant was measured at 517 nm. PBS was used as a blank control group instead of bacterial suspension, and PBS was used as a reaction solution group without DPPH, with absorbance measured at 517 nm (A2) for calculating the DPPH scavenging rate.

[0062] The formula for calculating DPPH clearance rate is: DPPH clearance rate (%) = [(A0–A1+A2) / A0]×100.

[0063] In the formula: A0 is the absorbance of the blank control group; A1 is the absorbance of the sample group; A2 is the absorbance of the reaction solution without DPPH.

[0064] The results showed that *Lactobacillus plantarum* Z07 exhibited a DPPH scavenging rate of 87.94 ± 2.66%, demonstrating good antioxidant properties. Figure 9 ).

[0065] Example 3: Fermentation of prune juice using Lactobacillus plantarum Z07 Z07 Enzymatic digestion group: (1) Activation of bacterial strains and preparation of bacterial suspension 100 μL of bacterial suspension was transferred from a thawed glycerol storage tube to 8 mL of MRS broth medium and incubated at 37°C for 24 h for initial activation. Then, 100 μL of the activated bacterial suspension was transferred to 8 mL of MRS broth medium and incubated at 37°C for 24 h for secondary activation. The resulting bacterial suspension was centrifuged at 10000 r / min at 4°C for 5 min, and the supernatant was discarded. The OD of the bacterial suspension was adjusted with sterile physiological saline. 600 The value is 0.9.

[0066] (2) Enzymatic hydrolysis Blend the prunes until they are smooth and even, ensuring there are no large chunks of flesh, but avoid crushing the seeds to obtain prune puree.

[0067] Add 0.2% (v / v) of pectinase XXL to the prune puree and react at 50℃ for 2 hours. Then filter through 100-mesh gauze to obtain prune juice.

[0068] (3) pH adjustment and sterilization of prune juice Prune juice has a low pH of approximately 3.90, which is not conducive to the healthy growth of lactic acid bacteria. Use food-grade baking soda to adjust the pH of the prune juice to around 5.00.

[0069] The prune juice is pasteurized to maintain its core temperature at 65°C for 30 minutes.

[0070] (4) Lactic acid bacteria fermentation process for prune juice After the sterilized prune juice has cooled, the bacterial suspension is added to the prune juice at an inoculation rate of 1% (V / V), and the mixture is incubated in a constant temperature incubator at 37 ℃ for 4 days. Fermented prune juice is obtained after the fermentation is completed.

[0071] Z07 Non-enzymatic hydrolysis group: The Z07 non-enzymatic hydrolysis group was set as the control group. The difference between the Z07 non-enzymatic hydrolysis group and the Z07 enzymatic hydrolysis group is that the prune pulp was not treated with pectinase hydrolysis.

[0072] The LP90 enzymatic digestion group differs from the Z07 enzymatic digestion group in that it replaces *Lactobacillus plantarum* Z07 with *Lactobacillus plantarum* (…). L. plantarum LP90.

[0073] LP3 enzymatic digestion group: The difference from the Z07 enzymatic digestion group is that *Lactobacillus plantarum* Z07 is replaced with *Lactobacillus plantarum* (…). L. plantarum LP3, this bacterium was purchased from the China Industrial Microbial Culture Collection Center, number CICC 21805.

[0074] (5) Determination of basic physicochemical indicators The pH of the prune juice during fermentation was measured using a pH meter at room temperature, and the results are as follows: Figure 10The corresponding curves for the Z07 enzymatic hydrolysis are shown. During fermentation, the pH of the prune juice decreased from 5.00 to approximately 3.90, due to the large amount of organic acids produced during lactic acid bacteria fermentation. The lower pH at the end of fermentation in the non-enzymatic Z07 group may inhibit the activity of the lactic acid bacteria themselves, while the higher pH at the end of fermentation in the enzymatic Z07 group results in a better flavor balance in the fermented prune juice, making it more acceptable to consumers while retaining more active ingredients.

[0075] The viable count of lactic acid bacteria in the prune juice at the end of fermentation was determined according to GB4789.35-2023, "National Food Safety Standard - Microbiological Examination of Food - Lactic Acid Bacteria Examination". The results are as follows: Figure 11 As shown in the figure. At the end of fermentation, the number of viable lactic acid bacteria in the prune juice exceeded 8 1 g CFU / mL, indicating that the lactic acid bacteria grew and multiplied well in the juice, had high fermentation activity, and were well matched with the prune juice substrate.

[0076] Reducing sugars are the main carbon source utilized by lactic acid bacteria during lactic acid fermentation, in which they produce lactic acid and other organic acids. The reducing sugar content in prune juice before and after fermentation was determined using the 3,5-dinitrosalicylic acid method. 2.0 mL of diluted sample was taken, 2.0 mL of DNS reagent was added, and after thorough mixing, the mixture was heated in a boiling water bath for 5 min. After cooling to room temperature, the solution was brought to a final volume of 10 mL, and the absorbance was measured at 540 nm. A standard curve was plotted using glucose standards dried to constant weight at 105 ℃ to determine the reducing sugar content.

[0077] The results are as follows Figure 12 As shown in the figure, after lactic acid bacteria fermentation, the reducing sugar content of prune juice decreased significantly, indicating that the fermentation process was effectively initiated and continued. Meanwhile, the reducing sugar content at the end of fermentation in the Z07 enzymatic hydrolysis group was higher than that in the Z07 non-enzymatic hydrolysis group, indicating that pectinase releases more potential fermentable carbon sources by degrading pectin, cellulose, and other substances, thereby enhancing substrate utilization and fermentation efficiency. Pectinase can also release more aromatic precursors and soluble polyphenols bound to pectin, thus enhancing the flavor.

[0078] The fermented prune juice was subjected to sensory evaluation according to Table 4, and the results are as follows: Figure 13As shown. Compared with the prune juice without fermentation in step (4), the prune juice fermented with Lactobacillus plantarum Z07 after enzymatic hydrolysis showed improvements in aroma (21.05±3.22) and texture (14.55±3.11). The LP90 enzymatic hydrolysis group had limited effect on the release of aroma precursors and flavor enhancement, with only a slight advantage in texture. The Z07 non-enzymatic hydrolysis group had the lowest aroma and taste scores, indicating that without the aid of enzymatic hydrolysis, this strain could not fully release aromatic substances or improve flavor, resulting in poor overall sensory quality. The LP3 enzymatic hydrolysis group was inferior to the Z07 enzymatic hydrolysis group in aroma and taste, and did not stand out in color and texture, with the overall improvement effect falling short of expectations.

[0079] Table 4 Sensory Evaluation Form

[0080] The aroma sensory evaluation of fermented prune juice was conducted in accordance with the standards in the national standard GB / T 29605-2013, "Guidelines for Sensory Quality Control of Foods in Sensory Analysis". 30 ml of each type of fermented prune juice and unfermented prune juice were placed in tasting cups, coded with a three-digit random number, and presented to the sensory evaluators. The sensory evaluators were required to carefully smell each sample and score the prune puree and fermented prune juice based on their preference. Then, aroma descriptive radar charts were drawn for the prune juice without fermentation step (4) and the fermented prune juice. The results are as follows: Figure 14 As shown, the Z07 enzymatic hydrolysis group scored the highest in "blueberry aroma," significantly different from other groups and markedly different from the Z07 non-enzymatic hydrolysis group. This may be because enzymatic hydrolysis releases bound aromatic precursors, which, under the transformation of Z07, allow characteristic blueberry aroma compounds such as β-damastone to form. In addition, pectinase releases more fermentable sugars, providing abundant substrates for Z07 metabolism and indirectly promoting the formation of aroma compounds.

[0081] (6) Detection of volatile compounds Sample pretreatment: Take 5g of fermented plum juice and 2g of sodium chloride and place them in a 20mL sample bottle. Add 10μL of internal standard (4-methyl-2-pentanol, concentration 1.025mg / mL) and seal with the sample bottle cap with a polytetrafluoroethylene heat insulation pad.

[0082] HS-SPME pretreatment: Performed using a CTC CombiPAL autosampler (CTC Analytic, Zwingen, Switzerland) equipped with a 2 cm divinylbenzene / carboxylic acid / polydimethylsiloxane (DVB / CAR / PDMS) 50 / 30 µm SPME extraction head (Supelco, Bellefonte, PA, USA). The SPME extraction head was pre-aged at 270°C for 30 min before use. The headspace vial was incubated at 45°C for 20 min. After incubation, the pre-aged SPME extraction head was inserted into the headspace vial for 40 min of extraction at 45°C and an incubator shaking rate of 400 rpm / min to achieve liquid-gas-solid three-phase equilibrium.

[0083] Volatile component detection conditions: GC-MS analysis was performed using an Agilent 8890-5977B gas chromatograph-mass spectrometer equipped with an HP-INNOWAX capillary column (60 m × 0.25 mm × 0.25 μm) for sample separation. The GC injection port temperature was 250℃, and the desorption time for SPME analysis was 8 min. Splitless injection was used. The carrier gas was high-purity helium (purity >99.999%) at a flow rate of 1 mL / min. The temperature program was as follows: initial column oven temperature was 40℃, held for 3 min, then increased to 100℃ at a rate of 3℃ / min, then increased to 230℃ at a rate of 5℃ / min, held for 12 min. The final run temperature was 250℃, held for 5 min. The mass spectrometer used an electron impact ionization source (EI) with an ion source temperature of 230℃, an electron impact energy of 70 eV, a quadrupole temperature of 150℃, and a mass spectrometry interface temperature of 280℃. Data acquisition was performed in full-scan mode, with a mass scan range of 50–450 m / z. Three independent technical replicates were performed for each sample.

[0084] Qualitative analysis: Comparative analysis was performed using standards, RI values, and the NIST20 database. Raw GC-MS data were extracted using an MSD ChemStation (MSD ChemStation F.01.01.2317, Agilent). RI values ​​were corrected for n-alkanes (C7-C40) and calculated using an automated mass spectrometry convolution system (AMDIS 2.7.3).

[0085] Quantitative analysis: External standard method is used for quantification. Standard curves are plotted to accurately quantify volatile compounds. For compounds lacking standards, semi-quantitative analysis is performed using internal standards with similar chemical structures and carbon number.

[0086] The results showed that the fermented prune juice contained 12349.91±183.43 μg / L of phenylethanol, 9138.56±654.32 μg / L of isoamyl alcohol, 639.83±68.89 μg / L of eugenol, 344.85±12.47 μg / L of phenethyl acetate, 199.89±9.47 μg / L of linalool, and 193.79±23.97 μg / L of damascene.

[0087] The plum juice fermented with Lactobacillus plantarum LP90 contained 8048.22±190.08 μg / L of phenylethanol, 7937.45±140.26 μg / L of isoamyl alcohol, 607.66±50.17 μg / L of eugenol, 163.92±6.42 μg / L of phenethyl acetate, and 83.26±13.44 μg / L of linalool.

[0088] The plum juice fermented with Lactobacillus plantarum LP3 contained 11093.74±457.61 μg / L of phenylethanol, 8809.14±371.92 μg / L of isoamyl alcohol, 628.66±30.81 μg / L of eugenol, 221.08±13.44 μg / L of phenethyl acetate, 164.03±26.51 μg / L of damascene (fruity aroma), and 154.22±9.84 μg / L of linalool.

[0089] As shown in Table 5, the content of volatile compounds related to blueberry aroma in the Z07 enzymatic hydrolysis group was significantly higher than that in the LP90 and LP3 enzymatic hydrolysis groups.

[0090] Table 5. Volatile compound content of Z07, LP90, and LP3 enzymatic hydrolysis groups

[0091] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A method for preparing fermented prune juice, characterized in that, The fermented prune juice has a blueberry aroma, and the method includes the following steps: (1) Activated Lactobacillus plantarum ( Lactiplantibacillus plantarum Z07 was used to prepare a seed culture of *Lactobacillus plantarum* Z07. The plant lactobacillus ( Lactiplantibacillus plantarum Z07 was deposited on May 30, 2025 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34721, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. (2) Prune pulp was enzymatically hydrolyzed using pectinase, and then filtered to obtain prune juice; (3) Adjust the pH of the prune juice to 5 and sterilize it; (4) Inoculate the sterilized prune juice with *Lactobacillus plantarum* (Lactobacillus plantarum). Lactiplantibacillus plantarum Fermentation of Z07 seed liquid yields fermented prune juice with a blueberry aroma.

2. The method for preparing fermented prune juice according to claim 1, characterized in that, Step (2) involves adding pectinase to the prune pulp at a volume fraction of 0.2%, reacting at 50°C for 2 hours, and then filtering with 100-mesh gauze to obtain prune juice.

3. A method for preparing fermented prune juice according to claim 1 or 2, characterized in that, The sterilization process described in step (3) is pasteurization.

4. The method for preparing fermented prune juice according to claim 1, characterized in that, The fermentation described in step (4) is carried out at 37°C for 4 days.

5. Lactobacillus plantarum ( Lactiplantibacillus plantarum Z07 was deposited on May 30, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34721, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

6. The *Lactobacillus plantarum* as described in claim 5 ( Lactiplantibacillus plantarum Application of Z07 in the preparation of microbial preparations or fermented prune juice with blueberry aroma.

7. The application according to claim 6, characterized in that, In the microbial preparation, the *Lactobacillus plantarum* ( Lactiplantibacillus plantarum The bacterial count of Z07 is not less than 1×10⁻⁶. 8 CFU / mL or 1×10 8 CFU / g.

8. Containing the *Lactobacillus plantarum* as described in claim 5 ( Lactiplantibacillus plantarum Z07 microbial preparations or foods.

Citation Information

Patent Citations

  • Prunes fermented raw liquid and use for intestinal health care

    CN112655948A

  • Cellulase-ultrasonic cavitation assisted extraction method for flavones in sea buckthorn leaves

    CN115054620A

  • Fermentation inoculant, application of fermentation inoculant in rapid fermentation of prune juice and fermentation product

    CN116515685A

  • Prune enzyme and preparation method thereof

    CN117243370A

  • Oral liquid for reducing fat and promoting metabolism and preparation process thereof

    CN119924425A